CN116814582A

CN116814582A - Taq DNA polymerase mutant and application thereof

Info

Publication number: CN116814582A
Application number: CN202310050404.0A
Authority: CN
Inventors: 朱振宇; 孙大鹏
Original assignee: Wuhan Abclonal Inc
Current assignee: Wuhan Abclonal Inc
Priority date: 2022-06-29
Filing date: 2022-06-29
Publication date: 2023-09-29
Also published as: CN115851661A; CN116814584A; CN115044569A; CN116790548A; CN116814583A; CN116790549A; CN115044569B

Abstract

The application discloses a Taq DNA polymerase mutant and application thereof. The Taq DNA polymerase mutant has the following mutation on the basis of the amino acid sequence SEQ ID NO. 1: E9K, L15S, D18R, H20E, H21E, K E and R37D, etc. The Taq DNA polymerase mutant obtained by the method is different from wild Taq DNA polymerase in that the Taq DNA polymerase mutant has high-efficiency and stable reverse transcriptase activity, can convert cDNA with RNA substrate as high-efficiency, and can amplify the cDNA under standard reaction conditions without adding reverse transcriptase, thereby remarkably improving the efficiency of detecting target ribonucleic acid (RNA) by real-time fluorescence quantitative PCR.

Description

Taq DNA polymerase mutant and application thereof

The application relates to a divisional application of a patent application with the application number of 20221076015. X (the application date of the original application is 2022, 06 and 29), and the application name is Taq DNA polymerase mutant and application thereof.

Technical Field

The application belongs to the technical field of genetic engineering, and relates to a Taq DNA polymerase mutant and application thereof.

Background

Real-time RT-PCR is a method for detecting RNA in a sample by detecting a fluorescent signal that increases over time as amplicons are generated in a qPCR reaction. At present, the most well known application of RT-PCR is the detection of viral genetic material, such as SARS-CoV2 (COVID-19), in patient samples during diagnostic laboratory tests. RT-PCR is a standard for detection of RNA targets for molecular biology, medicine and forensic research.

Taq DNA polymerase is commonly used in molecular biology to expand nucleic acid amplicons in Polymerase Chain Reaction (PCR). In PCR, a specified DNA fragment (amplicon) is amplified by a repeated cycle of three steps: denaturation, annealing, and extension/expansion of amplicons. Using qualitative real-time PCR (qPCR), fluorescent signals generated by dyes or probes can collect data during the PCR cycle so that target amplification can be measured and recorded. Probe-based chemistry utilizes fluorescently labeled target-specific probes that release reporter dye only upon binding to the target sequence, allowing real-time detection of target amplification as the fluorescent signal intensity increases.

RT-PCR allows detection and amplification of RNA substrates. When reverse transcriptase is included in the qPCR reaction, RNA can be detected by an additional initial cycling step, wherein the reverse transcriptase generates DNA (cDNA) complementary to the RNA substrate; the cDNA may then be amplified by DNA polymerase for quantification. Current RT-PCR protocols rely on a combination of reverse transcriptase and DNA polymerase to generate data, in most cases Taq polymerase is limited to amplification of DNA substrates; few examples of the ability to generate cDNA from RNA substrates generally rely on very specific buffers and protocols, or on aspartic acid mutations at amino acid 732, and in general, taq activity in these cases is generally not as strong as reverse transcriptase.

In summary, how to provide Taq DNA polymerase with high reverse transcriptase activity has important significance in the RNA detection field.

Disclosure of Invention

Aiming at the defects and actual demands of the prior art, the application provides a Taq DNA polymerase mutant and application thereof.

In order to achieve the above purpose, the application adopts the following technical scheme:

in a first aspect, the application provides a Taq DNA polymerase mutant which is mutated on the basis of the amino acid sequence SEQ ID NO.1 as follows:

the method comprises the steps of (1) providing a combination of E9 15 18 20 31 66 82 83 87 89 90 99 101 108 31 101,108,109,109,109,150,157,157,168,168 189 189,189,202 230,230,230,230,230,230,230,233,233,235,236,237,237,etc. providing a combination of E39K and E189K, a combination of E39K and E230K, a combination of E39K and E520K, a combination of E39K and E537K, a combination of E39K and D578R, a combination of E39K and D732R, a combination of E39K a combination of E39K and E742K, a combination of G46D and E189K, a combination of G46D and E230K, a combination of G46D and N384R, a combination of G46D and D578R, a combination of E189K and E230K, a combination of E189K and E520K, a combination of E189K and E537K, a combination of E189K and D578R, a combination of E189K and D732R, a combination of E189K and E742K, a combination of E230K and E520K, a combination of E230K and E537K, a combination of E230K and D578R, a combination of E230K and D732R a combination of E230K and E742K, a combination of E520K and E537K, a combination of E520K and D578R, a combination of E520K and D732R, a combination of E520K and E742K, a combination of E537K and D578R, a combination of E537K and D732R, a combination of E537K and E742K, a combination of D578R and D732R, a combination of D578R and E742K, a combination of D732R and E742K, a combination of E39K and E230K and E742K, a combination of G46D and E189K and D578R a combination of G46D and E189K and F667Y, a combination of G46D and E189K and D732R, a combination of G46D and E230K and F667Y, a combination of G46D and E230K and D732R, a combination of G46D and N384R and F667Y, a combination of G46D and D578R and F667Y, a combination of E189K and E230K and E520K, a combination of E189K and E230K and E537K, a combination of E189K and E230K and D578R, a combination of E189K and E230K and D732R, a combination of E189K and E230K and E742K, A combination of E189K and E520K and E537K, a combination of E189K and E520K and D578R, a combination of E189K and E520K/D732R, a combination of E189K/E520K/E742K, a combination of E189K/E537K/D578R, a combination of E189K and E537K and D732R, a combination of E189K and E537K and E742K, a combination of E189K and D578R and D732R, a combination of E189K and D578R and E742K, a combination of E230K and E520K and E537K, a combination of E230K and E520K and D732R, a combination of E230K and E520K and E742K, a combination of E230K and E537K and D732R a combination of E230K and E537K and D732R, a combination of E230K and D578R and D732R, a combination of E230K and D732R and E742K, a combination of E230K and D578R and E742K, a combination of E230K and D732R and E742K, a combination of E520K and E537K and D578R, a combination of E520K and D537R and D732R, a combination of E520K and D732R and E742K, a combination of E537K and D578R and D732R, a combination of E537K and D578R and E742K, a combination of D230R and E742K, a combination of G46D and E189K and E230K and F667Y, a combination of G46D and E189K and D578R and F667Y.

In the application, the Taq DNA polymerase mutant is obtained through point mutagenesis, and is different from wild Taq DNA polymerase, the wild Taq DNA polymerase only has limited reverse transcriptase activity under very strict reaction conditions, the Taq DNA polymerase mutant can efficiently convert cDNA by taking RNA as a substrate, and amplify the cDNA under standard reaction conditions without adding reverse transcriptase, so that the efficiency of detecting target ribonucleic acid (RNA) by real-time fluorescence quantitative PCR can be remarkably improved, and meanwhile, the scheme can be simplified, and the scheme optimization is facilitated, for example, the buffer composition is adjusted to be the most effective component for single enzyme.

SEQ ID NO.1：

MRGMLPLFEPKGRVLLVDGHHLAYRTFHALKGLTTSRGEPVQAVYGFAKSLLKALKEDGDAVIVVFDAKAPSFRHEAYGGYKAGRAPTPEDFPRQLALIKELVDLLGLARLEVPGYEADDVLASLAKKAEKEGYEVRILTADKDLYQLLSDRIHVLHPEGYLITPAWLWEKYGLRPDQWADYRALTGDESDNLPGVKGIGEKTARKLLEEWGSLEALLKNLDRLKPAIREKILAHMDDLKLSWDLAKVRTDLPLEVDFAKRREPDRERLRAFLERLEFGSLLHEFGLLESPKALEEAPWPPPEGAFVGFVLSRKEPMWADLLALAAARGGRVHRAPEPYKALRDLKEARGLLAKDLSVLALREGLGLPPGDDPMLLAYLLDPSNTTPEGVARRYGGEWTEEAGERAALSERLFANLWGRLEGEERLLWLYREVERPLSAVLAHMEATGVRLDVAYLRALSLEVAEEIARLEAEVFRLAGHPFNLNSRDQLERVLFDELGLPAIGKTEKTGKRSTSAAVLEALREAHPIVEKILQYRELTKLKSTYIDPLPDLIHPRTGRLHTRFNQTATATGRLSSSDPNLQNIPVRTPLGQRIRRAFIAEEGWLLVALDYSQIELRVLAHLSGDENLIRVFQEGRDIHTETASWMFGVPREAVDPLMRRAAKTINFGVLYGMSAHRLSQELAIPYEEAQAFIERYFQSFPKVRAWIEKTLEEGRRRGYVETLFGRRRYVPDLEARVKSVREAAERMAFNMPVQGTAADLMKLAMVKLFPRLEEMGARMLLQVHDELVLEAPKERAEAVARLAKEVMEGVYPLAVPLEVEVGIGEDWLSAKEGSGSSGHHHHHH。

In a second aspect, the application provides a nucleic acid molecule comprising a nucleic acid sequence encoding the Taq DNA polymerase mutant of the first aspect.

In a third aspect, the present application provides an expression vector comprising a nucleic acid molecule according to the second aspect.

Preferably, the expression vector comprises a plasmid vector or a viral vector.

In a fourth aspect, the present application provides a recombinant cell comprising a nucleic acid molecule according to the second aspect or an expression vector according to the third aspect.

In a fifth aspect, the application provides the use of the Taq DNA polymerase mutant of the first aspect in the preparation of a reverse transcription reagent.

The Taq DNA polymerase mutant obtained by the application has high-efficiency and stable reverse transcription activity, and can be effectively applied to preparation of a reverse transcription reaction reagent.

In a sixth aspect, the present application provides a reverse transcription kit comprising the Taq DNA polymerase mutant of the first aspect.

Preferably, the kit further comprises a PCR reaction solution.

In a seventh aspect, the present application provides the use of a Taq DNA polymerase mutant according to the first aspect in a reverse transcription reaction.

In an eighth aspect, the present application provides a reverse transcription PCR method comprising:

reverse transcription PCR was performed using RNA as template and Taq DNA polymerase mutant as described in the first aspect.

In a ninth aspect, the application provides the use of a Taq DNA polymerase mutant according to the first aspect in RNA detection.

In a tenth aspect, the present application provides an RNA detection method comprising:

and (3) taking the RNA to be detected as a template, carrying out real-time fluorescence quantitative PCR by using the Taq DNA polymerase mutant in the first aspect, and analyzing a fluorescence result.

In the present application, the amount of RNA to be detected in a real-time fluorescent quantitative PCR mixture is quantified based on the amount of fluorescent signal generated by cleavage of an intercalating dye or a labeled target probe.

Preferably, the intercalating dye comprises SYBRGreen or EvaGreen.

Compared with the prior art, the application has the following beneficial effects:

the Taq DNA polymerase mutant is obtained through point mutagenesis, has high-efficiency and stable reverse transcriptase activity, can efficiently convert cDNA by taking RNA as a substrate, amplifies the cDNA under standard reaction conditions, does not need to additionally add reverse transcriptase, can remarkably improve the efficiency of detecting target ribonucleic acid (RNA) by real-time fluorescence quantitative PCR, and simultaneously can simplify the scheme and facilitate the scheme optimization.

Drawings

FIG. 1 is an agarose gel electrophoresis chart showing the results of activity comparison of wild-type (WT) Taq DNA polymerase and Taq DNA polymerase mutants having mutation sites of E9K, L15S, D R, H, E, H21R, H, 5228, 37D, F66A, K82E, A83F, R85D, P87G, P, 89 5294, 5493, 92A, I99S, E, 101K, L, 102S, L, S, A109, F, R, D, G, 115, P, S124, I, I, 138, 4813, 155, 52156S, respectively;

FIG. 2 is an agarose gel electrophoresis chart showing the results of comparing the activities of wild-type (WT) Taq DNA polymerase and Taq DNA polymerase mutants each having a mutation site, H157E, T164I, L S, R183D, G187P, E189A, E189I, E189I, E, 202, I, E, 230, I, E, 233, I, E235I, E236I, E237I, E244I, E247 52281 291I, E294I, E310I, E314 349I, E379 383I, E394I, E395I, E442F;

FIG. 3 is an agarose gel electrophoresis chart showing the results of comparing the activities of wild-type (WT) Taq DNA polymerase and Taq DNA polymerase mutants each having a mutation site, E507G, E507I, E507L, E537W, T544I, P550G, D578F, D578F, D578F, D732F, D732F, D732F, D732F, D732F, D732F, D732F, D5237 742F, D742F, D742F, D742F, D742F, D742F, D K/E189K (in the present application "/" means a combination of corresponding mutation sites, e.g., E39K/E189K, E39K/E230/E520/E537/F, D K/D578/F, D/D732/F, D K/E742/F, D D/E189/F, D D/E230K;

FIG. 4 is an agarose gel electrophoresis chart showing the results of comparing the activities of wild-type (WT) Taq DNA polymerase and Taq DNA polymerase mutants each having a mutation site, G46D/N384D/D578 189K/E230K/E520K/E189K/E537 189K/D578 189K/D732K/E742 230K/E520K/E537 230K/D578 230K/D732 230K/E742 520K/E537 520K/D578 520K/D732 520K/E742 537K/D578 537K/D537K/D732 537K/E742R/D732R/E742 39K/E742K/E230K/E742D/E189K/E230D/E189K/D46D/E578K/F667D/E189K/D732 46D/E230K/F667D/E230K/D732 46D/N384R/F667D/D578R/F667 189K/E230K/E520 189K/E230K/E537K/E230K/D578 189K/E230K/D732K/E230K/E742 189K/E520K/E537 189K/E520K/D578K/E520K/D732K/E520K/E742K/E537K/D578K/E537K/D732K/E537K/E742K/D578R/D732R;

FIG. 5 is an agarose gel electrophoresis chart showing the results of comparing the activities of wild-type (WT) Taq DNA polymerase and Taq DNA polymerase mutants each having a mutation site, E189K/D578R/E742K, E189K/D732R/E742K, E K/E520K/E537K, E K/E520K/D578R, E K/E520K/D732R, E K/E520K/E742K, E K/E537K/D578R, E K/E537K/D732R, E K/D578R/D732R, E K/D732R/E742KE230K/D578R/E742 KE230K/D K, E K/D732R/E742K, E K/E537K/D578R, E K/E537K/D732R, E K/D578R/D732R, E K/D732R/E742K, E537K/D578R/D732R, E537K/D578R/E742K, E537K/D732R/E742K, D578R/D742K, G D/E189K/E230K/F667Y or G46D/E189K/D578R/F667Y.

Detailed Description

The technical means adopted by the application and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the application and are not limiting thereof.

The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.

The term "biologically active fragment" refers to any fragment, derivative, homologue or analogue of Taq DNA polymerase or mutant sequence thereof, which has in vivo or in vitro reverse transcriptase activity specific for a biological molecule. In some embodiments, the biologically active fragment, derivative, homolog or analog of the Taq DNA polymerase mutant has any degree of biological activity of the Taq DNA polymerase mutant in any in vivo or in vitro assay.

In some embodiments, the biologically active fragment may optionally include any number of consecutive amino acid residues of the Taq DNA polymerase mutant sequence. The application also includes polynucleotides encoding any such biologically active fragments and/or degenerate nucleic acid sequences.

The biologically active fragment may be derived from post-transcriptional processing or from translation of alternatively spliced RNA, or may be produced by engineering, batch synthesis, or other suitable manipulation. Biologically active fragments include fragments expressed in natural or endogenous cells, as well as fragments produced in expression systems such as bacterial, yeast, plant, insect or mammalian cells.

The phrase "conservative amino acid substitution" or "conservative mutation" refers to the substitution of one amino acid for another amino acid that has common properties. One functional method of defining the identity between individual amino acids is to analyze the normalized frequency of amino acid changes between the corresponding proteins of the homologous organism (Schulz (1979) Principles of Protein Structure, springer-Verlag). From such analysis, groups of amino acids can be defined, wherein the amino acids within the group preferentially exchange with each other and thus are most similar to each other in their effect on the overall protein structure (Schulz (1979) supra). Examples of groups of amino acids defined in this way may include: "charged/polar group", including Glu, asp, asn, gln, lys, arg and His; "aromatic or cyclic group" including Pro, phe, tyr and Trp; and "aliphatic group", including Gly, ala, val, leu, ile, met, ser, thr and Cys. Within each group, subgroups may also be determined. For example, charged/polar groups of amino acids may be subdivided into subgroups comprising: "positively charged subgroup" including Lys, arg and His; "negatively charged subgroup" includes Glu and Asp; and "polar subgroups" including Asn and Gln. In another example, the aromatic or cyclic group may be subdivided into subgroups comprising: "Nitrogen ring subgroup" includes Pro, his and Trp; and "phenyl subgroup" including Phe and Tyr. In yet a further example, the aliphatic group may be subdivided into subgroups comprising: "Large aliphatic nonpolar subgroups" including Val, leu and Ile; "aliphatic micropolarity subgroup" includes Met, ser, thr and Cys; and "small residue subgroup" includes Gly and Ala. Examples of conservative mutations include amino acid substitutions of amino acids within the above subgroups, such as, but not limited to: lys replaces Arg and vice versa, so that a positive charge can be maintained; glu replaces Asp, vice versaVice versa, this can preserve negative charges; ser replaces Thr and vice versa, so that a free-OH can be maintained; and Gln replaces Asn and vice versa, so that free- -NH can be maintained ₂ . A "conservative variant" is a polypeptide that comprises one or more amino acids that have been substituted for one or more amino acids of a reference polypeptide (e.g., a polypeptide whose sequence is disclosed in a publication or sequence database, or a polypeptide whose sequence has been determined by nucleic acid sequencing), e.g., belonging to the same amino acid group or subgroup as described above, with an amino acid having a common property.

When referring to a gene, "mutant" means that the gene has at least one base (nucleotide) change, deletion, or insertion relative to the native or wild-type gene. The mutation(s) (one or more nucleotide changes, deletions and/or insertions) may be in the coding region of the gene or may be in an intron, 3'UTR, 5' UTR or promoter region. As a non-limiting example, a mutant gene may be a gene inserted within a promoter region that can increase or decrease gene expression; may be a gene with a deletion resulting in the production of a non-functional protein, a truncated protein, a dominant negative protein or a protein-free; alternatively, it may be a gene with one or more point mutations, resulting in a change in amino acids encoding a protein or in aberrant splicing of a gene transcript.

When the terms "Taq DNA polymerase mutant of the present application" and "Taq DNA polymerase mutant" are used in this detailed description section, the Taq DNA polymerase mutant polypeptides tested and exhibiting enhanced reverse transcriptase activity are referred to collectively or individually, depending on the context. The terms "Taq DNA polymerase mutants" and "Taq DNA polymerase mutants" of the present application also include variant sequences and/or degenerate nucleic acid sequences.

"naturally occurring" or "wild type" refers to a form found in nature. For example, a naturally occurring or wild-type polypeptide or polynucleotide sequence is a sequence that is present in an organism that has not been intentionally modified by human manipulation.

In some embodiments, the present application relates to methods (and related kits, systems, devices, and compositions) for performing a ligation reaction comprising or consisting of: contacting a Taq DNA polymerase mutant or biologically active fragment thereof with a nucleic acid template in the presence of one or more nucleotides, and ligating at least one of the one or more nucleotides using the Taq DNA polymerase mutant or biologically active fragment thereof.

In some embodiments, the method of performing a ligation reaction may comprise ligating a double stranded RNA or DNA polynucleotide strand into a circular molecule. In some embodiments, the method may further comprise detecting a signal indicative of the connection using a sensor. In some embodiments, the sensor is an ISFET. In some embodiments, the sensor may include a detectable label or a detectable reagent in the ligation reaction.

The Taq DNA polymerase mutants of the present application may be expressed in any suitable host system, including bacterial, yeast, fungal, baculovirus, plant or mammalian host cells.

For bacterial host cells, promoters useful for transcription of Taq DNA polymerase mutants include those obtained from: coli lac operon, streptomyces coelicolor agarase gene (dagA), bacillus subtilis levan deer enzyme gene (sacB), bacillus licheniformis alpha-amylase gene (amyL), bacillus stearothermophilus maltogenic amylase gene (amyM), bacillus amyloliquefaciens alpha-amylase gene (amyQ), bacillus licheniformis penicillinase gene (penP), bacillus subtilis xylA and xylB genes and prokaryotic beta-lactamase gene (Villa-Kamarofelta, 1978,Proc.Natl Acad.Sci.USA75:3727-3731), and tac promoter (DeBoeretal., 1983,Proc.NatlAcad.Sci.USA80:21-25).

For filamentous fungal host cells, promoters useful for transcription of the Taq DNA polymerase mutant include those obtained from the following sources of genes: aspergillus oryzae TAKA amylase, rhizomucor miehei aspartic proteinase, aspergillus niger neutral alpha-amylase, aspergillus niger acid stable alpha-amylase, aspergillus niger or Aspergillus awamori glucoamylase (glaA), rhizomucor miehei lipase, aspergillus oryzae alkaline proteinase, aspergillus oryzae triose phosphate isomerase, aspergillus nidulans acetamidase, and Fusarium oxysporum trypsin-like proteinase (WO 96/00787), and NA2-tpi promoters (hybrids from promoters of Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase genes), and mutant, truncated, and hybrid promoters thereof.

In yeast hosts, promoters useful for transcription of Taq DNA polymerase mutants may be derived from genes for Saccharomyces cerevisiae enolase (ENO-1), saccharomyces cerevisiae galactokinase (GAL 1), saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH 2/GAP), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described in romanoset al, 1992, yeast8:423-488.

For baculovirus expression, promoters useful for transcription of Taq DNA polymerase mutants may be derived from insect cell lines of the Lepidoptera (moths and butterflies), such as Spodoptera frugiperda, used as hosts. Gene expression is controlled by a strong promoter, e.g.pPolh.

Plant expression vectors are based on Ti plasmids of Agrobacterium tumefaciens, or on Tobacco Mosaic Virus (TMV), potato virus X or cowpea mosaic virus. A common constitutive promoter in plant expression vectors is the cauliflower mosaic virus (CaMV) 35S promoter.

For mammalian expression, cultured mammalian cell lines such as Chinese Hamster Ovary (CHO), COS (including human cell lines such as HEK and HeLa) can be used to produce Taq DNA polymerase mutants. Mammalian expression vectors include adenovirus vectors, pSV and pCMV series plasmid vectors, vaccinia virus and retrovirus vectors, and baculovirus. Cytomegalovirus (CMV) and SV40 promoters are commonly used in mammalian expression vectors to drive gene expression. Non-viral promoters, such as the Elongation Factor (EF) -1 promoter, are also known.

The control sequence for expression may be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used.

For example, exemplary transcription terminators for filamentous fungal host cells may be obtained from the genes for Aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, aspergillus nidulans anthranilate synthase, aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin-like protease.

Exemplary terminators for yeast host cells can be obtained from genes for Saccharomyces cerevisiae enolase, saccharomyces cerevisiae cytochrome C (CYC 1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase.

The control sequence may also be a suitable leader sequence, i.e., an untranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used. Exemplary leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase. The leader sequences suitable for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), saccharomyces cerevisiae 3-phosphoglycerate kinase, saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH 2/GAP).

The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleic acid sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present application. Exemplary polyadenylation sequences for filamentous fungal host cells may be derived from the genes for Aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, aspergillus nidulans anthranilate synthase, fusarium oxysporum trypsin-like protease, and Aspergillus niger alpha-glucosidase.

The control sequence may also be a signal peptide coding region that encodes an amino acid sequence linked to the amino terminus of the polypeptide and directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region encoding the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region foreign to the coding sequence. An exogenous signal peptide coding region may be required when the coding sequence does not naturally contain a signal peptide coding region.

Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region to enhance secretion of the polypeptide. However, any signal peptide coding region that directs the expressed polypeptide into the secretory pathway of a host cell of choice may be used.

The effective signal peptide coding region of the bacterial host cell is that obtained from the genes for bacillus NCIB11837 maltogenic amylase, bacillus stearothermophilus alpha-amylase, bacillus licheniformis subtilisin, bacillus licheniformis beta-lactamase, bacillus stearothermophilus neutral proteases (nprT, nprS, nprM) and bacillus subtilis prsA. Simonen and Palva,1993, microbiol Rev57:109-137 further describe signal peptides.

The effective signal peptide coding region of the filamentous fungal host cell may be the signal peptide coding region obtained from the genes for Aspergillus oryzae TAKA amylase, aspergillus niger neutral amylase, aspergillus niger glucoamylase, rhizomucor miehei aspartic proteinase, humicola insolens cellulase, and Humicola lanuginosa lipase.

Useful signal peptides for yeast host cells may be derived from genes for Saccharomyces cerevisiae alpha factor and Saccharomyces cerevisiae invertase. Signal peptides for other host cell systems are also well known.

The control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resulting polypeptide is referred to as a zymogen or pro-polypeptide (or zymogen in some cases). A pro-polypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the pro-polypeptide from the pro-polypeptide. The propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), bacillus subtilis neutral protease (nprT), saccharomyces cerevisiae alpha-factor, rhizomucor miehei aspartic proteinase, and myceliophthora thermophila lactase (WO 95/33836).

When both the signal peptide and the propeptide region are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.

It may also be desirable to add regulatory sequences that allow for regulation of expression of the Taq DNA polymerase mutant relative to the growth of the host cell. Examples of regulatory systems are those that cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In prokaryotic host cells, suitable regulatory sequences include the lac, tac and trp manipulation systems. In yeast host cells, suitable regulatory systems include, for example, the ADH2 system or the GAL1 system. In filamentous fungi, suitable regulatory sequences include the TAKA alpha-amylase promoter, the Aspergillus niger glucoamylase promoter, and the Aspergillus oryzae glucoamylase promoter. Other host cell regulatory systems are also well known.

Other examples of regulatory sequences are sequences which allow for gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene amplified in the presence of methotrexate and the metallothionein genes amplified with heavy metals. In these cases, the nucleic acid sequence encoding the polypeptide of the application will be operably linked to regulatory sequences.

One embodiment includes a recombinant expression vector comprising a polynucleotide encoding an engineered Taq DNA polymerase mutant, and one or more expression regulatory regions, such as promoters and terminators, and an origin of replication, depending on the type of host into which they are to be introduced. The various nucleic acids and control sequences described above may be ligated together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleic acid sequence encoding the Taq DNA polymerase mutant at these sites. Alternatively, the nucleic acid sequence of the Taq DNA polymerase mutant may be expressed by inserting the nucleic acid sequence or a nucleic acid construct comprising the sequence into a suitable expression vector. In constructing an expression vector, the coding sequence is located in the vector such that the coding sequence is operably linked to the appropriate control sequences for expression.

The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and that can cause expression of the Taq DNA polymerase mutant polynucleotide sequence. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is introduced. The vector may be a linear or closed circular plasmid.

The expression vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may comprise any means of ensuring self-replication. Alternatively, the vector may be one that is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated when introduced into the host cell. Furthermore, a single vector or plasmid, or two or more vectors or plasmids, which together comprise the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.

The expression vectors of the present application preferably comprise one or more selectable markers that allow for easy selection of transformed cells. A selectable marker is a gene whose product provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like. Examples of bacterial selection markers are the dal genes from bacillus subtilis or bacillus licheniformis, or markers conferring antibiotic resistance such as ampicillin, kanamycin, chloramphenicol (example 1) or tetracycline resistance. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5' -phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase) and equivalents thereof. Embodiments for Aspergillus cells include the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus. Selectable markers for insect, plant and mammalian cells are also well known.

The expression vectors of the application preferably comprise elements that allow the vector to integrate into the host cell genome or to autonomously replicate the vector in the cell independently of the genome. For integration into the host cell genome, the vector may rely on the nucleic acid sequence encoding the polypeptide or any other element of the vector to integrate the vector into the genome by homologous or non-homologous recombination.

Alternatively, the expression vector may comprise additional nucleic acid sequences for directing integration into the genome of the host cell by homologous recombination. The additional nucleic acid sequences enable integration of the vector into the host cell genome at a precise location in the chromosome. The integration element may be any sequence homologous to a target sequence in the host cell genome. Furthermore, the integrational elements may be non-encoding or encoding nucleic acid sequences. In another aspect, the vector may be integrated into the genome of the host cell by non-homologous recombination.

For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. Examples of bacterial origins of replication are the origins of replication of the plasmids pBR322, pUC19, pACYC177 (which have the origin of replication of P15A ori) or pACYC184, or of the plasmids pUB110, pE194, pTA1060 or pAM31, which allow replication in Bacillus. Examples of origins of replication used in yeast host cells are the 2 micron origins of replication ARS1, ARS4, a combination of ARS1 and CEN3, and a combination of ARS4 and CEN 6. The origin of replication may be a mutation that renders it temperature sensitive in the host cell (see, e.g., ehrlich,1978,Proc Natl Acad Sci.USA 75:1433).

More than one copy of the nucleic acid sequence of the Taq DNA polymerase mutant may be inserted into a host cell to increase production of the gene product. The increase in the number of copies of the nucleic acid sequence may be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene in the nucleic acid sequence, wherein the additional copy of the nucleic acid sequence may be selected by culturing the cell in the presence of a suitable selection reagent to select for cells containing the amplifiable selectable marker gene copy.

Expression vectors for the Taq DNA polymerase mutant polynucleotides are commercially available. Suitable commercial expression vectors include p3xFLAGTM expression vectors from Sigma-Aldrich Chemicals, st. Louis Mo. Which include a CMV promoter and hGH polyadenylation site for expression in mammalian host cells, as well as a pBR322 origin of replication and an ampicillin resistance marker for amplification in E.coli. Other suitable expression vectors are pBluescriptII SK (-) and pBK-CMV, which are commercially available from Stratagene, laJolla CA, and plasmids from pBR322 (Gibco BRL), pUC (Gibco BRL), pREP4, pCEP4 (Invitrogen) or pPoly (Lathey et al, 1987, gene 57:193-201).

Suitable host cells for expressing the polynucleotides encoding Taq DNA polymerase mutants are well known in the art and include, but are not limited to, bacterial cells such as E.coli, L.kefir, L.brevis, L.parvulus, streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells (e.g., saccharomyces cerevisiae or Pichia pastoris (ATCC application No. 201178)); insect cells, such as Drosophila S2 and Spodoptera Sf9 cells; animal cells, such as CHO, COS, BHK, 293 and Bowes melanoma cells; and plant cells.

Polynucleotides for expressing the Taq DNA polymerase mutants may be introduced into cells by various methods known in the art. Techniques include electroporation, biolistics microprojectile bombardment, liposome-mediated transfection, calcium chloride transfection, protoplast fusion, and the like.

Polynucleotides encoding the Taq DNA polymerase mutants may be prepared by standard solid phase methods according to known synthetic methods. In some embodiments, fragments of up to about 100 bases can be synthesized separately and then ligated (e.g., by enzymatic or chemical litigation methods, or polymerase mediated methods) to form any desired contiguous sequence. For example, polynucleotides may be prepared by chemical synthesis using, for example, the classical phosphoramidite method described by Beaucage et al, 1981,Tet Lett 22:1859-69, or the method described by Matthes et al, 1984,EMBO J.3:801-05, for example, which is typically practiced in an automated synthesis process. According to the phosphoramidite method, oligonucleotides are synthesized, for example, in an automated DNA synthesizer, purified, annealed, ligated and cloned in appropriate vectors. In addition, essentially any nucleic acid can be obtained from a variety of commercial sources, for example, midland Certified Reagent Company, midland, tex; great American Gene Company, ramona, calif; expressGen inc. And Operon Technologies inc., alameda, calif.

Engineered Taq DNA polymerase mutants expressed in host cells may be recovered from the cells and/or culture medium using any one or more well known protein purification techniques including lysozyme treatment, sonication, filtration, salting out, ultracentrifugation and chromatography. Suitable solutions for lysing and efficient extraction of proteins from bacteria (e.g., E.coli) are commercially available from Sigma-Aldrich of St.LouisMo under the trade name CelLyticB.

Chromatographic techniques for separating the Taq DNA polymerase mutants include reverse phase chromatography, high performance liquid chromatography, ion exchange chromatography, gel electrophoresis, affinity chromatography, and the like. The purification conditions will depend in part on factors such as net charge, hydrophobicity, hydrophilicity, molecular weight, molecular shape, and the like, and will be apparent to those skilled in the art.

In some embodiments, affinity techniques may be used to isolate the Taq DNA polymerase mutants. For affinity chromatography purification, any antibody that specifically binds to Taq DNA polymerase mutant can be used. To produce antibodies, various host animals, including but not limited to rabbits, mice, rats, and the like, may be immunized by injection with the compound. The compounds may be attached to a suitable carrier, such as bovine serum albumin, by a side chain functional group or a linker attached to a side chain functional group. Depending on the host species, various adjuvants may be used to increase the immune response, including but not limited to Freund's adjuvant (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (BCG) and Corynebacterium parvum.

Example 1

Taq DNA polymerase mutants were prepared in this example.

Taq DNA polymerase mutants exhibit higher reverse transcriptase activity compared to wild type Taq DNA polymerase, are engineered, characterized and screened by polymerase chain reaction, visualized by agarose gel electrophoresis, and after initial screening using probe-based real-time fluorescent quantitative PCR (qPCR), the specified ribonucleic acid (RNA) target sequence is detected using a typical reverse transcription cycling protocol.

Taq DNA polymerase mutants were generated by conventional inverse PCR mutagenesis of SEQNOID.1. Sequencing and verifying all mutants, expressing and purifying in colibacillus, and adding C-terminal tag to all Taq DNA polymerase mutants and wild Taq DNA polymerase (with the amino acid sequence of SEQ ID NO.1 and the nucleic acid sequence of SEQ ID NO. 2) for purification.

The DNA sequence (wild type) of Taq DNA polymerase with the C-terminal Histag is shown in SEQ ID NO. 2.

SEQ ID NO.2：

atgcgcggtatgctgccgttatttgaaccgaaaggtcgtgtgctgctggttgatggtcatcacttagcatatcgtacctttcatgccctgaaaggcctgaccacctctcgcggcgaaccggttcaggcagtgtatggttttgccaaatcactgctgaaagcattaaaagaagatggcgatgcagtgattgttgtgtttgatgccaaagccccgagctttcgtcatgaagcctatggcggctacaaagcaggtcgcgccccgaccccggaagattttccgcgtcagctggccttaattaaagaattagttgacttgctgggcttagcacgtctggaagttccgggctatgaagcagatgatgttttagcctcactggccaaaaaagccgaaaaagaaggctatgaagttcgcattctgaccgcagataaggatctgtatcagctgctgagcgatcgtattcatgtgttacatccggaaggctatctgattaccccggcatggttatgggaaaaatatggtttacgtccggatcagtgggcagattatcgtgcactgaccggtgacgaatcagataatctgccgggcgttaaaggtattggtgaaaaaaccgcccggaaattattagaagaatggggtagtctggaagcattactgaaaaatctggatcgcctgaaaccggcaattcgcgaaaaaattttagcccacatggatgacttaaaactgtcttgggatctggccaaagtgcgtaccgatctgccgttagaagttgattttgccaaacgtcgcgaaccggatcgtgaacgcctacgagcctttctggaacgcttagaatttggctcactgttacatgaatttggcttactggaatctccgaaagcattagaagaagccccgtggccgccgccggaaggcgcctttgtgggctttgtgctgagtaggaaagaaccgatgtgggcagacttgctggccctggccgcagcacgcggcggtcgcgttcatcgtgccccggaaccgtacaaagccctgcgtgacctgaaagaagcacgcggcttattagccaaagacctgagtgttctggcattaagggaaggcttaggcctgccgccgggcgatgatccgatgctgctggcctatctgcttgacccgagtaataccaccccggaaggcgttgcacgtcgctatggcggcgagtggaccgaagaagcaggcgaacgtgcagccctgtcagaacgtctgtttgccaatctgtggggtcgcttagaaggcgaagaacgcttactgtggttatatcgtgaagtggaacgtccgctgagcgcagtgctggcacacatggaagccaccggtgtgcgcttagatgttgcatatctgcgtgccctgtctctggaagttgcagaagaaattgcacgcttagaagccgaagtttttcgcttagcaggtcatccgtttaacttaaatagtcgcgatcagctggaaagggttctgtttgatgaattaggcctgccggcaattggcaagaccgaaaaaaccggtaaacgctctacctcagccgcagttctggaagccctgcgcgaagcccatccgattgttgaaaaaattttacagtatcgtgaactgaccaaactgaaatctacctatattgatccgttaccggatctaattcatccgcgtaccggtcgcttacatacccgttttaatcagaccgccaccgccaccggtcgcttatcaagtagcgatccgaacttgcagaatattccggtgcgtaccccgttaggtcagcgcattcgtcgtgcctttattgcagaagaaggttggttattagttgcattagattatagtcagattgaactgcgtgtgttagcccatctgagcggcgacgaaaatctgattcgtgtgtttcaggaaggtcgcgatattcataccgaaaccgcctcttggatgtttggtgttccgcgcgaagcagttgatccgttaatgcgccgtgcagccaaaaccattaattttggtgtgctgtatggtatgagcgcacatcgcctgtcacaggaactggcaattccgtatgaagaagcacaggcctttattgaacgctattttcagtcttttccgaaagttcgcgcatggattgaaaaaaccttagaagaaggtcgtcgtcgcggctatgtggaaaccctgtttggtcgtcgtcgctatgttccggatctggaagcgagagttaaatcagtgcgtgaagccgccgaacgcatggcctttaatatgccggttcagggaacggcagctgaccttatgaaactggcaatggttaaactgtttccgcgcctggaagaaatgggtgcacgaatgctgttacaggttcatgatgaattagttctggaagccccgaaagaacgcgccgaagcagttgcacgtctggccaaagaagtgatggaaggtgtgtatccgttagcagttccgttagaagtggaagtgggtattggtgaagattggctgagcgccaaagaaggttctggcagttcaggtcatcaccaccatcatcactaa。

qPCR was performed under the following conditions, wherein the target gene was the 28s gene.

Forward primer: 5'-CCGCTGCGGTGAGCCTTGAA-3'

Reverse primer: 5'-TCTCCGGGATCGGTCGCGTT-3'

Target gene: 28s RNA derived from the total RNA-human tumor cell line: hela (Biochain Cat#R 1255811-50).

Each 10. Mu.L reaction system contained 1.5. Mu.L of 50 ng/. Mu.L Taq DNA polymerase, 0.4. Mu.L of 10. Mu.M forward primer, 0.4. Mu.L of 10. Mu.M reverse primer, 1. Mu.L of 10 ng/. Mu.L of target RNA, 0.4. Mu.L of 10mM equimolar dNTP, 0.1. Mu.L of 1MDTT and 1. Mu.L of 10 Xreaction buffer (final composition 20mM tris hydrochloride, 80mM tris acetate, 10mM ammonium sulfate, 10mM potassium chloride, 2mM magnesium sulfate, 3mM magnesium acetate, 0.1% triton X-100, pH 8.8 (25 ℃)), with water to make up 10. Mu.L.

The thermal cycler used for qPCR assay was Bio-Rad T100, the reaction procedure was as follows: incubation at 60℃for 20 min, denaturation at 95℃for 5 min, followed by 35 cycles (denaturation at 95℃for 10 sec, extension at 60℃for 30 sec) and then incubation at 75℃for 5 min. To each sample was added 3. Mu.L of a 6 Xstop dye containing a 6 XGelRed nucleic acid dye (Biotechnology Cat# 41003). Each 10. Mu.L of sample was loaded into a 2% agarose gel and compared to wild-type (WT) Taq polymerase and a low molecular weight DNA length marker (New England Biolabs, cat#N 3233).

As shown in the results of figures 1-5, compared with wild Taq polymerase, the amplification products amplified by the Taq DNA polymerase mutants of the application have obvious target product bands, which indicates that the Taq DNA polymerase mutants of the application can efficiently convert cDNA by taking RNA as a substrate and amplify the cDNA under standard reaction conditions, namely, the Taq DNA polymerase mutants have high-efficiency reverse transcriptase activity and polymerase activity.

Example 2

This example provides the use of Taq DNA polymerase mutants in real-time fluorescent quantitative PCR (qPCR).

The Taq DNA polymerase mutants obtained in the present application can be used for quantification of RNA in samples using conventional qPCR protocols for RNA detection without the addition of additional reverse transcriptase in the reaction mixture.

In summary, the Taq DNA polymerase mutant obtained by the point mutagenesis has high-efficiency and stable reverse transcriptase activity, is different from wild Taq DNA polymerase, can convert cDNA with RNA substrate as high-efficiency, can amplify the cDNA under standard reaction conditions, does not need to additionally add reverse transcriptase, can remarkably improve the efficiency of detecting target ribonucleic acid (RNA) by real-time fluorescence quantitative PCR, and simultaneously can simplify the scheme and facilitate the scheme optimization.

The applicant states that the detailed method of the present application is illustrated by the above examples, but the present application is not limited to the detailed method described above, i.e. it does not mean that the present application must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present application, equivalent substitution of raw materials for the product of the present application, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present application and the scope of disclosure.

Claims

1. A Taq DNA polymerase mutant, wherein the Taq DNA polymerase mutant has an L156S mutation based on the amino acid sequence SEQ ID No. 1.

2. A nucleic acid molecule comprising a nucleic acid sequence encoding the Taq DNA polymerase mutant of claim 1.

3. An expression vector comprising the nucleic acid molecule of claim 2;

preferably, the expression vector comprises a plasmid vector or a viral vector.

4. A recombinant cell comprising the nucleic acid molecule of claim 2 or the expression vector of claim 3.

5. Use of the Taq DNA polymerase mutant of claim 1 in the preparation of a reverse transcription reaction reagent.

6. A reverse transcription kit comprising the Taq DNA polymerase mutant of claim 1;

preferably, the kit further comprises a PCR reaction solution.

7. Use of the Taq DNA polymerase mutant of claim 1 in a reverse transcription reaction.

8. A reverse transcription PCR method, comprising:

reverse transcription PCR was performed using the Taq DNA polymerase mutant of claim 1 using RNA as a template.

9. Use of the Taq DNA polymerase mutant of claim 1 in RNA detection.

10. An RNA detection method, comprising:

real-time fluorescence quantitative PCR is performed by using the Taq DNA polymerase mutant according to claim 1 and using the RNA to be detected as a template, and a fluorescence result is analyzed.