CN116837070A - Method for removing RNA fragments in ribosome profile analysis and application thereof - Google Patents

Method for removing RNA fragments in ribosome profile analysis and application thereof Download PDF

Info

Publication number
CN116837070A
CN116837070A CN202310879220.5A CN202310879220A CN116837070A CN 116837070 A CN116837070 A CN 116837070A CN 202310879220 A CN202310879220 A CN 202310879220A CN 116837070 A CN116837070 A CN 116837070A
Authority
CN
China
Prior art keywords
trna
ribosome
probe
sample
removal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310879220.5A
Other languages
Chinese (zh)
Inventor
李新
薛宁宁
张翠杰
李瑞强
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Novogene Technology Co ltd
Original Assignee
Beijing Novogene Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Novogene Technology Co ltd filed Critical Beijing Novogene Technology Co ltd
Priority to CN202310879220.5A priority Critical patent/CN116837070A/en
Publication of CN116837070A publication Critical patent/CN116837070A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The application provides a method for removing RNA fragments in ribosome profile analysis and application thereof. The removing method comprises the following steps: analyzing sample combination by utilizing tRNA removing probe and ribosome map, forming double-chain RNA structure by tRNA removing probe and tRNA fragment in RNA fragment, and removing tRNA fragment by removing double-chain RNA structure; tRNA-removing probes include probes that are capable of hybridizing to SEQ ID NOs: 1, and a sequence to which the conserved sequences shown in 1 specifically bind. Can solve the problem that tRNA fragments in the Ribo-seq library are difficult to remove in the prior art. Is suitable for the field of ribosome profile analysis.

Description

Method for removing RNA fragments in ribosome profile analysis and application thereof
Technical Field
The application relates to the field of ribosome map analysis, in particular to a method for removing RNA fragments in ribosome map analysis and application thereof.
Background
Classical central laws demonstrate the process by which genes are transcribed from DNA to RNA, which is translated into protein, and ultimately function through the protein. Protein expression levels are one of the important manifestations of gene function, and currently detected protein expression can be assessed by ELISA, mass spectrometry and ribosome profile analysis. Ribosome map analysis (Ribosome profiling, ribo-seq) promotes new discovery of gene expression regulation in various and complex biological processes, is one of important means for protein synthesis mechanism and even new protein research, and provides a systematic method for experimental annotation of coding regions.
Ribosome profiling is the process of treating cell lysates by RNase to degrade RNA that is not protected by ribosomes, followed by isolation of mRNA fragments that are protected by ribosomes. RNA sequences of about 30 nucleotides were obtained by this experimental treatment, which could be directly mapped (map) to the original mRNA for determining the exact position of the ribosome in translation. Ribosome mapping is used to construct strand-specific libraries and high throughput sequencing, and these sequenced fragments are mapped to the appropriate genome. The translation efficiency of each mRNA can be detected by comparing the ratio of protein synthesis to the abundance of mRNA.
However, in the ribosome map data including the ribosome map data of human samples, there are a large number of tRNA fragments in addition to rRNA residues, and these tRNA fragment data occupy 30% or more of the total filtered data (clean reads), and there are no methods and reagents capable of removing the relevant tRNA in the prior art.
Disclosure of Invention
The application mainly aims to provide a method for removing RNA fragments in ribosome analysis and application thereof, which are used for solving the problem that tRNA fragments in a Ribo-seq library are difficult to remove in the prior art.
In order to achieve the above object, according to a first aspect of the present application, there is provided a tRNA-remover probe comprising a nucleic acid sequence capable of hybridizing to the sequence set forth in SEQ ID NO:1, and a sequence to which the conserved sequences shown in 1 specifically bind.
Further, the tRNA-remover probe comprises a DNA sequence that consists of deoxyribonucleotides.
Further, the tRNA-depleted probe comprises a nucleic acid sequence comprising SEQ ID NO:2, and a sequence of the sequence shown in 2; preferably, the tRNA is removed from the 5' end of the probe as SEQ ID NO: 2; preferably, the tRNA-removing probe is SEQ ID NO:2, and a sequence shown in seq id no.
Further, the tRNA has a locked nucleic acid modification on a ribonucleotide of the tRNA remover probe; preferably, the number of lock nucleic acid modifications is 1 to 10, more preferably 3 to 8, still more preferably 5 to 7; preferably, the tRNA-depleted probe has a length of 18-29nt, more preferably 19-25nt, and even more preferably 22-24nt.
In order to achieve the above object, according to a second aspect of the present application, there is provided a method for removing an RNA fragment in ribosome analysis, the method comprising: and analyzing the sample combination by utilizing the tRNA removal probe and the ribosome, wherein the tRNA removal probe and the tRNA fragments in the RNA fragments form double-stranded RNA structures, and the removal of the RNA fragments is realized by removing the double-stranded RNA structures.
Further, the method of removing double-stranded RNA structure comprises removing double-stranded RNA structure using one or more of magnetic beads, RNase, chromatography column or filtration membrane.
Further, the removing method comprises the following steps: combining the tRNA removal probe with a ribosome profiling sample connected with a sequencing adapter in the library building process of the ribosome profiling library; the library construction process of the ribosome map analysis library comprises the following steps: lysing the cell or tissue sample, and fixing the ribosome by using a translation inhibitor to obtain a ribosome-immobilized sample; digesting a ribosome-immobilized sample by using RNase, and purifying to obtain a ribosome-protected fragment; carrying out terminal phosphorylation and sequencing joint connection on the ribosome protection fragment to obtain a ribosome profile analysis sample connected with the sequencing joint; combining the tRNA removing probe with a ribosome mapping analysis sample connected with a sequencing joint, and removing the double-stranded RNA structure to obtain a tRNA removing sample; and carrying out reverse transcription, PCR enrichment and purification on the tRNA-removed sample to obtain a tRNA-removed ribosome profile analysis library.
Further, the removing method further comprises removing rRNA fragments from the RNA fragments by using a probe for removing rRNA; preferably, the tRNA-removing probe and the probe for removing rRNA are simultaneously combined with the ribosome profiling sample, the tRNA-removing probe and the tRNA fragment form a first double-stranded RNA structure, and the probe for removing rRNA and the rRNA fragment form a second double-stranded RNA structure, and simultaneously remove the first double-stranded RNA structure and the second double-stranded RNA structure.
In order to achieve the above object, according to a third aspect of the present application, there is provided an RNA removal kit comprising the above tRNA removal probe.
Further, the RNA removal kit further includes a probe for removing rRNA.
In order to achieve the above object, according to a fourth aspect of the present application, there is provided the use of the above tRNA-removal probe, the above-described removal method or the above-described RNA removal kit in ribosome profile analysis or ribosome-protected tRNA analysis.
By applying the technical scheme of the application, the nucleotide sequence capable of being matched with SEQ ID NO:1, can remove the tRNA fragments protected by ribosome in ribosome analysis and increase the proportion of effective data of the Ribo-seq library.
Drawings
The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification, illustrate embodiments of the application and together with the description serve to explain the application. In the drawings:
FIG. 1 is a schematic diagram showing a library construction process of a ribosome map analysis library according to example 3 of the present application.
Fig. 2 shows a graph of the results before and after processing for 24 person source samples according to example 6 of the present application.
Detailed Description
It should be noted that, without conflict, the embodiments of the present application and features of the embodiments may be combined with each other. The present application will be described in detail with reference to examples.
As mentioned in the background art, the ribosome map data of the existing human sample contains a large amount of tRNA fragments, and the tRNA fragment data occupies more than 30% of clean reads on average, occupies sequencing resources, causes waste of sequencing resources and increase of cost, and affects subsequent data analysis. Thus, in the present application, the inventors have attempted to develop a tRNA-removal probe capable of removing tRNA fragments in ribosome analysis, and have proposed a series of protection schemes of the present application based on the probe.
In a first exemplary embodiment of the application, a tRNA-remover probe is provided that includes a nucleic acid sequence that is capable of hybridizing to the sequence set forth in SEQ ID NO:1, and a sequence to which the conserved sequences shown in 1 specifically bind.
SEQ ID NO：1：UCCCUGGUGGUCUAGUGGUUAGGAUUCGG。
The above SEQ ID NO:1 is a conserved sequence of human ribosome protected tRNA fragments in human samples. The conserved sequence is RNA sequence composed of ribonucleotide. Using a polypeptide capable of hybridizing with SEQ ID NO:1, which is capable of specifically binding to a tRNA fragment (including but not limited to a conserved sequence) in a ribosome profile analysis to form a double stranded structure, and removing the tRNA fragment from the sample by removing the double stranded structure. Probes include, but are not limited to, RNA sequences composed of ribonucleotides, DNA sequences composed of deoxyribonucleotides, or DNA-RNA sequences composed of both deoxyribonucleotides and ribonucleotides.
The above SEQ ID NO:1 to human transcript databases, only one lncRNA was matched. That is, the sequence cannot be matched with the coding region of the gene, and the sequence which can be complementarily matched with the conserved sequence cannot influence mRNA containing coding information and cannot influence the accuracy of ribosome analysis.
The tRNA-removing probe can be used for removing the tRNA from the DNA of SEQ ID NO:1, "partial specific binding" includes specific binding to a portion of the conserved sequence, and "a portion" includes continuous or discontinuous 10 or more bases, including but not limited to specific binding to 10, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 bases on the conserved sequence.
In a preferred embodiment, the tRNA-remover probe comprises an RNA sequence that consists of ribonucleotides.
In a preferred embodiment, the tRNA-removing probe comprises a nucleic acid comprising SEQ ID NO:2, and a sequence of the sequence shown in 2; preferably, the tRNA is removed from the 5' end of the probe as SEQ ID NO: 2; preferably, the tRNA-removing probe is SEQ ID NO:2, and a sequence shown in seq id no.
SEQ ID NO：2：CCGAATCCTAACCACTAGACCAC。
The above SEQ ID NO:2 is DNA sequence composed of deoxyribonucleotide. SEQ ID NO:2 is capable of hybridizing to SEQ ID NO:1 specifically bind to form a double-stranded structure. the tRNA-depleted probe comprises SEQ ID NO:2, and a sequence shown in seq id no. Preferably, in the tRNA-depleted probe, the SEQ ID NO:2 is located at the 5' end of the tRNA removal probe, at SEQ ID NO:2 optionally provided with other ribonucleotides capable of complementary pairing with the conserved sequence.
In a preferred embodiment, the tRNA has a locked nucleic acid modification on a ribonucleotide of the tRNA remover probe; preferably, the number of lock nucleic acid modifications is 1 to 10, more preferably 3 to 8, still more preferably 5 to 7; preferably, the locked nucleic acid modified ribonucleotide is positioned at any one or more of positions 1 to 23 of the 5 'terminus of the tRNA-removal probe, including, but not limited to, positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 of the 5' terminus of the tRNA-removal probe; preferably, the locked nucleic acid modified ribonucleotide is positioned at any one or more of positions 3, 6, 9, 12, 15 or 19 of the 5' terminus of the tRNA removal probe; preferably, the tRNA-depleted probe has a length of 18-29nt, including but not limited to 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29nt, more preferably 19-29nt,19-25nt,22-29nt, and even more preferably 22-24nt.
The ribonucleotides in the tRNA-remover probe are optionally ribonucleotides with a locked nucleic acid (LNA, locked Nucleic Acid) structure that increases the specificity of binding of the tRNA-remover probe to the tRNA fragment in the sample and prevents loss of encoded information in the mismatch-induced ribosome profile analysis.
In a second exemplary embodiment of the present application, there is provided a method for removing an RNA fragment in ribosome analysis, the method comprising: and analyzing the sample combination by utilizing the tRNA removing probe and the ribosome, wherein the tRNA removing probe and the tRNA fragment in the RNA fragment form a double-stranded RNA structure, and removing the tRNA fragment by removing the double-stranded RNA structure.
In a preferred embodiment, the method of removing double stranded RNA structure comprises removing double stranded RNA structure using one or more of magnetic beads, RNase, chromatography column or filtration membrane.
In a preferred embodiment, the removal method comprises: combining the tRNA removal probe with a ribosome profiling sample connected with a sequencing adapter in the library building process of the ribosome profiling library; library building processes for ribosome profiling libraries include, but are not limited to: lysing the cell or tissue sample, and fixing the ribosome by using a translation inhibitor to obtain a ribosome-immobilized sample; digesting a ribosome-immobilized sample by using RNase, and purifying to obtain a ribosome-protected fragment; carrying out terminal phosphorylation and sequencing joint connection on the ribosome protection fragment to obtain a ribosome profile analysis sample connected with the sequencing joint; combining the tRNA removing probe with a ribosome mapping analysis sample connected with a sequencing joint, and removing the double-stranded RNA structure to obtain a tRNA removing sample; and carrying out reverse transcription, PCR enrichment and purification on the tRNA-removed sample to obtain a ribosome profile analysis library of the tRNA-removed fragment.
The above-described methods of removing tRNA from a sample can be used in, but not limited to, the above-described methods of removing tRNA fragments from a sample, thereby reducing the amount of tRNA in the library and increasing the ratio of the effective data in the library. The effective data indicates sequencing data of fragments having data analysis value such as mRNA in a sample, and does not include sequencing data of fragments having no analysis value, which are repeated with respect to sequence information such as rRNA and tRNA.
In a preferred embodiment, the removal method further comprises removing rRNA fragments from the RNA fragments using a probe for removing rRNA; preferably, the tRNA-removing probe and the probe for removing rRNA are simultaneously combined with the ribosome profiling sample, the tRNA-removing probe and the tRNA fragment form a first double-stranded RNA structure, and the probe for removing rRNA and the rRNA fragment form a second double-stranded RNA structure, and simultaneously remove the first double-stranded RNA structure and the second double-stranded RNA structure.
Probes for removing rRNA are known in the art, and in the above-described removal method, the effect of reducing tRNA fragments and rRNA fragments in a sample can be achieved by combining the probe for removing rRNA with the above-described tRNA removal probe or by separately analyzing the sample with a ribosome map. The use of the probe for removing rRNA is not limited to the use before, after or simultaneously with the tRNA removal probe, and can further achieve the removal of rRNA without affecting the effect of removing tRNA. Preferably, in order to improve the efficiency of the operation and to reduce the steps and time used for the operation, the probe for removing rRNA and the tRNA removal probe can be simultaneously combined with the ribosome analysis sample, and the class 2 probes directly do not affect each other, so that the tRNA and rRNA fragments can be simultaneously removed in one experimental operation. The first double-stranded RNA structure and the second double-stranded RNA structure are only used for distinguishing different formed RNA double-stranded structures, and the sequence of probe addition or double-stranded structure formation is not limited.
In a third exemplary embodiment of the application, an RNA removal kit is provided that includes the tRNA removal probe described above.
In a preferred embodiment, the RNA removal kit further comprises probes for removing rRNA.
In a fourth exemplary embodiment of the application, there is provided the use of a tRNA-removal probe, method of removal or RNA-removal kit as described above in ribosome profiling or ribosome-protected tRNA analysis, which enables a library of lower ribosome-protected tRNA fragments and isolated ribosome-protected tRNA fragments to be obtained, which increases the proportion of available data in the library for ribosome profiling, reduces sequencing costs and sequencing data analysis difficulties; enriched ribosome-protecting tRNA can also be obtained in analytical studies on ribosome-protecting tRNA.
The advantageous effects of the present application will be explained in further detail below in connection with specific examples.
Example 1
In human sample Riboseq data we found that there were many residues of trnas in addition to non-removed ribosomal RNA, which were also considered as null data, but none of the methods in the Riboseq database construction procedure were directed to tRNA removal. In order to remove tRNA residues, it is desirable to analyze the conserved sequences of tRNA residues from the Riboseq data of different tissue samples, and to design probes for the sequences to better remove tRNA residues during subsequent Riboseq library building to increase the effective data volume.
Analyzing tRNA sequences from Riboseq data of 20 human tissue samples, analyzing the types and abundance of tRNA ready of each sample, naming the tRNA sequences ranked according to abundance, distinguishing the screened tRNAready sequences by using the ratio of sample number to ready as the sequence name, converting the sequences into fasta format, performing multiple sequence similarity comparison by using the mafft software, importing the aligned result files into BioEdit or other sequence editing software, and classifying the sequence files to obtain four ordered top sequences:
SEQ ID NO：1:UCCCUGGUGGUCUAGUGGUUAGGAUUCGG；
SEQ ID NO：5:GCAUUGGUGGUUCAGUGGUAGAAUUCUCGC；
SEQ ID NO：6:UCCCAUAUGGUCUAGCGGUUAGGAUUCCUGG；
SEQ ID NO：7:GCCGUGAUCGUAUAGUGGUUAGUACU。
SEQ ID NO: 1. SEQ ID NO: 5. SEQ ID NO:6 and SEQ ID NO: the percentages of 7 in the tRNA data were 75%, 12%, 7% and 5%, respectively. Considering whether the subsequent probe design for the 4tRNA sequences has influence on RPF (ribosome protective fragment), mRNA alignment is also carried out on the 4tRNA sequences in the design process, and only one lncRNA sequence can be aligned, and No influence is found on RPF, so that the probe design is carried out on the SEQ No1 sequence with higher abundance and is applied to the subsequent Riboseq library establishment process.
Example 2 tRNA removal Probe design in Ribo-seq
1.1 sample information and tRNA reads abundance analysis
The Ribo-seq sequencing data of 20 human cell samples were selected for analysis, the species and abundance of trnaads for each sample were analyzed, and tRNA sequences for abundance ranking top10 were retained (the number of reads for top10 was more than 60% of the total reads) for further analysis.
1.2 tRNA reads similarity analysis
Naming the tRNA ready sequence screened in the last step, distinguishing the sample number and ready ratio as the sequence name, converting the sequence into fasta format, and performing multiple sequence similarity comparison by using the afft software.
The compared result files are imported into BioEdit or other sequence editing software, and the sequence files are classified according to the classification principle: the difference sites are less than or equal to 1 and are classified into one type, and the following sequences are screened out:
SEQ ID NO:1: UCCCUGGUGGUCUAGUGGUUAGGAUUCGG, at a ratio of over 70%, is used as a conserved sequence for human sample tRNA removal.
1.3 sequence specific analysis
SEQ ID NO: the 1 sequence was aligned to a human transcript database and matched to one lncRNA. The sequence is not matched with the coding region of the gene, and the mRNA sequence is not affected.
1.4tRNA removal probe sequence design
For the above SEQ ID NO:1, designed to be capable of hybridizing to SEQ ID NO:1, SEQ ID NO:2 probes.
SEQ ID NO：2：CCGAATCCTAACCACTAGACCAC。
SEQ ID NO: the information of 2 is shown in table 1.
Table 1: tRNA removes probe sequence information
Name of the name Sequence(s) Length of Purification mode OD260 Quality (mug) nmol GC(％) TM(℃) MW
hsa SEQ ID NO：2 23nt HPLC 1 32.6 4.6 52.2 57.1 7116.6
Wherein, SEQ ID NO:2 having locked nucleic acid modifications at ribonucleotides at positions 3, 6, 9, 12, 15 and 19;
SEQ ID NO:2 is a DNA sequence consisting of deoxyribonucleotides.
Example 3
1. Sample lysis
1.1 tissue sample lysis
1) Grinding beads and a 2.0mL grinding tube were prepared, and the samples were minced into grinding tubes and snap frozen in liquid nitrogen.
2) The tissue was ground into powder using an automatic grinder at 48Hz for 20s for 2 times.
3) The reagents were prepared and the formulations are shown in tables 2 and 3.
TABLE 2 Polymer buffer (polysome buffer) formulation
Reagent(s) Usage amount (. Mu.L)/sample Storage conditions (. Degree. C.)
1M Tris-Cl pH7.5 20 Normal temperature
5M NaCl 30 4
1M MgCl 2 5 Normal temperature
NF-H 2 O 945 4
Total volume of 1000
TABLE 3 animal tissue and cell lysate formulations
Reagent(s) Usage amount (. Mu.L)/sample Storage conditions (. Degree. C.)
Polysome Buffer 878 4
10％Triton X-100 100 -20
100mM DTT 10 -20
DNasel(1U/μL) 10 -20
50mg/mL cycloheximide 2 -20
Total volume of 1000
4) 1mL of the lysate is added, and the gun head is fully blown and evenly mixed.
5) Cracking on ice for 20min, and slightly shaking and mixing every 2min.
6) Centrifuge at 13000rpm for 10min at 4℃and transfer the supernatant to a new centrifuge tube pre-cooled on ice.
7) The Qubit measures the concentration of the lysate and records, and the initial concentration is more than or equal to 100 ng/. Mu.L, so that the next reaction can be carried out.
1.2 cell sample lysis
1) And (3) determining the cell sample type, if the cell sample type is the cell preserved by the frozen stock solution, recovering the cell in a water bath at 37 ℃, centrifuging at normal temperature for 500g for 5min, collecting the cell, discarding the protective solution, and then performing lysis.
2) 600 mu L of cell lysate is added, and the gun head is fully blown and evenly mixed.
3) The No. 5 syringe was repeatedly blown with the cell lysate 8 times.
4) Cracking on ice for 20min, and slightly shaking and mixing every 2min.
5) Centrifuge at 13000rpm for 10min at 4℃and transfer the supernatant to a new centrifuge tube pre-cooled on ice.
6) The Qubit measures the concentration of the lysate and records, and the initial concentration is more than or equal to 100 ng/. Mu.L, so that the next reaction can be carried out.
2. Ribosome Protective Fragment (RPF) enrichment
2.1 reagent and consumable preparation
The reagents used are shown in Table 4.
TABLE 4 Table 4
2.2 RNase digestion
1) 200. Mu.L of the above lysate was taken, and the required RNaseI was calculated based on the total amount of RNA, and 7.5. Mu.L of RNaseI (100U/. Mu.L) was added.
Note that: at a lysate concentration of 100-200 ng/. Mu.L, 200. Mu.L lysate plus 7.5. Mu.L RNase I.
2) The enzyme digestion environments of different sample types are different, and the sample is incubated for 1h at 4 ℃ by a mixing instrument.
3) After 30min incubation, a MicroSpins-400 Columns of resin may be prepared.
2.3 termination of RNase digestion
10. Mu.L SUPERAse In RNase inhibitor was added and mixed well to terminate the nuclease digestion reaction.
2.4Microspin S-400column filtration
1) Each sample was prepared 3mL Polysome Buffer.
2) The Microspin S-400column was inverted several times to mix the resin and flick the column to remove air bubbles from the resin.
3) The upper and lower ends of the column were opened and Buffer (Polysome Buffer) was added to allow the Buffer to drip out under the force of gravity.
4) The collection tube was connected and centrifuged at 600g for 4min at room temperature in a fixed angle bench centrifuge. The effluent buffer was discarded and the column was transferred to a new 2mLEP tube.
5) Immediately 200. Mu.L of a nuclease digested RPF sample (confirming RNase inhibitor has been added) was centrifuged at 600g for 2min. And collecting effluent.
6) mu.L of 10% SDS (10. Mu.L of 10% SDS per 100. Mu.L) was added for the subsequent treatment of RPF RNA.
7) If the above mixture is more than 220. Mu.L, the mixture is split into two tubes, and the system is prepared according to the reagent ratio of 2.5.
2.5 RNA Clean & Concentrator-25Kit purified RPF RNA samples
1) The assay was performed using a kit (ZYMO rest, cat#r1017) to determine that ethanol had been added to the RNAWash Buffer prior to use.
2) The system was formulated and mixed as follows in Table 5.
Table 5 RNA Clean&Concentrator-25Kit purification System
Reagent(s) Usage amount (. Mu.L)/sample
RNA Binding Buffer 220
Absolute ethyl alcohol 495
RPF sample 110
3) Zymo-Spin TM IIC Column was placed in a collection tube, the above system was transferred to a Column, centrifuged at 13000rpm for 1min at room temperature, and the collection liquid was discarded.
4) The above procedure was repeated, the remaining system was transferred to the column, centrifuged at 13000rpm for 1min at room temperature, and the collected liquid was discarded.
5) 400. Mu.L of RNAPrep Buffer was added to the column and centrifuged at 13000rpm for 1min at room temperature, and the collection solution was discarded.
6) 700. Mu.L of RNAWash Buffer was added to the column and centrifuged at 13000rpm for 1min at room temperature, and the collection solution was discarded.
7) 400. Mu.L of NAWash Buffer was added to the column, centrifuged at 13000rpm for 2min at room temperature, the collection was discarded, and the column was transferred to a fresh 1.5mL centrifuge tube without RNase.
8) mu.LNF-H was used as the substrate 2 O was carefully added to the center of the recovery column, allowed to stand at room temperature for 2min, and centrifuged at 13000rpm for 2min at room temperature.
9) The total RNA amount was quantified and recorded with Qubit.
3. Denatured PAGE gel
3.1 preparation of reagents
The reagents used are shown in Table 6.
TABLE 6
Reagent(s) Storage conditions (. Degree. C.)
Urea Normal temperature
30% polyacrylamide 4
10×TBE 4
dd H 2 O Normal temperature
10% ammonium persulfate 4
TEMED 4
Denaturing Gel Loading Dye(ThermoFisher，R0641) －20
20/100Oligo Ladder(1ng/μL)(ThermoFisher，10597012) -20
SYBR Gold(ThermoFisher，S11494) Normal temperature
3.2 preparation of 15% denaturing PAGE gel
The 15% denaturing PAGE gel formulation is shown in Table 7.
TABLE 7
Reagent(s) 15mL glue dosage Dosage of 30mL of gum
Urea 6.3g 12.6g
30% polyacrylamide 6mL 12mL
i0×TBE 1.5mL 3mL
dd H 2 O 7.5mL 15mL
10% ammonium persulfate 75μL 150μL
TEMED 15μL 30μL
3.3 preparation of samples and markers (20/100 Oligo Ladder)
1) mu.L of the sample was mixed with 10. Mu.L of 2x loading dye (Denaturing Gel Loading Dye) and the total volume was 20. Mu.L.
2) 8 μL of 20/100Oligo Ladder was mixed with 10 μL of 2x loading dye, and 5 μL of 28/30nt marker was mixed with 5 μL of 2x loading dye.
The 28/30nt marker consisted of 2RNA sequences, wherein:
28nt sequence 5'-AUGUACACGGAGUCGACCCGCAACGCGA-3' (SEQ ID NO: 3),
30nt sequence 5'-AUGUACACGGAGUCGAAACCCGCAACGCGA-3' (SEQ ID NO: 4),
both the 28nt sequence and the 30nt sequence have a phosphorylation modification (Phos) at their 3' ends.
3) PCR instrument at 75deg.C for 3min. Samples and 20/100Oligo ladder were denatured and placed on ice immediately after completion.
3.4 electrophoresis and staining
180V electrophoresis for 50 min-1 h, after electrophoresis, the gel was cut and marked, then removed, and stained with SYBR Gold for 5min, 1:6000 (30 mL pure water+5. Mu.L SYBR Gold). The RNA bands were observed in the dark blue.
3.5 cutting glue
Cutting into glue with the range of 28-30nt. The cut glue was transferred to a centrifuge tube with a well punched.
4. Ribosome Protective Fragment (RPF) recovery purification
4.1 consumable preparation
Taking a 0.5mL centrifuge tube, pricking a hole at the bottom by a syringe needle to form a sieve shape, and placing the sieve shape into a 2mL centrifuge tube. Spin-X filter tubes were prepared.
4.2 preparation of reagents
The reagents used are shown in Table 8.
TABLE 8
Reagent(s) Storage conditions (. Degree. C.)
NF H 2 O Normal temperature
3M sodium acetate Normal temperature
Glycogen (Glycogen) -20
Absolute ethyl alcohol -20
80% ethanol -20, ready-to-use
4.3 recovery purification
1) The cut gel was placed in a prepared 2mL centrifuge tube (0.5 mL centrifuge tube), and centrifuged at 13000rpm at 4℃for 5min.
2) 200 mu LNF-H was added to the gel fragments 2 O, shaking at 37℃and 1000rpm for 1h.
3) The above solution was transferred to Spin-X centrifugal filter tubes and centrifuged at 13000rpm at 4℃for 10min.
4) The reagents were added and thoroughly mixed as shown in table 9 below.
TABLE 9
Reagent(s) Usage amount (. Mu.L)/sample
3M sodium acetate 13
Glycogen 2.5
Absolute ethyl alcohol 600
5) Centrifuging instantaneously, and standing at-20deg.C for more than 1 hr.
6) Centrifuge at 13000rpm for 15min at 4℃and carefully aspirate the supernatant.
7) 1000. Mu.L of 70% ethanol was added and the supernatant was discarded after centrifugation at 13000rpm for 5min.
8) The step 7 was repeated, and the supernatant was aspirated as much as possible.
9) With 43. Mu.L NF-H 2 O dissolves RNA precipitate, and the solution is promoted by gently blowing and sucking for 20 times.
5. Phosphorylation (end repair)
5.1 preparation of reagents
The reagents used are shown in Table 10.
Table 10
Reagent(s) Storage conditions (. Degree. C.)
T4 PNK buffer(NEB，M0201V) -20
SUPERase*In RNase inhibitor(20U/μL)(ThermoFisher，AM2694) -20
T4 PNK(10U/μL)(NEB，M0201V) .20
Absolute ethyl alcohol 4
NF H 2 O Normal temperature
5.2 terminal phosphorylation
1) Reagents were added sequentially as follows in table 11:
TABLE 11 terminal repair system
Volume (mu L)
RNA samples 43
T4 PNK buffer 5
SUPERase*In RNase inhibitor(20U/μL) 1
T4 PNK(10U/μL) 1
2) Shaking and mixing evenly, instantaneous centrifuging, and reacting on a PCR instrument: 37 ℃ for 1h;70 ℃ for 10min.
3) Addition of NF-H to samples 2 O, make up the sample volume to 100. Mu.L, formulate the system as in Table 12 and mix well.
Table 12
Reagent(s) Usage amount (. Mu.L)/sample
3M sodium acetate 13
Glycogen 2.5
Absolute ethyl alcohol 300
4) Centrifuging instantaneously, and standing at-20deg.C for more than 1 hr.
5) Centrifuge at 13000rpm for 15min at 4℃and carefully aspirate the supernatant.
6) 500. Mu.L of 70% ethanol was added, and the supernatant was discarded after centrifugation at 13000rpm for 5min.
8) The step 7 was repeated, and the supernatant was aspirated as much as possible.
9) After the precipitate was dried for 2min, it was treated with 7. Mu. LNF-H 2 O dissolves the sample.
6. Joint connection
6.1 preparation of reagents
The reagents used are shown in Table 13, and the reagents involved in the library construction part of the present application are derived from NEB kit, with the product number NEB#E7300S.
TABLE 13
Reagent(s) Storage conditions (. Degree. C.)
3'SR Adaptor for Illumina (4 times dilution) -20
NF H 2 O Normal temperature
3′Ligation Reaction Buffer(2X) -20
3′Ligation Enzyme Mix -20
sR RT Primer for Illumina (double dilution) -20
5′SR Adaptor for Illumina(denatured) -20
5′Ligation Reaction Buffer(10X) -20
5′Ligation Enzyme Mix －20
6.23' Joint connection
1) And placing the sample with the repaired tail end into a new PCR tube, adding a reaction system shown in the following table 14, and fully and uniformly mixing.
TABLE 14
2) The PCR instrument was denatured at 70℃for 2min and then immediately placed on ice.
3) The reaction solution shown in the following Table 15 was added to the above-mentioned system
TABLE 15
Reagent(s) Usage amount (mu L)
3′Ligation Reaction Buffer(2X) 5
3′Ligation Enzyme Mix 1.5
Total volume 14
4) Incubate at 25℃for 1h, immediately thereafter place on ice.
6.3 hybridization of reverse transcription primer (except for free 3' linker)
1) The components shown in table 16 below were added to the connection mixture and thoroughly mixed.
Table 16
Reagent(s) Usage amount (mu L)
SR RT Primer for Illumina (double dilution) 1.5
Total volume 15.5
2) The reaction conditions are shown in Table 17.
TABLE 17
Temperature (temperature) Time
75℃ 5min
37℃ 15min
25℃ 15min
4℃ Hold
6.45' Joint connection
1) mu.L of 5' SR adapter (stored at-80 ℃) was taken into a new PCR tube, denatured at 70℃for 2min, and immediately thereafter placed on ice.
Note that: the first centrifugation was performed using a 5' SR adapter, then 120. Mu.L of DEPC water was added for dissolution, and the mixture was dispensed into PCR tubes with 10. Mu.L of each tube and stored at-80 ℃.
1) Adding the reaction solution shown in the following table 18 into the upper tube reaction system, and fully and uniformly mixing;
TABLE 18
Reagent(s) Usage amount (mu L)
5′SR Adaptor for Illumina(denatured) 0.5
5′Ligation Reaction Buffer(10X) 0.5
5′Ligation Enzyme Mix 1.25
Total volume 17.25
4) Incubate at 25℃for 1 hour, immediately after which place on ice.
7. Removal of rRNA and tRNA
7.1 removal of rRNA
To the previous sample, 1. Mu.L QIAsequFastselect-rRNAHMR and 1. Mu.L tRNA remover probe (1 ng) were added, mixed well and the procedure shown in Table 19 below was performed in a thermocycler:
TABLE 19
Stage(s) Temperature (. Degree. C.) Time (min)
1 75 2
2 70 2
3 65 2
4 60 2
5 55 2
6 37 2
7 25 2
8 4 Hold
7.2 magnetic bead purification
1) Preparing XP magnetic beads, taking out in advance, standing at room temperature for 30min, fully mixing by vortex oscillation before use, sucking 110 mu L (2.2X) of the XP magnetic beads, adding the XP magnetic beads into a sample of a 50 mu L lower machine, blowing 10 times by a liquid-transfering device, fully mixing, standing at room temperature, and incubating for 5min;
2) Placing the sample on a magnetic rack, standing for 5min, and carefully removing the supernatant after the solution is clarified;
3) The sample was kept always in the magnetic rack, 200 μl of freshly prepared 80% ethanol was added to rinse the beads (note that freshly prepared 80% ethanol was used to rinse the beads and not to blow off the beads), incubated at room temperature for 30s, and the supernatant carefully removed;
4) Repeating the previous step, and rinsing the magnetic beads for 2 times in total;
5) Keeping the sample in the magnetic rack all the time, and uncovering the air to dry the magnetic beads for 5min; the recovery efficiency should be reduced by avoiding excessive drying (cracking) of the beads;
6) The sample was removed from the magnet holder and 18. Mu. LNF-H was added 2 O, lightly blowing for 10 times to fully mix the liquid, and standing for 5min at room temperature. The sample was placed on a magnetic rack and after 5min of standing (after the solution was clear) 18 μl of supernatant was carefully aspirated into a new nucleic-free PCR tube.
8. Reverse transcription
8.1 preparation of reagents
The reagents used are shown in Table 20 and are derived from the kit (NEB, # E7300S).
Table 20
Reagent(s) Storage conditions (. Degree. C.)
First Strand Synthesis Reaction Buffer -20 (Red cover)
Murine RNase Inhibitor -20 (Red cover)
ProtoScriptllReverse Transcriptase -20 (Red cover)
8.2 reverse transcription
1) To the 5' linker ligation product was added the ingredients shown in Table 21 below.
Table 21
Reagent(s) Usage amount (mu L)
First Strand Synthesis Reaction Buffer 4
Murine RNase Inhibitor 0.5
ProtoScriptllReverse Transcriptase 0.5
Total volume 22.25
2) The PCR amplification was immediately performed by incubating at 50℃for 1 hour.
PCR enrichment
9.1 preparation of reagents
The reagents used are shown in table 22.
Table 22
Reagent(s) Storage conditions (. Degree. C.)
LongAmp Taq 2XMaster Mix(NEB，#E7300S) -20
SR Primer for Illumina(NEB，#E7300S) -20
Index(X)Primer(NEB，#E7300S) -20
Nuclease-Free Water Normal temperature
9.2PCR enrichment
1) The components shown in table 23 below were added to the RT reaction mixture and mixed well.
Table 23
Reagent(s) Usage amount (mu L)
LongAmp Taq 2XMaster Mix 25
SR Primer for Illumina 1.5
Index(X)Primer 1.5
Nuclease-Free Water 2.5
Total volume 52.75
2) PCR cycling conditions are shown in Table 24.
Table 24
3) Qubit was quantified and recorded.
10. Non-denaturing PAGE gel
1) A12% native PAGE was performed and the ratio is shown in Table 25.
Table 25
Reagent(s) 15mL glue dosage Dosage of 30mL of gum
30% PolypropyleneAmides and their use 6 mL 12mL
10XTBE 1.5 mL 3mL
ddH 2 O 7.5mL 15mL
10% ammonium persulfate 75μL 150μL
TEMED 15μL 30μL
2) mu.L of 6x loading buffer (NEB, # E7300S) was added to 50. Mu.L of LPCR product, and a plate was prepared with 5. Mu.L of 20bp-500bp Maker.
3) The samples are numbered according to the requirements and spotted in sequence.
4) Electrophoresis was performed at 150V for 100min.
5) After the electrophoresis was completed, the gel was removed after corner cut labeling, and stained with SYBR Gold for 5min, 1:6000 (30 mL pure water+5. Mu.L SYBR Gold).
6) And cutting the gel, wherein the range is 140-160bp. The cut glue was transferred to a centrifuge tube with a well punched.
11. Recovery and purification of warehouse-building products
11.1 consumable preparation
Taking a 0.5mL centrifuge tube, pricking a hole at the bottom by a syringe needle to form a sieve shape, and placing the sieve shape into a 2mL centrifuge tube. Spin-X filter tubes were prepared.
11.2 preparation of reagents
The reagents used are shown in table 26.
Table 26
Reagent(s) Storage conditions (. Degree. C.)
NF H 2 O Normal temperature
3M sodium acetate Normal temperature
Glycogen -20
Absolute ethyl alcohol -20
80% ethanol -20, ready-to-use
11.3 recovery purification
1) The cut gel was placed in a prepared 2mL centrifuge tube (0.5 mL centrifuge tube), and centrifuged at 13000rpm at 4℃for 5min.
2) 200 mu LEB (Gel Elution Buffer) was added to the gel fragments and shaken at 1000rpm with a shaker at 50℃for 1h.
3) The above solution was transferred to Spin-X centrifugal filter tubes and centrifuged at 13000rpm at 4℃for 10min.
4) The reagents were added and thoroughly mixed as shown in table 27 below.
Table 27
Reagent(s) Usage amount (. Mu.L)/sample
3M sodium acetate 13
Glycogen 2.5
Absolute ethyl alcohol 600
5) Centrifuging instantaneously, and standing at-20deg.C for more than 1 hr.
6) Centrifuge at 13000rpm for 15min at 4℃and carefully aspirate the supernatant.
7) 1000. Mu.L of 70% ethanol was added and the supernatant was discarded after centrifugation at 13000rpm for 5min.
8) The step 7 was repeated, and the supernatant was aspirated as much as possible.
9) The DNA pellet was dissolved with 11. Mu.L EB and gently aspirated 20 times to promote dissolution.
10 Qubit was quantified and recorded, the library name was written on each library tube cover, the library was diluted to 1 ng/. Mu.L, and 20. Mu.L of the dilution was pooled for examination.
The library construction process of the ribosome map analysis library is schematically shown in FIG. 1.
Example 4
The results of the test performed using the method shown in example 3, shown in Table 28, showed that the residual effect of tRNA fragments in the data was significantly removed, reducing the yield of invalid data, and the residual of tRNA fragments in the human cell samples was maintained below 5%.
Table 28: results of test for effectiveness of tRNA removal probe sequence from human cell sample
Note that: in Table 28, the results of examining the residues of tRNA fragments in the T1-1 and T1-2 samples show that the amount of tRNA in the T1-1 sample is greater than the T1-2 sample, although more probe-removing reagent is added to the T1-1 sample. This phenomenon belongs to a normal experimental phenomenon which may exist in experiments. The efficiency of tRNA removal from the sample is a range, and the use of the tRNA removal probe and method described above can greatly reduce the tRNA content of the sample. The tRNA is removed in the process of the tRNA, which is possibly related to fine factors such as experimental operation, reagent addition of a reaction system and the like, and the method has little practical significance for comparison between pure residual quantity data after removal.
Example 5
The results of testing human-related cells and tissues using the method described in example 3 showed that the removal of tRNA probe was more than expected and very effective, keeping the fragment residue of tRNA within 10%, and the results of the specific experiments are shown in Table 29.
Table 29
Sample type rRNA ratio tRNA ratio rRNA+tRNA ratio coding％
Human embryonic stem cells 34.79％ 3.34％ 38.13％ 89.60％
Human embryonic stem cells 37.36％ 3.86％ 41.22％ 86.92％
Human thyroid cancer papillary cells 37.64％ 2.76％ 40.40％ 87.23％
Human thyroid cancer papillary cells 38.79％ 2.58％ 41.37％ 87.61％
Human stomach cancer tissue 40.65％ 5.28％ 45.93％ 83.76％
Human stomach cancer tissue 45.47％ 2.32％ 47.79％ 88.74％
Example 6
24 human source samples were tested using the method described in example 3 above, and Riboseq experiments were performed using 24 human source samples, with or without tRNA probe added, and the overall results are shown in FIG. 2. The overall results show that addition of tRNA probes is effective in reducing rRNA and tRNA residues. For the reduction of rRNA residues, the applicant speculates that the tRNA probes described above can also bind to part of the residual rRNA, thereby achieving the unexpected technical effect of removing part of the rRNA at the same time as removing tRNA.
From the above description, it can be seen that the above embodiments of the present application achieve the following technical effects: using the above-mentioned sequence capable of hybridizing with SEQ ID NO:1, including but not limited to the tRNA removal probes of SEQ ID NO:2, or removing the tRNA fragments protected by ribosomes in a ribosome profile analysis by using the above-described removing method or kit, thereby increasing the ratio of effective data in a Ribo-seq library.
The above description is only of the preferred embodiments of the present application and is not intended to limit the present application, but various modifications and variations can be made to the present application by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims (10)

1. A method for removing RNA fragments in a ribosome profile analysis, the method comprising: analyzing sample binding with a tRNA removal probe and a ribosome profile, wherein the tRNA removal probe and a tRNA fragment in the RNA fragment form a double-stranded RNA structure, and removing the tRNA fragment by removing the double-stranded RNA structure; the tRNA-removal probe comprises a nucleotide sequence capable of hybridizing to SEQ ID NO:1, and a sequence to which the conserved sequences shown in 1 specifically bind.
2. The method of claim 1, wherein the tRNA removal probe comprises a DNA sequence consisting of deoxyribonucleotides.
3. The method of removal of claim 2, wherein the tRNA removal probe comprises a nucleotide sequence comprising SEQ ID NO:2, and a sequence of the sequence shown in 2;
preferably, the tRNA remover probe has a 5' end of SEQ ID NO: 2;
preferably, the tRNA removal probe is SEQ ID NO:2, and a sequence shown in seq id no.
4. The method of claim 1, wherein the tRNA is depleted of probe ribonucleotides with a locked nucleic acid modification.
5. The method of claim 1, wherein the tRNA removal probe is 18-29nt in length.
6. The method of claim 1, wherein removing the double-stranded RNA structure comprises removing the double-stranded RNA structure using one or more of magnetic beads, rnase, chromatography columns, or filtration membranes.
7. The removal method according to claim 1, characterized in that the removal method comprises: binding the tRNA removal probe to the ribosome profiling sample to which a sequencing linker is attached during the pooling of a ribosome profiling library;
the library construction process of the ribosome map analysis library comprises the following steps:
lysing the cell or tissue sample, and fixing the ribosome by using a translation inhibitor to obtain a ribosome-immobilized sample;
digesting the ribosome-immobilized sample by using RNase, and purifying to obtain a ribosome-protected fragment;
carrying out terminal phosphorylation and sequencing joint connection on the ribosome protection fragment to obtain a ribosome profile analysis sample connected with the sequencing joint;
binding the tRNA-depleted probe to the ribosome profile analysis sample to which the sequencing linker is attached, and removing the double-stranded RNA structure to obtain a tRNA-depleted sample;
and carrying out reverse transcription, PCR enrichment and purification on the tRNA-removed sample to obtain the ribosome analysis library of the tRNA-removed fragment.
8. The removal method according to any one of claims 1 to 7, further comprising removing rRNA fragments in the RNA fragments using a probe for removing rRNA.
9. The method of claim 8, wherein the tRNA removal probe binds to the ribosome profile sample simultaneously with the probe for removing rRNA, wherein the tRNA removal probe forms a first double-stranded RNA structure with the tRNA fragment, and wherein the probe for removing rRNA forms a second double-stranded RNA structure with the rRNA fragment, and wherein the first double-stranded RNA structure and the second double-stranded RNA structure are removed simultaneously.
10. Use of the removal method of any one of claims 1 to 9 in a ribosome profile analysis or ribosome protective tRNA analysis.
CN202310879220.5A 2023-07-17 2023-07-17 Method for removing RNA fragments in ribosome profile analysis and application thereof Pending CN116837070A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310879220.5A CN116837070A (en) 2023-07-17 2023-07-17 Method for removing RNA fragments in ribosome profile analysis and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310879220.5A CN116837070A (en) 2023-07-17 2023-07-17 Method for removing RNA fragments in ribosome profile analysis and application thereof

Publications (1)

Publication Number Publication Date
CN116837070A true CN116837070A (en) 2023-10-03

Family

ID=88172467

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310879220.5A Pending CN116837070A (en) 2023-07-17 2023-07-17 Method for removing RNA fragments in ribosome profile analysis and application thereof

Country Status (1)

Country Link
CN (1) CN116837070A (en)

Similar Documents

Publication Publication Date Title
EP1654361B2 (en) Methods and compositions for preparing rna from a fixed sample
WO2016037416A1 (en) Vesicular linker and uses thereof in nucleic acid library construction and sequencing
US20160122753A1 (en) High-throughput rna-seq
CN111808854B (en) Balanced joint with molecular bar code and method for quickly constructing transcriptome library
CN113061648B (en) Method for constructing micro sample m6A modification detection library by aid of Tn5 transposase and application of method
CN109486923B (en) Primer system for sequencing multiple amplicons, application thereof and method for constructing sequencing library
CN112359093B (en) Method and kit for preparing and expressing and quantifying free miRNA library in blood
JP7248228B2 (en) Methods and kits for construction of RNA libraries
CN111378720A (en) Construction method and application of sequencing library of long-chain non-coding RNA
CN113463202A (en) Novel RNA high-throughput sequencing method, primer group and kit and application thereof
CN111549380B (en) Kit for constructing double-stranded RNA sequencing library and application thereof
CN111748637A (en) SNP molecular marker combination, multiplex composite amplification primer set, kit and method for genetic relationship analysis and identification
CN114774527A (en) High-throughput single-cell transcriptome sequencing method and application thereof
CN114507711A (en) Single cell transcriptome sequencing method and application thereof
CN112094892B (en) Composition for removing rRNA and Globin mRNA in human total RNA
CN112592981B (en) Primer group, kit and method for DNA archive construction
CN111560651B (en) Method for preparing double-stranded RNA sequencing library
TW201321520A (en) Method and system for virus detection
WO2023202030A1 (en) Method for constructing high-throughput sequencing library of small rna
US20220002797A1 (en) Full-length rna sequencing
CN116814767A (en) Probe set, kit, method and application for detecting alpha thalassemia and beta thalassemia related pathogenic genes
CN116837070A (en) Method for removing RNA fragments in ribosome profile analysis and application thereof
CN116837071A (en) Method for removing RNA fragments in ribosome profile analysis and application thereof
CN115029414A (en) Method for establishing database by Ribosome-seq of absolute quantitative translation group
CN108531609B (en) Set of golden monkshood EST-SSR primers and kit developed based on transcriptome sequencing

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination