CN116855462A - Genetically engineered bacterium for producing echinocandins medicine and application thereof - Google Patents

Genetically engineered bacterium for producing echinocandins medicine and application thereof Download PDF

Info

Publication number
CN116855462A
CN116855462A CN202210314827.4A CN202210314827A CN116855462A CN 116855462 A CN116855462 A CN 116855462A CN 202210314827 A CN202210314827 A CN 202210314827A CN 116855462 A CN116855462 A CN 116855462A
Authority
CN
China
Prior art keywords
echinocandins
leu
ser
ala
gly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210314827.4A
Other languages
Chinese (zh)
Inventor
陈少欣
卫腾云
杨松柏
吴远杰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Pharmaceutical Industry Research Institute Co ltd
Shanghai Pharmaceutical Industry Research Institute Co ltd
Original Assignee
China Pharmaceutical Industry Research Institute Co ltd
Shanghai Pharmaceutical Industry Research Institute Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Pharmaceutical Industry Research Institute Co ltd, Shanghai Pharmaceutical Industry Research Institute Co ltd filed Critical China Pharmaceutical Industry Research Institute Co ltd
Priority to CN202210314827.4A priority Critical patent/CN116855462A/en
Publication of CN116855462A publication Critical patent/CN116855462A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0077—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with a reduced iron-sulfur protein as one donor (1.14.15)
    • C12N9/0081—Cholesterol monooxygenase (cytochrome P 450scc)(1.14.15.6)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/50—Cyclic peptides containing at least one abnormal peptide link
    • C07K7/54—Cyclic peptides containing at least one abnormal peptide link with at least one abnormal peptide link in the ring
    • C07K7/56—Cyclic peptides containing at least one abnormal peptide link with at least one abnormal peptide link in the ring the cyclisation not occurring through 2,4-diamino-butanoic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/13—Transferases (2.) transferring sulfur containing groups (2.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/15—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced iron-sulfur protein as one donor, and incorporation of one atom of oxygen (1.14.15)
    • C12Y114/15006—Cholesterol monooxygenase (side-chain-cleaving) (1.14.15.6), i.e. cytochrome P450scc
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
    • C12Y208/02—Sulfotransferases (2.8.2)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a genetic engineering bacterium for producing echinocandins and application thereof. The genetically engineered bacterium comprises a substrateSuch a combination of genes includes a gene encoding the P450 monooxygenase CEP450-3 and a gene encoding the sulfonyltransferase CESUL derived from the filamentous fungus Coleophoma empetri. The invention also discloses an echinocandin compound, which comprises the modified sulfoxy group at the high tyrosine position of the cyclic lipopeptide. The invention also discloses a method for preparing the echinocandins compound by culturing the genetic engineering bacteria, and application of the genetic combination, the recombinant expression vector and the genetic engineering bacteria in producing the echinocandins compound. The genetically engineered bacterium of the invention can produce new compounds PBS and EcBS with sulfonyl oxygen modification, and the water solubility and antibacterial activity of the new compounds are respectively better than those of the original compounds PB without sulfonyl oxygen modification 0 And EcB.

Description

Genetically engineered bacterium for producing echinocandins medicine and application thereof
Technical Field
The invention belongs to the technical field of genetic engineering, and in particular relates to genetic engineering bacteria for producing echinocandins and application thereof, wherein the genetic engineering bacteria comprise a gene combination CEp-3 and CEsul. The invention also relates to new echinocandins compounds PBS and EcBS with sulfonyloxy modification produced by utilizing the genetically engineered bacteria.
Background
Micafungin is an echinocandin antibiotic and is approved by the FDA for market in 2006, and is mainly used for the treatment of deep fungal infections. The echinocandins also comprise caspofungin and anidulafungin, and the echinocandins inhibit the synthesis of fungal cell walls by non-competitively inhibiting the activity of cell wall 1, 3-beta glucan synthase, so that the echinocandins have good antifungal activity.
FR901379 is a key precursor for the synthesis of micafungin, produced by a filamentous fungus Coleophoma empetri F-11899, of the formula:
the biosynthesis mechanism is not reported yet.
New-Mokang B 0 (Pneumocandin B 0 ，PB 0 ) Is a key precursor for the synthesis of caspofungin, produced by filamentous fungi Glarea lozoyensis, and has the structural formula:
its biosynthetic pathway has been reported.
EcB (Echinocandin B) is a key precursor for the synthesis of anidulafungin, produced by the filamentous fungus Aspergillus pachycristatus NRRL11440, and has the structural formula:
its biosynthetic pathway has also been reported.
However, PB 0 Both EcB have the problem of poor water solubility, and therefore, improvement of PB is required 0 And EcB.
Disclosure of Invention
In order to solve the problem of low water solubility of echinocandins drugs in the prior art, a genetic engineering bacterium for producing echinocandins drugs and application thereof are provided.
The inventors speculate that FR901379 ratio PB 0 And EcB may be more water-soluble because of the modification of its chemical structure with sulfonyloxy groups at the high tyrosine constituting the cyclic lipopeptides, but the gene responsible for the modification is not yet defined. Because of PB 0 And EcB, which do not have such modifications, cannot be analyzed by the gene alignment method. The gene responsible for the synthesis of FR901379 was therefore knocked out in the filamentous fungus Coleophoma empetri F-11899 and finally screened therefrom for genes associated with the sulfonyloxy modification of FR 901379: CEp450-3 and CEsul, and the genes are respectively expressed in PB 0 The generation strains Glarea lozoyensis and EcB are subjected to heterologous expression in the generation strain A.pachlycristtus, and the obtained genetically modified strains are fermented to generate a series of novel echinocandins compounds, and the antibacterial activity of the novel echinocandins compounds is superior to that of the novel compounds which are not modified by sulfonyl oxygen.
In order to solve the technical problems, one of the technical schemes provided by the invention is as follows: a combination of genes comprising a gene encoding P450 monooxygenase CEP450-3 and a gene encoding a sulfonyltransferase CESUL from a filamentous fungus Coleophoma empetri.
In some preferred embodiments of the invention, the filamentous fungus Coleophoma empetri is Coleophoma empetri F-11899; and/or the amino acid sequence of CEP450-3 is shown as SEQ ID NO. 28; and/or the amino acid sequence of the CESUL is shown as SEQ ID NO. 30.
In some preferred embodiments of the invention, the nucleotide sequence encoding the CEP450-3 is shown in SEQ ID NO. 29 and/or the nucleotide sequence encoding the CESUL is shown in SEQ ID NO. 31.
In order to solve the technical problems, the second technical scheme provided by the invention is as follows: a recombinant expression vector comprising a combination of genes according to one of the claims.
In some preferred embodiments of the invention, the CEP450-3 and CESUL are on the same recombinant expression vector.
In some preferred embodiments of the invention, the backbone plasmid of the recombinant expression vector is pAg1-H3.
In order to solve the technical problems, the third technical scheme provided by the invention is as follows: a genetically engineered bacterium comprising a genetic combination according to one of the technical schemes or a recombinant expression vector according to the second of the technical schemes.
In some preferred embodiments of the invention, the genetically engineered bacterium uses echinocandins compound producing bacterium as a starting bacterium.
In some preferred embodiments of the invention, the echinocandin class compound producing bacterium is Glarea lozoyensis or Aspergillus pachycristatus.
In order to solve the technical problems, the fourth technical scheme provided by the invention is as follows: an echinocandin compound has a structure shown in a formula I:
wherein R is 1 Is C 1-20 Alkyl or C 2-20 Alkenyl groups;
R 2 is H or C 1-6 An alkyl group;
R 3 is C 1-6 Alkyl or quiltSubstituted C 1-6 An alkyl group;
X + is a monovalent cation;
the carbon atoms with "×" are chiral or achiral carbon atoms, and when chiral, are in the R configuration and/or S configuration.
In one embodiment, the X in formula I + Is Na (Na) + 、K + Or NH 4 + For example Na + 。
In one embodiment, R 1 In the above, the C 1-20 Alkyl is C 10-20 Alkyl groups, e.g. of
In one embodiment, R 1 In the above, the C 2-20 Alkenyl group is C 10-20 Alkenyl radicals, e.g. of
In one embodiment, R2 is the same as the C 1-6 Alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl or tert-butyl; preferably methyl.
In one embodiment, R 3 In the above, the C 1-6 Alkyl and quiltSubstituted C 1-6 C in alkyl 1-6 Alkyl is independently methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, or tert-butyl; preferably methyl.
In a certain scheme, the echinocandins compound is:
in order to solve the technical problems, the fifth technical scheme provided by the invention is as follows: a method for producing the echinocandins according to the fourth aspect, comprising culturing the genetically engineered bacterium according to the third aspect in a fermentation medium so that the echinocandins are expressed and produced.
In some embodiments of the invention, the fermentation medium has a pH of from 6.0 to 7.0 and/or comprises from 80 to 120g/L mannitol, from 4 to 6g/L cotton seed meal, from 8 to 12g/L soybean meal, from 3 to 5g/L K 2 HPO 4 And 0.8-1.2 g/L CaCO 3 The method comprises the steps of carrying out a first treatment on the surface of the And/or the temperature of the culture is 23-27 ℃, and/or the rotation speed of the culture is 200-240 rpm, and/or the time of the culture is 8-12 days.
In some preferred embodiments of the invention, the pH of the fermentation medium is 6.5; the mannitol concentration is 100g/L, the cotton seed cake powder concentration is 5g/L, the soybean cake powder concentration is 10g/L, and the K is the same as the cotton seed cake powder 2 HPO 4 At a concentration of 4g/L, caCO 3 The concentration is 1g/L; the temperature is 25 ℃; the rotating speed is 220rpm; the time period was 10 days.
In order to solve the technical problems, the sixth technical scheme provided by the invention is as follows: the gene combination according to one of the technical schemes, the recombinant expression vector according to the second technical scheme or the genetically engineered bacterium according to the third technical scheme is applied to the production of the echinocandins compound according to the fourth technical scheme.
On the basis of conforming to the common knowledge in the field, the above preferred conditions can be arbitrarily combined to obtain the preferred examples of the invention.
The reagents and materials used in the present invention are commercially available.
The invention has the positive progress effects that:
genes that might be associated with modifications responsible for sulfonyloxy groups during FR901379 synthesis were obtained by knockout experiments. And the gene is put in PB 0 And EcB, to obtain new compounds PBS and EcBS with sulfonyloxy modification. The water solubility and the antibacterial activity of the novel compounds PBS and EcBS are respectively superior to those of the novel compounds which are not modified by the original sulfonyl oxygen groupsObject PB 0 And EcB.
Drawings
FIG. 1 is an HPLC plot of the fermentation products of the control strain Ce-PC and the knockout strain C.e (Δ CEp 450-3).
FIG. 2 is an HPLC plot of the fermentation products of the control strain Ce-PC and the knockout strain C.e (. DELTA.CEsul).
FIG. 3 PB is a graph 0 And PBS fermentation HPLC profile.
FIG. 4 is a graph of EcB and EcBS fermentation HPLC.
Detailed Description
The invention is further illustrated by means of the following examples, which are not intended to limit the scope of the invention. The experimental methods, in which specific conditions are not noted in the following examples, were selected according to conventional methods and conditions, or according to the commercial specifications.
Construction of the knockout strain:
firstly, a plasmid pDHt/sk-PC containing cas9 gene is introduced into a starting strain Coleophoma empetri F-11899 by an agrobacterium-mediated (Agrobacterium tumefaciens-mediated transformation, AMT) method to obtain an engineering strain Ce-PC. The method is characterized in that an sgRNA expression box for gene knockout is constructed by utilizing a molecular cloning method on the basis of a plasmid pAgG, the expression box takes 5s rRNA as a promoter to guide the transcription of N20 and the sgRNA, and N20 is a target gene sequence of 20bp for knocking out a target gene. For the different genes of interest, the designed N20 is as follows in table 1:
TABLE 1
Gene SEQ ID NO： N20
CEp450-3 1 AAGTTCTGCGCAAGACTAGA
CEsul 2 tgcctaggactatgtcgaac
e20_02930 3 TCCCAAGTCTCACAGAGCAA
Introducing the constructed knockout plasmid into engineering strain Ce-PC, picking up the transformant, carrying out PCR verification and screening on the transformant, fermenting and culturing the obtained knockout strain, detecting a fermentation product by HPLC, and analyzing the molecular weight of the product by LC-MS.
Finally, all compounds of this patent were tested for antifungal activity.
The strain, plasmid, reagent, instrument and HPLC detection method used in the invention:
strains Aspergillus pachycristatus NRRL11440 and Glarea lozoyensis ATCC 20868 were purchased from NRRL and ATCC seed collection, respectively. Agrobacterium tumefaciens LBA4404 competence for AMT was purchased from the local biosystems. Plasmid pAg1-H3 was from the national academy of sciences of microorganisms. pDHt/sk-PC is from the plant physiological and ecological institute of research, shanghai life sciences, china academy of sciences, and the database research group.
The DNA gel recovery and purification kit and the plasmid extraction kit used in the invention are purchased from Shanghai, the reverse transcription kit, the PCR enzyme and all restriction enzymes are purchased from Takara, the homologous recombination kit (ClonExpress II One Step Cloning Kit) is purchased from Vazyme, the chromatographic pure acetonitrile is purchased from Amethyst Chemicals, and other conventional reagents are homemade analytical pure or imported split-charging.
The constant temperature fermentation shaker used in the present invention was purchased from Shanghai Shiping laboratory equipment Co., ltd, and the 1200 type high performance liquid chromatograph was purchased from Agilent Technologies company.
Culture medium used in the present invention
1. Liquid LB medium (1L)
10g of peptone, 5g of yeast extract, 10g of NaCl and 1L of distilled water; sterilizing at 121deg.C for 20 min.
2. Solid LB medium (1L)
10g of peptone, 5g of yeast extract, 10g of NaCl and 20g of agar powder; sterilizing at 121deg.C for 20 min.
3. PPY medium (1L): 20g of high polymer peptone, 20g of yeast extract and 20g of potato broth.
4. Induction liquid Medium (IM) 0.8mL K buffer,20mL MN buffer,1mL 1%CaCl 2 ·2H 2 O,10mL 0.01％FeSO 4 ·7H 2 O,5mL trace elements, 2.5mL 20% ammonium nitrate, 10mL 50% glycerol, 40mL 1M MES,10mL 20% glucose, and 905.7mL sterile water were added.
The solution used in the medium:
1％CaCl 2 ·2H 2 o: 1g CaCl was weighed out 2 ·2H 2 O, adding water to a volume of 100mL, and sterilizing before use.
0.01％FeSO 4 ·7H 2 O: weighing 0.01g FeSO 4 ·7H 2 O, adding water to a volume of 100mL, and filtering and sterilizing before use.
20% glucose: weighing 20g of glucose, adding water to a volume of 100mL, and sterilizing before use.
50% glycerol: 50mL of glycerin is measured and mixed with 50mL of water, and sterilization is needed before use.
20% ammonium nitrate: 20g of ammonium nitrate is weighed, water is added to fix the volume to 100mL, and sterilization is needed before use.
K buffer: will be 1.25M K 2 HPO 4 ·3H 2 O addition 1.25M K 2 HPO 4 Until the pH is 4.8, sterilization is required before use.
MN buffer: weigh 3g MgSO 4 ·7H 2 O and 1.5g NaCl, water is added to a volume of 100mL, and sterilization is needed before use.
Trace elements: weighing 10mg ZnSO 4 ·7H 2 O,10mg CuSO 4 ·5H 2 O,10mg H 3 BO 3 ,10mg MnSO 4 ·H 2 O,10mg NaMoO 4 ·2H 2 O, adding water to a volume of 100mL, and sterilizing before use.
1M MES: 10.66g MES was weighed, dissolved in water, pH adjusted to 5.3 and volume fixed to 50mL. Stored in a refrigerator at-20deg.C, and filtered for sterilization before use.
0.2M AS: 785mg of AS is weighed, dissolved in DMSO, fixed to 20mL, stored in a refrigerator at 20 ℃ in a dark place, and filtered for sterilization before use.
5. Inducing a solid culture medium: 0.8mL K buffer,20mL MN buffer,1mL 1%CaCl to sterilized sterile water containing 2% agar powder 2 ·2H 2 O,10mL 0.01％FeSO 4 ·7H 2 O,5mL trace elements, 2.5mL 20% ammonium nitrate, 10mL 50% glycerol, 40mL 1M MES,10mL 20% glucose.
6. Seed culture medium formulation (1L):
20g of glucose, 10g of soybean cake powder and KH 2 PO 4 2g, pH 6.5; sterilizing at 121deg.C for 20 min.
7. Fermentation medium formula (1L):
100g of mannitol, 5g of cottonseed cake powder, 10g of soybean cake powder and K 2 HPO 4 4g，CaCO 3 1g, pH 6.5; sterilizing at 121deg.C for 20 min.
The HPLC detection method in the invention comprises the following steps:
HPLC liquid phase detection method:
mobile phase: 50% acetonitrile and 50% water (containing 0.5% NaH) 2 PO 4 )；
Chromatographic column: c18 4.6X1250 nm;
flow rate: 1mL/min;
detection wavelength: 210nm;
column temperature: 30 ℃;
sample injection amount: 20. Mu.L.
The base sequences of the primers used in the present invention are shown in Table 2 below, wherein-F represents the upstream primer and-R represents the downstream primer.
TABLE 2
Example 1 Gene knockout and product analysis of CEp450-3
The amino acid sequence of the gene CEp450-3 knocked out in this example is shown in SEQ ID NO. 28, and the nucleotide sequence is shown in SEQ ID NO. 29.
1. Constructing a plasmid:
(1) Construction of pAgG and pAgG-sgRNA-CEp450-3
A trpC promoter fragment (fragment 1) was obtained by PCR using pAg1-H3 as a template and the primer Ptrpc-F/R (the base sequence of the primer used in this example is shown in Table 2). The G418 resistance gene Neo fragment (fragment 2) was obtained by PCR with the plasmid pEGFP-N2 as a template and the primer NeoR-F/R. PCR was performed using pAg1-H3 as a template and the primer Ttrpc-F/R to obtain trpC terminator fragment (fragment 3). Overlapping PCR is carried out by using PCR fragment 1, fragment 2 and fragment 3 as templates and primers Ptrpc-F and Ttrpc-R to obtain a G418 resistance gene expression cassette, and the expression cassette is connected to a HindIII/SpeI linearized pAg1-H3 vector to finally obtain plasmid pAg1-HG. pAgG 1-HG was excised by EcoRI and self-ligated to give pAgG.
The 5S rRNA fragment was obtained by PCR using Coleophoma empetri F-11899 genome as a template and 5S-F/R as primers. Using N20-CEp450-3-F and sgRNA-R as primers, a fragment of sgRNA specifically recognizing CEp450-3 was obtained by PCR. Overlapping PCR was performed using the 5S rRNA fragment and the sgRNA fragment as templates and 5S-F and sgRNA-R as primers to obtain the sgRNA expression cassette. The expression cassette is connected to a pAgG linear vector subjected to BglII/EcoRI digestion by using a homologous recombination kit (ClonExpress II One Step Cloning Kit) to obtain a knockout plasmid pAgG-sgRNA-CEp450-3.
2. Construction of knockout Strain
Using AMT, plasmid pAgG-sgRNA-CEp450-3 was introduced into Ce-PC strain, and the resulting strain was selected to obtain engineering strain C.e (Delta CEp 450-3).
3. Fermentation of engineering Strain C.e (delta CEp 450-3)
To examine the fermentation product of engineering strain C.e (Δ CEp 450-3), it was inoculated into 20mL of seed medium, 25 ℃,220rpm, cultured for 4 days, inoculated into 30mL of fermentation medium at 10% inoculum size, 25 ℃,220rpm, and cultured for 10 days.
4. HPLC detection
Fermentation products were detected by reverse phase HPLC (agilent): taking 2mL of fermentation liquor, adding 8mL of acetone, fully and uniformly mixing, carrying out ultrasonic vibration for 30min, and filtering to obtain filtrate for detection, wherein the result is shown in figure 1.
The results show that: the molecular weight of the fermentation product compound 6 of the engineering strain C.e (delta CEp 450-3) is 1126, and the structure of the analyzed compound 6 is as follows:
the enzyme encoded by this gene is presumed to be involved in the synthesis of FR901379 sulfonyloxy.
5. Antifungal Activity: the results of the antibacterial activity of compound 6 are shown in table 3, and from the results, compound 6 has antifungal activity.
Example 2 CEsul Gene knockout and product analysis
The amino acid sequence of the CEsul gene knocked out in this example is shown in SEQ ID NO. 30, and the nucleotide sequence is shown in SEQ ID NO. 31.
1. Constructing a plasmid:
(1) Construction of pAgG-sgRNA-CEsul
The 5S rRNA fragment was obtained by PCR using Coleophoma empetri F-11899 genome as a template and 5S-F/R as primers. Using N20-CEsul-F and sgRNA-R as primers, a fragment of sgRNA specifically recognizing CEsul was obtained by PCR. Overlapping PCR was performed using the 5S rRNA fragment and the sgRNA fragment as templates and 5S-F and sgRNA-R as primers to obtain the sgRNA expression cassette. The expression cassette was ligated to the bgg linear vector treated with BglII/EcoRI cleavage using homologous recombination kit (ClonExpress II One Step Cloning Kit) to give knockout plasmid pAgG-sgRNA-CEsul.
2. Construction of knockout Strain
Using AMT, plasmid pAgG-sgRNA-CEsul was introduced into Ce-PC strain, and the resultant strain was selected to obtain engineering strain C.e (. DELTA.CEsul).
3. Fermentation of engineering Strain C.e (ΔCEsul)
To examine the fermentation product of engineering strain C.e (ΔCEsul), it was inoculated into 20mL of seed medium, 25 ℃,220rpm, cultured for 2 days, and inoculated into 30mL of fermentation medium at 10% inoculum size, 25 ℃,220rpm, cultured for 10 days.
4. HPLC detection
Fermentation products were detected by reverse phase HPLC (agilent): taking 2mL of fermentation liquor, adding 8mL of acetone, fully and uniformly mixing, carrying out ultrasonic vibration for 30min, and filtering to obtain filtrate for detection.
The results show that: the fermentation product of engineering strain C.e (Δcesul) did not produce FR901379, and the enzyme encoded by this gene was presumed to be a sulfonyltransferase involved in the synthesis of FR901379 sulfonyloxy, as shown in fig. 2.
Comparative example 1 Sulfonyltransferase Gene e20_02930 knockout and product analysis
The amino acid sequence of the gene e20_02930 knocked out in this example is shown in SEQ ID NO. 32, and the nucleotide sequence is shown in SEQ ID NO. 33.
1. Constructing a plasmid:
(1) Construction of pAgG-sgRNA-02930
The 5S rRNA fragment was obtained by PCR using Coleophoma empetri F-11899 genome as a template and 5S-F/R as primers. Using N20-02930-F and sgRNA-R as primers, a fragment of sgRNA specifically recognizing e20_02930 was obtained by PCR. Overlapping PCR was performed using the 5S rRNA fragment and the sgRNA fragment as templates and 5S-F and sgRNA-R as primers to obtain the sgRNA expression cassette. The expression cassette was ligated to the BglII/EcoRI digested pAgG linear vector using homologous recombination kit (ClonExpress II One Step Cloning Kit) to give knockout plasmid pAgG-sgRNA-02930.
2. Construction of knockout Strain
Using AMT, plasmid pAgG-sgRNA-02930 was introduced into Ce-PC strain, and the resulting strain was selected to obtain engineering strain C.e (Δ 02930).
3. Fermentation of engineering strain C.e (delta 02930)
To examine the fermentation product of engineering strain C.e (Δ 02930), it was inoculated into 20mL of seed medium, 25 ℃,220rpm, cultured for 4d, inoculated into 30mL of fermentation medium at 10% inoculum size, 25 ℃,220rpm, and cultured for 10 days.
4. HPLC detection
Fermentation products were detected by reverse phase HPLC (agilent): taking 2mL of fermentation liquor, adding 8mL of acetone, fully and uniformly mixing, carrying out ultrasonic vibration for 30min, and filtering to obtain filtrate for detection.
The results show that: the fermentation product of the engineering strain C.e (delta 02930) is indistinguishable from the original strain, and FR901379 is still produced, and it is presumed that the sulfonyltransferase encoded by the gene is not involved in the sulfonyloxy synthesis of FR 901379.
EXAMPLE 3 heterologous expression and use of CEP450-3 and CESUL in PB0 producing Strain Glarea lozoyensis
1. Construction of expression plasmids:
the G.lozoyensis genome is used as a template, and primers Pgpd-F/R and Tgpd-F/R are used for PCR to obtain glgpd promoter and terminator fragments. PCR was performed using the C.empetri cDNA as a template and CEP450-3-F/R to obtain fragment CEP450-3. And (3) performing overlap PCR by using the obtained three fragments as templates and Pgpd-F and Tgpd-R as primers to obtain Pglgpd-CEP450-3-Tglgpd. The fragment was ligated to PvuII/EcoRI linearized pAg1-H3 vector using a homologous recombination kit to give pAg1-H3-Pglgpd-CEp450-3.
The Coleophoma empetri genome is used as a template, and primers Pcegpd-F/R and Tcegpd-F/R are used for PCR to obtain cegpd promoter and terminator fragments. The fragment CESUL was obtained by PCR using the C.empetri cDNA as a template and CESUL-F/R. And (3) performing overlap PCR by using the two obtained fragments as templates and Pcegpd-F and Tcegpd-R as primers to obtain Pcegpd-CESUL-Tcegpd. The fragment was ligated into SalI/SpeI linearized pAg1-H3 vector using a homologous recombination kit to give pAg1-H3-Pcegpd-CESUL.
The constructed pAg1-H3-Pcegpd-CESUL was double-cut with SalI/SpeI, and a fragment of 3438bp in size was recovered. The constructed pAg1-H3-Pglgpd-CEp450-3 was double-cut with SalI/SpeI to recover a 10459bp fragment. The two recovered fragments were ligated using T4 ligase to obtain pAg1-H3-CEP450-3+CESUL.
2. Construction of engineering strains
The three plasmids pAg1-H3-Pcegpd-CESUL, pAg1-H3-Pglgpd-CEp450-3 and pAg1-H3-CEP450-3+CESUL were introduced into the G.lozoyensis strain by AMT, respectively, to obtain engineering strains Gl-CEP450-3, gl-CESUL and Gl-CEP450-3+CESUL.
3. Analysis of engineering strain products:
the strain was inoculated into 20mL of seed medium, at 25℃and 220rpm, cultured for 4 days, inoculated into 30mL of fermentation medium at 10% inoculum size, and cultured for 10 days at 25℃and 220 rpm. Taking 2mL of fermentation liquor, adding 8mL of absolute ethyl alcohol, fully and uniformly mixing, carrying out ultrasonic vibration for 30min, and filtering to obtain filtrate for detection.
New compound PBS was detected from strain Gl-CEP450-3+CESUL, and the fermentation yield is shown in Table 4, and the structure is:
fermentation of the original strain G.lozoyensis and the engineering strain Gl-CEP450-3+CESUL to PB production, respectively 0 And the HPLC profile of PBS is shown in figure 3.
4. Antifungal Activity:
caspofungin, PB 0 And the antibacterial activity of the novel compound PBS are shown in Table 3, and it can be seen from Table 3 that the antibacterial activity of PBS is superior to PB 0 。
5. Solubility: PB (PB) 0 And the solubility of the novel compound PBS is shown in Table 4, and it can be seen from Table 4 that the solubility of PBS is superior to PB 0 。
EXAMPLE 4 heterologous expression and use of CEP450-3 and CESUL in the EcB producer strain A. Pachlysttatus NRRL11440
1. Construction of engineering strains
The three plasmids pAg1-H3-Pcegpd-CESUL, pAg1-H3-Pglgpd-CEp450-3 and pAg1-H3-CEP450-3+CESUL were introduced into the A.pachrystatitus strain by AMT, respectively, to obtain engineering strains Ap-CEP450-3, ap-CESUL and Ap-CEP450-3+CESUL.
3. Analysis of engineering strain products:
the strain was inoculated into 20mL of seed medium, at 25℃and 220rpm, cultured for 2 days, inoculated into 30mL of fermentation medium at 10% inoculum size, and cultured for 10 days at 25℃and 220 rpm. Taking 2mL of fermentation liquor, adding 6mL of acetone, fully and uniformly mixing, carrying out ultrasonic vibration for 30min, and filtering to obtain filtrate for detection.
The novel compound EcBS was detected from the strain Ap-CEP450-3+CESUL, and the fermentation yield is shown in Table 4, and the structure is:
HPLC profiles of EcB and EcBS, respectively, were generated by fermentation of the original strain A. Pachlysttatus and the engineered strain Ap-CEP450-3+CESUL, as shown in FIG. 4.
4. Antifungal Activity:
the results of the antimicrobial activity of anidulafungin, ecB and the novel compound EcBS are shown in table 3, and it can be seen from table 3 that the antimicrobial activity of EcBS is better than EcB.
5. Solubility: ecB and the solubility of the novel compound EcBS are shown in table 4, and as can be seen from table 4, the solubility of EcBS is better than EcB.
TABLE 3 antibacterial Activity detection results
Fermentation yield and solubility of the compounds of Table 4
Compounds of formula (I) Fermentation yield Water-solubility
EcB 1g/L 0.5g/L
EcBS 0.6g/L 10g/L
PB 0 2g/L 1g/L
PBS 1.8g/L 20g/L
SEQUENCE LISTING
<110> Shanghai pharmaceutical industry Co., ltd
China medical industry research institute Co Ltd
<120> a genetically engineered bacterium for producing echinocandins and application thereof
<130> P22010843C
<160> 33
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> CEp450-3 N20
<400> 1
aagttctgcg caagactaga 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> CEsul N20
<400> 2
tgcctaggac tatgtcgaac 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> e20_02930 N20
<400> 3
tcccaagtct cacagagcaa 20
<210> 4
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Ptrpc-F
<400> 4
acccaagctt gggaatcgat gatcaggcct cgac 34
<210> 5
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Ptrpc-R
<400> 5
aatccatctt gttcaatcat ttggatgctt gggtagaata 40
<210> 6
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> NeoR-F
<400> 6
tattctaccc aagcatccaa atgattgaac aagatggatt 40
<210> 7
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> NeoR-R
<400> 7
gatcccggtc ggcatctact tcagaagaac tcgtcaagaa 40
<210> 8
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Ttrpc-F
<400> 8
ttcttgacga gttcttctga agtagatgcc gaccgggatc 40
<210> 9
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Ttrpc-R
<400> 9
ctggactagt ccttcgtccg gcgtagagga tcct 34
<210> 10
<211> 46
<212> DNA
<213> Artificial Sequence
<220>
<223> sgRNA-R
<400> 10
gactagtcgg gggatcctct agatcttctg caggtcgact ctagag 46
<210> 11
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> 5S-F
<400> 11
gttgtaaaac gacggccagt gaaacgttgg acgcgccgct 40
<210> 12
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> 5S-R
<400> 12
ggtgtttcgt cctttcatac aaca 24
<210> 13
<211> 54
<212> DNA
<213> Artificial Sequence
<220>
<223> Pgpd-F
<400> 13
gttgtaaaac gacggccagt actatctcct cgagtgtcac ttcgcgtctt tgtc 54
<210> 14
<211> 58
<212> DNA
<213> Artificial Sequence
<220>
<223> Pgpd-R
<400> 14
gcagcacatc cccctttcgc caggtatccc gggagcgctg tgagtcgatg gcgaaatc 58
<210> 15
<211> 42
<212> DNA
<213> Artificial Sequence
<220>
<223> Tgpd-F
<400> 15
gaatacttgt ggaagcataa ggtcttcacc actcatttct ca 42
<210> 16
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> Tgpd-R
<400> 16
cccctttcgc caggtatccc gggagcgctg tgagtcgatg gcgaaatcg 49
<210> 17
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> CEP450-3-F
<400> 17
aatcttcacc agaaaacaat atgataaatc ttgcaagtcc 40
<210> 18
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> CEP450-3-R
<400> 18
gaaatgagtg gtgaagacct tatgcttcca caagtattct 40
<210> 19
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> N20-CESUL-N20-F
<400> 19
tctcgcgaga ggagatatcg gttttagagc tagaaatagc 40
<210> 20
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> N20-CEP450-3-N20-F
<400> 20
aagttctgcg caagactaga gttttagagc tagaaatagc 40
<210> 21
<211> 59
<212> DNA
<213> Artificial Sequence
<220>
<223> N20-02930-F
<400> 21
tatgaaagga cgaaacacct cccaagtctc acagagcaag ttttagagct agaaatagc 59
<210> 22
<211> 47
<212> DNA
<213> Artificial Sequence
<220>
<223> CESUL-F
<400> 22
tactaacaag caatcagaat catggcttta gaccgccaga atgcgaa 47
<210> 23
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> CESUL-R
<400> 23
tcggtaagga agagaagacc ctacttccta gctagccaaa 40
<210> 24
<211> 52
<212> DNA
<213> Artificial Sequence
<220>
<223> Pcegpd-F
<400> 24
ggagaattaa gggagtcacg aagcttgtcg acgcacttgt ggtatgaata ga 52
<210> 25
<211> 46
<212> DNA
<213> Artificial Sequence
<220>
<223> Pcegpd-R
<400> 25
actaacaagc aatcagaatc atggctttag accgccagaa tgcgaa 46
<210> 26
<211> 46
<212> DNA
<213> Artificial Sequence
<220>
<223> Tcegpd-F
<400> 26
gtttagaggt aatccttctt actagtaagg gggggtttat gttggt 46
<210> 27
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Tcegpd-R
<400> 27
tttggctagc taggaagtag ggtcttctct tccttaccga 40
<210> 28
<211> 500
<212> PRT
<213> Artificial Sequence
<220>
<223> CEP450-3 amino acid sequence
<400> 28
Met Ile Asn Leu Ala Ser Pro Leu Phe Ala Thr Thr Ala Val Leu Val
1 5 10 15
Trp Leu Ser Ser Leu Ile Ile Tyr Arg Leu Tyr Leu Ser Pro Leu Ser
20 25 30
Arg Phe Pro Gly Pro Lys Leu Ala Ala Leu Thr Gly Trp Tyr Glu Thr
35 40 45
Tyr Phe Asp Leu Phe Lys Arg Gly Arg Tyr Trp Ile Glu Ile Glu Arg
50 55 60
Met His Glu Val Tyr Gly Pro Ile Ile Arg Ile Asn Pro Asn Glu Leu
65 70 75 80
His Val Asn Asp Pro Glu Trp Asn Glu Pro Tyr Lys Ile Ser Gly Arg
85 90 95
Val Asp Lys Tyr Asp Trp Tyr Tyr Thr Phe Val Gly Ser Ser Gly Ser
100 105 110
Ser Ser Ala Phe Gly Thr Ile Asp His Asp Val His Arg Gly Arg Arg
115 120 125
Lys Ala Gln Gln Gly Tyr Phe Thr Thr Asp Ala Ile Thr Arg Phe Glu
130 135 140
Pro His Leu Glu Thr Leu Thr Ala Lys Phe Cys Ala Arg Leu Asp Gly
145 150 155 160
Phe Lys Gly Thr Gly Lys His Val Asn Leu Ser Asp Ala Phe Arg Ser
165 170 175
Ile Ala Val Asp Val Ala Ala Met Phe Thr Leu Asn Gln Ser Tyr Gly
180 185 190
Phe Ile Asp Asp Pro Asp Phe Lys Ala Glu Val His Gln Gly Ile Arg
195 200 205
Ala Phe Pro Asp Ile Gly Val Leu Asn Arg His Phe Thr Gly Leu Phe
210 215 220
Val Val Leu Glu Ser Ile His Arg Trp Val Leu Ser Val Ile Asn Pro
225 230 235 240
Ser Glu Glu Asp Asn Gly Leu Leu Thr Ser Arg Ile Asn Leu His Cys
245 250 255
Lys Ala Ile Ile Ala Asp Tyr Ala Ser Lys Lys Gly Asp Val Lys Pro
260 265 270
Asn Ile Ile His Arg Met Leu Asp Ala Pro Glu Leu Ser Met Lys Asp
275 280 285
Lys Thr Ala Trp Arg Leu Gln Leu Glu Ala Arg Thr Leu Ile Gly Ala
290 295 300
Gly Thr Glu Thr Thr Gly His Thr Leu Ala Val Ile Ala Phe His Leu
305 310 315 320
Leu Ala Asn Pro Glu Lys Ala Lys Arg Leu Lys Glu Glu Ile Leu Ala
325 330 335
Thr Lys Glu Gly Arg Glu Lys Pro Leu Thr Tyr Gln Glu Leu Gln Met
340 345 350
Leu Pro Tyr Leu Ser Ser Val Val Leu Glu Gly His Arg Ile Ser Ser
355 360 365
Val Val Ser Gly Arg Leu Pro Arg Val Asn Thr Lys Glu Pro Leu Arg
370 375 380
Tyr Gly Asp Tyr Ser Ile Pro Ile Gly Thr Pro Val Ser Thr Thr Gln
385 390 395 400
Arg Leu Thr His Tyr Asn Ala Thr Ile Phe Pro Ser Pro Asn Thr Phe
405 410 415
Leu Pro Glu Arg Trp Leu Gln Pro Ser Glu Arg Lys Arg Leu Glu Lys
420 425 430
Tyr Ile Gln Pro Phe Gly Arg Gly Ser Arg Ser Cys Ile Gly Met His
435 440 445
Leu Ala Asn Ala Glu Ile Tyr Lys Thr Leu Ala Glu Met Phe Ala Arg
450 455 460
Phe Asp Met Lys Leu Tyr Asp Thr Glu Phe Glu Asp Ile Met Gln Val
465 470 475 480
His Asp Phe Phe Thr Ser Phe Pro Ser Ser Glu Arg Gly Leu Arg Ile
485 490 495
Leu Val Glu Ala
500
<210> 29
<211> 1802
<212> DNA
<213> Artificial Sequence
<220>
<223> CEp DNA sequence of 450-3 (containing introns)
<400> 29
atgataaatc ttgcaagtcc cctcttcgca acaacagcag ttctagtctg gctcagcagt 60
ctcataatct atcgcctata tctctctcca ctatctcgat ttcccggccc aaaactcgct 120
gctctaacag gatggtacga gacatacttc gacctcttta aacggggtcg ctactggatc 180
gagattgaac gcatgcacga agtctatggt aagtttgtat tttcttcaat aaaaagcgga 240
tatattttga caccagccag gccctatcat ccgcatcaat cccaatgagc tacatgttaa 300
tgacccagaa tggaatgagc cctacaagat cagcggccgc gttgacaagt atgactggta 360
ctacaccttt gttggtagtt ccggatcctc atctgcattc ggaaccatag accacgacgt 420
tcatcgtggc cgccggaaag ctcaacaggg ctatttcacc accgacgcca tcacgcgctt 480
tgaaccacat ttagaaaccc tgacagcaaa gttctgcgca agactagacg gcttcaaggg 540
gacgggaaag catgttaatc tctccgatgc gttccgatca atcgcggtgg atgtggccgc 600
gatgtttaca ttgaatcaat cgtatggttt catcgatgac ccggatttca aggccgaggt 660
ccatcaaggg atccgggcat ttccggatat tggagtgctg aatcgccatt ttacgggttt 720
gttcgtggtt ttggagtcaa tccatagatg ggtgttgagt gttatcaacc cgtcagaaga 780
agataatggg ttactcacaa gtgtacgtat ctttccacta atactgcttt ccccgagatc 840
ctaatgcgtg atagagaata aacctgcatt gtaaagctat tattgccgac tacgccagta 900
agaaaggcga cgtcaagccc aatatcattc acagaatgct agacgcacca gaactatcga 960
tgaaagataa gacagcgtgg cgccttcaat tggaggcgcg cacccttata ggagctggaa 1020
ctgaaacgac aggacacaca ttagccgtca tagcattcca tctgctagca aatccggaga 1080
aggcaaagag gttgaaggag gagatcttag ctacgaaaga agggcgggaa aagcctttaa 1140
cttatcagga gttacaaatg cttccgtatt tagtgagtgt attgttatgg tctgcagagc 1200
atggctaatg aaagcagtct tctgtggtcc ttgaaggtca tcggtaggga gttgattttt 1260
acttttcaga agatgaggct aataacctgt agcatttcta gtgttgtatc aggtcgtctg 1320
ccacgggtca atacaaaaga gccgctcaga tatggtgact atagtatccc tattggcgca 1380
agttttcctc tcctttcgct ctctttctat aactgacgga ttagacagac acccgtcagc 1440
accacccaac ggttaacaca ctacaatgcc accatattcc cctccccaaa cacattcctc 1500
cccgaacgtt ggcttcagcc ctcggaacga aagcgcctgg agaaatacat ccagccgttc 1560
gggcgtggct caagatcttg tataggcatg cagtaagtct cgtcccctat tcgagtgtga 1620
ctaaaatgac taatgagaga agtcttgcaa atgcagagat ttacaaaaca ttggcggaga 1680
tgtttgcaag gtttgacatg aagttatatg atacggagtt cgaggatatt atgcaagtgc 1740
atgacttttt tacttcgttt ccatcgagcg agaggggttt aagaatactt gtggaagcat 1800
aa 1802
<210> 30
<211> 282
<212> PRT
<213> Artificial Sequence
<220>
<223> CESUL amino acid sequence
<400> 30
Met Ala Leu Asp Arg Gln Asn Ala Lys Val Thr Thr Phe Gly Leu Ser
1 5 10 15
Lys Pro Lys Thr Asn Ile Asp Arg Arg Ser Cys Gln Arg Thr Val Pro
20 25 30
Met Lys Val Leu Cys Leu Gly Leu Cys Arg Thr Gly Thr Ser Ser Leu
35 40 45
Arg Ala Ala Leu Phe Glu Leu Gly Leu Asp Asp Val Tyr His Met Cys
50 55 60
Ser Val Thr Glu Glu Asn Pro Leu Asp Ser Lys Leu Trp Lys Glu Ala
65 70 75 80
Phe Asp Ala Lys Tyr Glu Gly Ile Gly Lys Pro Tyr Gly Arg Ala Glu
85 90 95
Phe Asp Ala Leu Leu Gly His Cys Met Ala Thr Ser Asp Phe Pro Ser
100 105 110
Val Ala Phe Ala Pro Glu Leu Ile Ala Ala Tyr Pro Glu Ala Lys Ile
115 120 125
Ile Leu Thr Val Arg Asp Asn Ala Asp Val Trp Tyr Asp Ser Val Leu
130 135 140
Asn Thr Ile Trp Arg Val Ser Asn Phe Leu Arg Ala Pro Pro Arg Thr
145 150 155 160
Leu Thr Gln Arg Val Val Gln Ala Ile Leu Pro Lys Pro Asp Phe Asn
165 170 175
Ile Phe Lys Tyr Ser Pro Leu Gly Asn Phe Pro Glu Glu Gly Cys Gln
180 185 190
Trp Tyr Ser Asp Trp Asn Glu Glu Ile Arg Thr Leu Ala Lys Gly Arg
195 200 205
Asp Phe Leu Glu Phe Asn Val Lys Glu Gly Trp Gly Pro Leu Cys Arg
210 215 220
Phe Leu Glu Val Glu Gln Pro Glu Thr Pro Phe Pro Arg Val Asn Asp
225 230 235 240
Ser Asn Thr Phe Lys Glu Phe His Asp Lys Gly Leu Glu Gln Asp Ile
245 250 255
Gln Arg Leu Val Gly Ile Ser Thr Lys Leu Val Ala Ala Val Gly Val
260 265 270
Leu Gly Leu Ala Val Trp Leu Ala Arg Lys
275 280
<210> 31
<211> 965
<212> DNA
<213> Artificial Sequence
<220>
<223> CEsul DNA sequence (containing introns)
<400> 31
atggctttag accgccagaa tgcgaaagtt acaactttcg gtctgtcaaa gccgaaaacc 60
aatatagatc gccgatcatg tcagagaact gtccccatga aggttctctg cctaggacta 120
tgtcgaaccg gcacttcctg ttcgtatcaa accatatctc tcacattgct actctcgcta 180
accattcaac agcattgcgt gcggctctct ttgagcttgg ccttgatgat gtctatcaca 240
tgtgtagtgt gacggaagag aatcccctcg actccaagtt gtggaaagag gccttcgacg 300
cgaaatatga agggatcggc aagccctacg gaagagctga atttgacgca ctcttgggtc 360
attgcatggt aagaatcacc tgatcccaac tcttaacgtc caaagtatct gtattactaa 420
caatgcacta ggcaacctcg gatttcccca gcgttgcctt cgctccagaa ctcatcgccg 480
cttaccccga ggcaaagata attctcactg tacgagataa cgccgatgtc tggtatgact 540
ccgttctcaa cacgatctgg agagtctcca acttccttcg cgctcctccg agaactttaa 600
cccaacgagt cgttcaagcg attcttccca agccggattt caacatattc aagtacagcc 660
cccttggcaa ctttcctgag gaaggctgtc agtggtatag tgactggaat gaagagatta 720
gaactctagc caaagggagg gacttcttgg aattcaatgt aaaggaggga tggggtccac 780
tctgtagatt cttggaggtg gagcagccgg agacgccatt tccaagagtc aatgattcaa 840
atacattcaa ggaatttcat gataagggtt tggagcagga tattcaaaga ctggtaggca 900
taagtactaa gcttgtcgcc gctgttggtg tattgggttt ggctgtttgg ctagctagga 960
agtag 965
<210> 32
<211> 455
<212> PRT
<213> Artificial Sequence
<220>
<223> e20_02930 amino acid sequence
<400> 32
Met Phe Arg Ser Glu Asn Ser Gln Val Ser Gln Ser Lys Gly Ala Phe
1 5 10 15
Lys Pro Arg Thr Phe Ser Phe Ser Pro Gln Thr Pro Ser Leu Ser Ser
20 25 30
Cys Asn Ser Phe Tyr Leu Tyr Ile His Gly Val Ser Lys Arg Val Pro
35 40 45
Ala Gly Glu Glu Ser Glu Ser Arg Leu Thr Ala Gln Asn Leu Val Trp
50 55 60
Ser Gly Tyr Asn Ala Ala Phe Gly Asn Asp Val Ala Trp Asp Phe Lys
65 70 75 80
Val Val Gln Leu Asn Thr Thr Ala Gln Gly Leu Ala Phe Phe Arg Gly
85 90 95
Ser Met Ala Arg Gly His Gly Ser Gly Gln Ile Ile Leu Leu Asp Glu
100 105 110
Ser Tyr Lys Leu His Arg Thr Ile Ser Ala Glu Ile Glu Gly Ala Ser
115 120 125
Leu Asp Ala His Asp Phe Gln Leu Leu Asp Asn Gly Arg Val Ala Ile
130 135 140
Val Val Met Tyr Thr Ala Val Gln Arg Asp Leu Ser Ser Arg Asp Tyr
145 150 155 160
Thr Ala Gly Leu Gly Trp Leu Ile Ser His Glu Asp Ser Ser Ile Ile
165 170 175
Trp Arg Leu Gly Gly Pro Arg Ser Asp Phe Glu Leu Glu Asp Phe Thr
180 185 190
Phe Ser Ala Gln His Asp Val Arg Ile Val Gln Glu Ser Asp Asp Lys
195 200 205
Glu Gln Ile Ser Leu Phe Asn Asn Gly Trp Asn Gly Ala Thr Gln Thr
210 215 220
Arg Phe Asp Ser Val Ala Met Val Leu Glu Leu Asp Ile Gln Glu Lys
225 230 235 240
Lys Ala Arg Val Leu Lys Glu Trp Ser Pro Leu Asn Gly Gly Leu Ala
245 250 255
Leu His Glu Gly Ser Ile Arg Phe Leu Glu Asn Gly Asn Thr Leu Val
260 265 270
Ser Trp Gly Gly Leu Pro Gln Phe Ser Glu Phe Ala Pro Asp Gly Glu
275 280 285
Arg Val Leu Asp Val Lys Phe Glu Arg His Thr Val Ala Thr Tyr Arg
290 295 300
Thr Ile Lys His Gly Trp Val Gly Arg Pro Asp Thr Leu Pro Asp Leu
305 310 315 320
Tyr Ile Tyr Ser Arg Ser Glu Val Asp Pro Ser Tyr Val Tyr Met Ser
325 330 335
Trp Asn Gly Ala Thr Glu Val Val Ser Trp Lys Val Tyr Gly Val Gly
340 345 350
Asn Asp Ala Ser Thr Ala Pro Glu Phe Leu Gly Ser Ile Asp Arg Gln
355 360 365
Gly Phe Glu Thr Gln Tyr Ile Ala Pro Gln Thr Ile Val Ser Gly Tyr
370 375 380
Val Glu Ala Ile Asp Lys His Gly Glu Ile Leu Ala Thr Ser Val Val
385 390 395 400
Thr Thr Thr Thr Ile Pro Pro Glu Asn Leu Arg Pro Gln Cys Glu Ile
405 410 415
Trp His Cys Ser Ala Gln Ala Asp Glu Asn Ala Pro Asp Ser Asp Phe
420 425 430
Asn Asp Gly Gln Lys Pro Pro Gln Phe Met Asn Val Lys Glu Pro Val
435 440 445
Leu Gln Ala Thr Lys Glu Asp
450 455
<210> 33
<211> 2055
<212> DNA
<213> Artificial Sequence
<220>
<223> e20_02930 DNA sequence
<400> 33
atgtttcgtt ccgagaactc ccaagtctca cagagcaagg gcgcctttaa acctcgtaca 60
ttctcattct ctccgcaaac cccctcgctt agctcctgta attcattcta cctatacata 120
cagtagaact ttctatgtcg aaaggttctt cacggtcgta atgctatctt gaacctaact 180
taatgctatc atgagagttg ttctgctcct aaaactgtcc atcctgaatt ggatgtcaag 240
accatatgct tctgctctgt cttttttatc agtacgtgcc tctgagatcg gtacttaacc 300
tgcagaagtg actcttttcc agagacccga cttgaatata cctactttca ttattcgtat 360
acacgaagaa caacgatgtg ctcccggata ctggtttgtg gcaccatgga cgggcccaca 420
ccaacacgca ccatacatct acgataacag tggtgtaagt aaaagagtcc ctgcgggaga 480
ggaaagtgaa agtcggttaa cagcacagaa tcttgtctgg tctggttaca atgctgcctt 540
tggcaatgac gtggcgtggg acttcaaggt tgtccagctc aacacgactg cccagggact 600
cgctttcttt cgcggatcga tggcgcgtgg acacggctcg ggtcagatca ttcttctcga 660
cgagtcgtac aaattgcacc ggacgattag tgcggagata gaaggagctt cacttgatgc 720
acatgacttt caactgcttg ataatggacg cgtcgccatt gtagttatgt atactgcggt 780
tcaaagagac ctctcatcga gagattatac agctgggttg ggttggttgt acgattgtag 840
cttcaaggaa tacgagcttg agacggggaa tgtactgttc gagtggaatt cgctagatca 900
tgtacctatc gacgaatcag ttttggagat aaatctcatt caaggagttg gaagttcaac 960
tctgaagccg tgggattatt tgtaaggata tgtcattatc cgctattgga cattgctaac 1020
ttctctcagc cacatcaact cagtcgagaa gtacaaaaat ggagattatc ttatctctgc 1080
aagacacacc gatacaatct ataggatctc tcacgaggat tcatcaatca tatggagact 1140
gggaggacct cgttcagact ttgagcttga agacttcacg ttctcggcac agcacgacgt 1200
acgaatcgtc caagaaagtg acgacaagga gcaaatttca ctgtttaaca acggctggaa 1260
tggagcaaca caaacccgct ttgattcggt agcaatggtt ctcgagctag atatccaaga 1320
gaagaaagcg agggtactga aagagtggtc accgctgaac ggcgggttgg ctctgcatga 1380
gggaagcata agattcctcg agaacggtaa tactttggtg agctggggag gacttccaca 1440
gttcagcgag ttcgcaccag atggcgagcg ggttctggac gtgaaattcg aacgtcacac 1500
ggtagcgacg tatcgaacca tcaaacatgg ttgggttggc agaccagaca cactcccaga 1560
tctttacatt tattcgcgct cggaagtcga ccccagctat gtctacatga gttggaacgg 1620
agccaccgag gtagtgagtt ggaaagtgta cggggtaggg aatgacgcct cgacggcacc 1680
cgaatttctg ggaagtatcg acaggcaagg attcgagacg caatatattg cgccgcagac 1740
tatcgtctcc ggatacgtcg aggccattga taagcatggc gaaattctcg caacttccgt 1800
tgtgacgacg acgaccatcc cacctgaaaa tctacggcca cagtgtgaga tctggcactg 1860
ttcagcccaa gctgatgaaa acgcaccaga ttctgacttt aacgatggcc agaaaccacc 1920
ccagtttatg aatgtgaagg aaccggtcct gcaagccacg aaggaagtat caaaatgtca 1980
aatgaatagg aggcttttat tgataattgc tggtgtcgtg ttattgggta tcggctttta 2040
cgctggtagg attag 2055

Claims (10)

1. A combination of genes comprising a gene encoding P450 monooxygenase CEP450-3 and a gene encoding a sulfonyltransferase CESUL from a filamentous fungus Coleophoma empetri.
2. The combination of genes of claim 1, wherein the filamentous fungus Coleophoma empetri is Coleophoma empetri F-11899; and/or the amino acid sequence of CEP450-3 is shown as SEQ ID NO. 28; and/or the amino acid sequence of the CESUL is shown as SEQ ID NO. 30;
preferably, the nucleotide sequence encoding the CEP450-3 is shown in SEQ ID NO. 29 and/or the nucleotide sequence encoding the CESUL is shown in SEQ ID NO. 31.
3. A recombinant expression vector comprising the gene combination of claim 1 or 2;
preferably, the CEP450-3 and CESUL are on the same recombinant expression vector;
more preferably, the backbone plasmid of the recombinant expression vector is pAg1-H3.
4. A genetically engineered bacterium comprising the gene combination of claim 1 or 2, or the recombinant expression vector of claim 3;
preferably, the genetically engineered bacterium takes echinocandins compound producing bacterium as a starting bacterium;
more preferably, the echinocandin class compound producing bacteria is Glarea lozoyensis or Aspergillus pachycristatus.
5. The echinocandin compound is characterized in that the structure of the echinocandin compound is shown as a formula I:
wherein R is 1 Is C 1-20 Alkyl or C 2-20 Alkenyl groups;
R 2 is H or C 1-6 An alkyl group;
R 3 is C 1-6 Alkyl or quiltSubstituted C 1-6 An alkyl group;
X + is a monovalent cation;
the carbon atoms with "×" are chiral or achiral carbon atoms, and when chiral, are in the R configuration and/or S configuration.
6. The echinocandins of claim 5, wherein in formula I, said X + Is Na (Na) + 、K + Or NH 4 + For example Na + The method comprises the steps of carrying out a first treatment on the surface of the And/or the number of the groups of groups,
R 1 in the above, the C 1-20 Alkyl is C 10-20 Alkyl groups, e.g. ofOr alternatively, the first and second heat exchangers may be,
R 1 in the above, the C 2-20 Alkenyl group is C 10-20 Alkenyl radicals, e.g. ofAnd/or the number of the groups of groups,
R 2 in the above, the C 1-6 Alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl or tert-butyl, preferably methyl; and/or the number of the groups of groups,
R 3 in the above, the C 1-6 Alkyl and quiltSubstituted C 1-6 C in alkyl 1-6 Alkyl is independently methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl or tert-butyl, preferably methyl.
7. The echinocandins compound of claim 5, wherein said echinocandins compound is:
8. a process for preparing the echinocandins of any one of claims 5-7, comprising culturing the genetically engineered bacterium of claim 4 in a fermentation medium to express the echinocandins.
9. The method of claim 8, wherein the fermentation medium has a pH of 6.0 to 7.0 and/or comprises 80 to 120g/L mannitol, 4 to 6g/L cottonseed meal, 8 to 12g/L soybean meal, 3 to 5g/L K 2 HPO 4 And 0.8-1.2 g/L CaCO 3 The method comprises the steps of carrying out a first treatment on the surface of the And/or the number of the groups of groups,
the temperature of the culture is 23-27 ℃, and/or the rotation speed of the culture is 200-240 rpm, and/or the time of the culture is 8-12 days;
the pH value of the fermentation medium is preferably 6.5;
the mannitol is preferably 100g/L, the cotton seed cake powder is preferably 5g/L, the soybean cake powder is preferably 10g/L, and the K is preferably the same as the soybean cake powder 2 HPO 4 Preferably 4g/L, of CaCO 3 Preferably 1g/L;
the temperature is preferably 25 ℃; said rotation speed is preferably 220rpm; the time is preferably 10 days.
10. Use of the gene combination according to claim 1 or 2, or the recombinant expression vector according to claim 3, or the genetically engineered bacterium according to claim 4 for the production of echinocandins; preferably, the echinocandins are as defined in any one of claims 5 to 7.
CN202210314827.4A 2022-03-28 2022-03-28 Genetically engineered bacterium for producing echinocandins medicine and application thereof Pending CN116855462A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210314827.4A CN116855462A (en) 2022-03-28 2022-03-28 Genetically engineered bacterium for producing echinocandins medicine and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210314827.4A CN116855462A (en) 2022-03-28 2022-03-28 Genetically engineered bacterium for producing echinocandins medicine and application thereof

Publications (1)

Publication Number Publication Date
CN116855462A true CN116855462A (en) 2023-10-10

Family

ID=88232738

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210314827.4A Pending CN116855462A (en) 2022-03-28 2022-03-28 Genetically engineered bacterium for producing echinocandins medicine and application thereof

Country Status (1)

Country Link
CN (1) CN116855462A (en)

Similar Documents

Publication Publication Date Title
CN112280726B (en) Construction method and application of high-yield tetrahydropyrimidine engineering strain
CN113234610B (en) Saccharomyces cerevisiae strain for synthesizing squalene and application thereof
CN113755354A (en) Recombinant saccharomyces cerevisiae for producing gastrodin by using glucose and application thereof
CN112175848A (en) Patchouli alcohol production yeast strain and construction method and application thereof
CN115851810A (en) Engineering strain for de novo synthesis of naringenin by saccharomyces cerevisiae and construction method and application thereof
KR102308556B1 (en) Genetically engineered bacterium with altered carbon monoxide dehydrogenase (codh) activity
CN110903993A (en) Saccharomyces cerevisiae engineering bacterium for producing brassicasterol and construction method and application thereof
CN116855462A (en) Genetically engineered bacterium for producing echinocandins medicine and application thereof
AU2001295782A1 (en) An acyl coenzyme a carboxylase from streptomyces
CN109112151B (en) Gene cassette for finely regulating and controlling composition ratio of 4-hydroxybutyric acid in copolymer and application thereof
CN113846026B (en) Saccharomyces cerevisiae strain for synthesizing african bean element and catechin and application thereof
CN113789292B (en) Gene-deficient amycolatopsis capable of producing vanillin at high yield, and construction method and application thereof
CN112795587B (en) Escherichia coli engineering bacteria producing surfactant, construction method and application thereof
CN110540943B (en) Gene engineering strain for producing emodin and construction method and application thereof
CN107903227B (en) Succinic anhydride compound, gene and protein related to succinic anhydride compound and preparation method of succinic anhydride compound
CN113817757A (en) Recombinant yeast engineering strain for producing cherry glycoside and application
CN109666595B (en) Microorganism and method for improving fermentation yield of hydrophobic compound of microorganism
CN113046251B (en) Production of pneumocandin B 0 The gene engineering bacterium, its preparation method and application
CN116855393A (en) Genetically engineered bacterium for producing FR901379 derivative and application thereof
CN110468091A (en) Microorganism and application thereof
CN107541481B (en) Genetic engineering bacterium for producing epirubicin and application thereof
CN113046250B (en) Production of pneumocandin B 0 Genetically engineered bacterium, and preparation method and application thereof
CN114774443B (en) Recombinant saccharomyces cerevisiae strain for producing parthenolide and construction method thereof
EP4063509A1 (en) Recombinant bacteria for producing de-epoxidized epothilone b and use thereof
CN110527638B (en) Gene engineering strain for accumulating emodin and construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination