CN115044569A

CN115044569A - Taq DNA polymerase mutant and application thereof

Info

Publication number: CN115044569A
Application number: CN202210764015.XA
Authority: CN
Inventors: 朱振宇; 孙大鹏
Original assignee: Wuhan Abclonal Inc
Current assignee: Wuhan Abclonal Inc
Priority date: 2022-06-29
Filing date: 2022-06-29
Publication date: 2022-09-13
Anticipated expiration: 2042-06-29
Also published as: CN115044569B; CN116814582A; CN116790548A; CN116814583A; CN116814584A; CN116790549A; CN115851661A

Abstract

The invention discloses a Taq DNA polymerase mutant and application thereof. The Taq DNA polymerase mutant has the following mutations on the basis of an amino acid sequence SEQ ID NO. 1: E9K, L15S, D18R, H20E, H21E, K31E, R37D, and the like. The Taq DNA polymerase mutant is obtained by point mutagenesis, has high-efficiency and stable reverse transcriptase activity different from wild Taq DNA polymerase, can convert cDNA (complementary deoxyribonucleic acid) by taking an RNA substrate as a high-efficiency substrate, amplifies the cDNA under standard reaction conditions, does not need to additionally add reverse transcriptase, and can obviously improve the efficiency of detecting target ribonucleic acid (RNA) by real-time fluorescent quantitative PCR (polymerase chain reaction).

Description

Taq DNA polymerase mutant and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and relates to a Taq DNA polymerase mutant and application thereof.

Background

Real-time RT-PCR is a method for detecting RNA in a sample by detecting a fluorescent signal that increases over time as amplicons are generated in a qPCR reaction. Currently, the most widely known application of RT-PCR is the detection of the presence of viral genetic material, such as SARS-CoV2(COVID-19), in patient samples during diagnostic laboratory testing. RT-PCR is a standard for detection of RNA targets for molecular biology, medicine and forensic research.

Taq DNA polymerase is commonly used in molecular biology to extend nucleic acid amplicons in the Polymerase Chain Reaction (PCR). In PCR, a designated DNA fragment (amplicon) is amplified by a repetitive cycle of three steps: denaturation, annealing and extension/expansion of amplicons. Using qualitative real-time PCR (qpcr), the fluorescent signal generated by the dye or probe enables data to be collected during the PCR cycle so that target amplification can be measured and recorded. Probe-based chemistry utilizes fluorescently labeled target-specific probes that release a reporter dye only upon binding to the target sequence, allowing real-time detection of target amplification as the intensity of the fluorescent signal increases.

RT-PCR allows the detection and amplification of RNA substrates. When reverse transcriptase is included in the qPCR reaction, RNA can be detected by an additional initial cycling step, wherein the reverse transcriptase generates dna (cdna) complementary to the RNA substrate; the cDNA can then be amplified by DNA polymerase for quantification. Current RT-PCR protocols rely on a combination of reverse transcriptase and DNA polymerase to generate data, in most cases Taq polymerase is limited to amplification of DNA substrates; a few examples of the ability to generate cDNA from RNA substrates typically rely on very specific buffers and protocols, or on aspartic acid mutations at amino acid 732, and overall Taq activity in these cases is generally less potent than reverse transcriptase.

In conclusion, how to provide the Taq DNA polymerase with high reverse transcriptase activity has important significance for the field of RNA detection.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides the Taq DNA polymerase mutant and the application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a Taq DNA polymerase mutant, which has the following mutations on the basis of an amino acid sequence SEQ ID NO. 1:

the combination of the combinations of E9, L15, D18, H20, H21, K31, R37, F66, K82, A83, R85, P87, P89, E90, F92, I99, E101, L102, L108, A109, R110, G115, S124, I138, V155, L156, H157, T164, L168, R183, G187, E189, K202, E230, L233, H235, M236, D237, D244, K247, L281, P291, L294, V310, K314, R349, L379, S383, Y394, G395, 442, E507, E537, E507, E550, T550, P578, D732, D742, E520, E39, E79, E520, E189, E185, E189, E5, E185, E742, E46, E189, E578, E742, E46, E578, E46, E189, E578, E189, E578, E742, E46, E578, E46, E578, E732, E742, E46, E189, E46, E742, E189, E732, E742, E46, E189, E46, E189, E742, E189, E46, E189, E732, E46, E189, E732, E46, E742, E189, E732, E742, E46, E189, E742, E189, E732, E742, E189, E46, E189, E732, E742, E46, E189, E732, E46, E189, E46, E742, E189, E46, E189, E732, E189, E46, E189, E742, E189, E732, E46, E189, E732, E46, E732, E189, E732, E742, E46, E189, E742, E732, E46, E189, E46, E732, E46, E189, E732, E742, E189, E732, E189, E732, E742, E46, E732, E46, E189, E46, E732, the combination of E189K and D578R, the combination of E189K and D732R, the combination of E189K and E742K, the combination of E230K and E520K, the combination of E230K and E537K, the combination of E230K and D578R, the combination of E230K and D732R, the combination of E230K and E742K, the combination of E520K and E537K, the combination of E520K and D K, the combination of E520 and D732K, the combination of E520 and E742K, the combination of E K and E537, the combination of E537 and E537K, the combination of E K and E K, the combination of D36732, the combination of D K and E36578, the combination of E537 and K, the combination of E36732 and E K, the combination of E K and K, the combination of E K, the combination of 36537 and K, the combination of E K, the combination of 36537 and K, the combination of E K, the combination of K, the combination of 36537, the combination of E K, the combination of K, the combination of 36537, the combination of E537, the combination of K, the combination of E537, the combination of E K, the combination of E537, the combination of E K, the combination of K, the combination of E537, the combination of K, the combination of E537, the combination of K, the combination of E537, the combination of K, the combination of E537 and K, the combination of K, the combination of the K, the combination of the K, the combination of the K, the combination of the K, the combination of the, The combination of E189 and E520 and D578, the combination of E189 and E520/D732, the combination of E189/E520/E742, the combination of E189/E537/D578, the combination of E189 and E537 and D732, the combination of E189 and E537 and E742, the combination of E189 and D578 and D732, the combination of E189 and D578 and E742, the combination of E189 and D732 and E742, the combination of E230 and E520 and E537, the combination of E230 and E520 and D578, the combination of E230 and E520 and E742, the combination of E230 and E537 and D578, the combination of E230 and E537 and D732, the combination of E230 and D742, the combination of E230 and D578 and E578, the combination of E732 and D578, the combination of E742 and E537 and D578, the combination of E742 and D732, the combination of E537 and D732, the combination of E732, E537, E732, D732, E537, D732, E742, D732, E732, D732, E537, D732, E742, E732, D732, E732, D732, E732, D732, E742, E732, and D732, E732, and D732, E732, and D732, E732, and D732, E742, G46D and E189K and D578R and F667Y in combination.

According to the invention, the Taq DNA polymerase mutant is obtained through point mutagenesis, and different from wild Taq DNA polymerase, the wild Taq DNA polymerase only shows limited reverse transcriptase activity under a very strict reaction condition, the Taq DNA polymerase mutant can efficiently convert cDNA by taking RNA as a substrate, and amplify the cDNA under a standard reaction condition without additionally adding reverse transcriptase, so that the efficiency of detecting target ribonucleic acid (RNA) by real-time fluorescent quantitative PCR can be obviously improved, meanwhile, the scheme can be simplified, and the scheme optimization is facilitated, for example, the buffer solution composition is adjusted to be the most effective component for a single enzyme.

SEQ ID NO.1：

MRGMLPLFEPKGRVLLVDGHHLAYRTFHALKGLTTSRGEPVQAVYGFAKSLLKALKEDGDAVIVVFDAKAPSFRHEAYGGYKAGRAPTPEDFPRQLALIKELVDLLGLARLEVPGYEADDVLASLAKKAEKEGYEVRILTADKDLYQLLSDRIHVLHPEGYLITPAWLWEKYGLRPDQWADYRALTGDESDNLPGVKGIGEKTARKLLEEWGSLEALLKNLDRLKPAIREKILAHMDDLKLSWDLAKVRTDLPLEVDFAKRREPDRERLRAFLERLEFGSLLHEFGLLESPKALEEAPWPPPEGAFVGFVLSRKEPMWADLLALAAARGGRVHRAPEPYKALRDLKEARGLLAKDLSVLALREGLGLPPGDDPMLLAYLLDPSNTTPEGVARRYGGEWTEEAGERAALSERLFANLWGRLEGEERLLWLYREVERPLSAVLAHMEATGVRLDVAYLRALSLEVAEEIARLEAEVFRLAGHPFNLNSRDQLERVLFDELGLPAIGKTEKTGKRSTSAAVLEALREAHPIVEKILQYRELTKLKSTYIDPLPDLIHPRTGRLHTRFNQTATATGRLSSSDPNLQNIPVRTPLGQRIRRAFIAEEGWLLVALDYSQIELRVLAHLSGDENLIRVFQEGRDIHTETASWMFGVPREAVDPLMRRAAKTINFGVLYGMSAHRLSQELAIPYEEAQAFIERYFQSFPKVRAWIEKTLEEGRRRGYVETLFGRRRYVPDLEARVKSVREAAERMAFNMPVQGTAADLMKLAMVKLFPRLEEMGARMLLQVHDELVLEAPKERAEAVARLAKEVMEGVYPLAVPLEVEVGIGEDWLSAKEGSGSSGHHHHHH。

In a second aspect, the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding the Taq DNA polymerase mutant of the first aspect.

In a third aspect, the present invention provides an expression vector comprising the nucleic acid molecule of the second aspect.

Preferably, the expression vector comprises a plasmid vector or a viral vector.

In a fourth aspect, the present invention provides a recombinant cell comprising the nucleic acid molecule of the second aspect or the expression vector of the third aspect.

In a fifth aspect, the invention provides the use of the Taq DNA polymerase mutant of the first aspect in the preparation of a reagent for reverse transcription reaction.

The Taq DNA polymerase mutant obtained by the invention has high-efficiency and stable reverse transcription activity and can be effectively applied to preparation of a reverse transcription reaction reagent.

In a sixth aspect, the invention provides a reverse transcription kit, which comprises the Taq DNA polymerase mutant of the first aspect.

Preferably, the kit further comprises a PCR reaction solution.

In a seventh aspect, the invention provides the use of the Taq DNA polymerase mutant of the first aspect in a reverse transcription reaction.

In an eighth aspect, the present invention provides a reverse transcription PCR method comprising:

reverse transcription PCR is carried out by using the Taq DNA polymerase mutant according to the first aspect with RNA as a template.

In a ninth aspect, the invention provides the use of the Taq DNA polymerase mutant of the first aspect in RNA detection.

In a tenth aspect, the present invention provides a method for detecting RNA, comprising:

and (3) taking the RNA to be detected as a template, and carrying out real-time fluorescence quantitative PCR by using the Taq DNA polymerase mutant of the first aspect to analyze a fluorescence result.

In the present invention, the amount of RNA to be detected in the real-time fluorescent quantitative PCR mixture is quantified based on the amount of fluorescent signal generated by the cleavage of the intercalating dye or the labeled target probe.

Preferably, the intercalating dye comprises SYBR Green or EvaGreen.

Compared with the prior art, the invention has the following beneficial effects:

the Taq DNA polymerase mutant is obtained by point mutagenesis, has high-efficiency and stable reverse transcriptase activity different from wild Taq DNA polymerase, can efficiently convert cDNA by taking RNA as a substrate, amplifies the cDNA under standard reaction conditions, does not need to additionally add reverse transcriptase, can remarkably improve the efficiency of detecting target ribonucleic acid (RNA) by real-time fluorescence quantitative PCR, and can simplify the scheme and facilitate the optimization of the scheme.

Drawings

FIG. 1 is an agarose gel electrophoresis diagram showing the results of comparing the activities of wild-type (WT) Taq DNA polymerase and Taq DNA polymerase mutants having mutation sites, respectively, E9K, L15S, D18R, H20E, H21E, K31E, R37D, F66A, K82E, A83F, R85D, P87G, P89G, E90K, F92A, I99S, E101K, L102S, L108S, A109F, R110D, G115P, S124I, I138S, V155S, L156S;

FIG. 2 is an agarose gel electrophoresis graph showing the results of comparing the activities of wild-type (WT) Taq DNA polymerase and Taq DNA polymerase mutants respectively having mutation sites of H157E, T164I, L168S, R183D, G187D, E189D, K202D, E230D, L233D, H235D, M236D, D237D, D244D, K247D, L281D, P291D, L294D, V310D, K314D, R349D, L379D, S383D, Y36394, G D, A D;

FIG. 3 is an agarose gel electrophoresis image showing the results of comparing the activities of wild-type (WT) Taq DNA polymerase and Taq DNA polymerase mutants having mutation sites, respectively, E507G, E507I, E507L, E537W, T544I, P550G, D578F, D578R, D732R, E742R, E39R/E189R ("/" in the present invention represents a combination of the respective mutation sites, e.g., E39R/E R, E R/E R, a combination of E39R and E189, E R/E R, E39/E R, E537/E R, E R/E R, E3639/E R, E R/E R, E3639/E R, E R/E R, D R, E R/E R, E R/E R, D R, E R/E R, D R, E R/E R, E R/E R, E R/E R, D R, E R, and D R/E3646;

FIG. 4 is an agarose gel electrophoresis chart showing the results of comparing the activities of wild-type (WT) Taq DNA polymerase and a mutant Taq DNA polymerase having mutation sites, G46/N384, G46/D578, E189/E230, E189/E520, E189/E537, E189/D578, E189/D732, E189/E742, E230/E520, E230/E537, E230/D578, E230/D732, E230/D742, E520/E537, E520/D578, E520/D732, E520/E742, E537/D578, E537/E742, D578/D732, D578/D742, D732/E742, E39/E230/E742, G46/E189/E230, G46/E/D189, G46/E/D578, G46/E/F189, G46/E732, G46/E230/E732, G46/D732, G46/E230/D732, and G230/D732, G46D/N384R/F667Y, G46D/D578R/F667Y, E189K/E230K/E520K, E189K/E230K/E537K, E189K/E230K/D578K, E189K/E230K/D732K, E189K/E230K/E742K, E189/E520K/E537K, E189K/E520/D K/D578K, E189K/E520/D K/E537K, E189K/E537/D36732, E K/E537/D K/E537/E36578/E K, E K/E537/E K/E36578 and E189/E K/E36578;

FIG. 5 is an agarose gel electrophoresis chart showing the results of comparing the activities of wild-type (WT) Taq DNA polymerase and a mutant Taq DNA polymerase having mutation sites E189/D578/E742, E189/D732/E742, E230/E520/E537, E230/E520/D578, E230/E520/D732, E230/E520/E742, E230/E537/D578, E230/E537/D732, E230/D578/D732, E230/D732/E742E 230/D578/E742, E230/D732/E742, E520/E537/D578, E520/E537/D732, E520/D578/D732, E520/D732/E742, E537/D578/D732, D742/E578, D742/D732/D742/E, G46D/E189K/E230K/F667Y or G46D/E189K/D578R/F667Y.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

The term "biologically active fragment" refers to any fragment, derivative, homologue, or analogue of Taq DNA polymerase or its mutant sequence, which has in vivo or in vitro reverse transcriptase activity characteristic of a biomolecule. In some embodiments, the biologically active fragment, derivative, homolog or analog of the Taq DNA polymerase mutant has any degree of biological activity of the Taq DNA polymerase mutant in any in vivo or in vitro assay.

In some embodiments, the biologically active fragment can optionally include any number of contiguous amino acid residues of a Taq DNA polymerase mutant sequence. The invention also includes polynucleotides encoding any such biologically active fragments and/or degenerate nucleic acid sequences.

Biologically active fragments may result from post-transcriptional processing or from translation of alternatively spliced RNA, or may be produced by engineering, batch synthesis, or other suitable procedures. Biologically active fragments include fragments expressed in natural or endogenous cells, as well as fragments produced in expression systems such as bacterial, yeast, plant, insect or mammalian cells.

The phrase "conservative amino acid substitution" or "conservative mutation" refers to the replacement of one amino acid by another amino acid having a common propertyAnd (4) substitution. One functional approach to defining the common properties between individual amino acids is to analyze the normalized frequency of amino acid changes between corresponding proteins of homologous organisms (Schulz (1979) Principles of Protein Structure, Springer-Verlag). From such an analysis, groups of amino acids can be defined, wherein the amino acids within a group are preferentially exchanged for each other and are therefore most similar to each other in their effect on the overall protein structure (Schulz (1979) supra). Examples of the amino acid group defined in this way may include: "charged/polar group" including Glu, Asp, Asn, Gln, Lys, Arg, and His; "aromatic or cyclic group" including Pro, Phe, Tyr, and Trp; and "aliphatic group" including Gly, Ala, Val, Leu, Ile, Met, Ser, Thr, and Cys. Within each group, subgroups may also be identified. For example, the charged/polar amino acid group can be subdivided into subgroups, including: "positively charged subgroups" including Lys, Arg and His; "negatively charged subgroup," including Glu and Asp; and "polar subgroups," including Asn and gin. In another example, aromatic or cyclic groups may be subdivided into subgroups, including: "nitrogen ring subgroup" including Pro, His, and Trp; and the "phenyl subgroup," including Phe and Tyr. In another further example, the aliphatic groups may be subdivided into subgroups, including: "large aliphatic nonpolar subgroup" including Val, Leu, and Ile; the "aliphatic micropolar subgroups" include Met, Ser, Thr and Cys; and "small residue subgroup" includes Gly and Ala. Examples of conservative mutations include amino acid substitutions of amino acids within the above subgroups, such as, but not limited to: lys for Arg and vice versa, so that a positive charge can be maintained; glu for Asp and vice versa, so that a negative charge can be maintained; ser for Thr and vice versa, so that a free- -OH group can be maintained; and Gln for Asn and vice versa, so that free- -NH can be retained ₂ . A "conservative variant" is a polypeptide comprising one or more amino acids that have been substituted to replace one or more amino acids of a reference polypeptide (e.g., a polypeptide whose sequence is disclosed in a publication or sequence database, or a polypeptide whose sequence has been determined by nucleic acid sequencing) with an amino acid having a common property, e.g.,belonging to the same group or subgroup of amino acids as described above.

When referring to a gene, "mutant" means that the gene has at least one base (nucleotide) alteration, deletion, or insertion relative to the native or wild-type gene. The mutation (alteration, deletion and/or insertion of one or more nucleotides) may be in the coding region of the gene or may be in an intron, 3 'UTR, 5' UTR or promoter region. As a non-limiting example, a mutant gene may be a gene that increases or decreases gene expression inserted in the promoter region; may be a gene with deletions resulting in the production of a non-functional protein, a truncated protein, a dominant negative protein, or no protein; alternatively, it may be a gene having one or more point mutations that result in changes in the amino acids encoding the protein or in aberrant splicing of the gene transcript.

When the terms "Taq DNA polymerase mutant of the invention" and "Taq DNA polymerase mutant" are used in this detailed description section, the Taq DNA polymerase mutant polypeptides that are tested and exhibit enhanced reverse transcriptase activity are referred to collectively or individually, depending on the context. The terms "Taq DNA polymerase mutants of the invention" and "Taq DNA polymerase mutants" also include variant sequences and/or degenerate nucleic acid sequences.

"naturally occurring" or "wild type" refers to the form found in nature. For example, a naturally occurring or wild-type polypeptide or polynucleotide sequence is a sequence that is present in an organism and that has not been intentionally modified by man.

In some embodiments, the present invention relates to methods (and related kits, systems, devices, and compositions) for performing a ligation reaction comprising or consisting of: contacting a Taq DNA polymerase mutant or a biologically active fragment thereof with a nucleic acid template in the presence of one or more nucleotides and ligating at least one of the one or more nucleotides using the Taq DNA polymerase mutant or biologically active fragment thereof.

In some embodiments, the method of performing a ligation reaction may comprise ligating a double stranded RNA or DNA polynucleotide strand into a circular molecule. In some embodiments, the method may further comprise detecting a signal indicative of the connection using a sensor. In some embodiments, the sensor is an ISFET. In some embodiments, the sensor may comprise a detectable label or detectable reagent in the ligation reaction.

The Taq DNA polymerase mutants described herein may be expressed in any suitable host system, including bacterial, yeast, fungal, baculovirus, plant or mammalian host cells.

For bacterial host cells, promoters useful for transcription of Taq DNA polymerase mutants include promoters obtained from: coli lac operon, Streptomyces coelicolor agarase gene (dagA), Bacillus subtilis levan deer amylase gene (sacB), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, and prokaryotic beta-lactamase gene (Villa-Kamaroff et al, 1978, Proc. Natl Acad.Sci.USA 75: 3727-.

For filamentous fungal host cells, promoters useful for transcription by Taq DNA polymerase mutants include promoters obtained from genes from: aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, and Fusarium oxysporum trypsin-like protease (WO 96/00787), and the NA2-tpi promoter (a hybrid of promoters from the genes for Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase), as well as mutant, truncated, and hybrid promoters thereof.

In a yeast host, promoters useful for transcription of Taq DNA polymerase mutants can be derived from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for Yeast host cells are described in Romanos et al, 1992, Yeast 8: 423-488.

For baculovirus expression, promoters useful for transcription of Taq DNA polymerase mutants can be derived from insect cell lines of the order lepidoptera (moths and butterfly), such as spodoptera frugiperda, and used as hosts. Gene expression is under the control of a strong promoter, such as pPolh.

The plant expression vector is based on Ti plasmid of Agrobacterium tumefaciens, or based on Tobacco Mosaic Virus (TMV), potato virus X or cowpea mosaic virus. A commonly used constitutive promoter in plant expression vectors is the cauliflower mosaic virus (CaMV)35S promoter.

For mammalian expression, cultured mammalian cell lines such as Chinese Hamster Ovary (CHO), COS (including human cell lines such as HEK and HeLa) can be used to produce Taq DNA polymerase mutants. Mammalian expression vectors include adenovirus vectors, pSV and pCMV series plasmid vectors, vaccinia and retrovirus vectors, and baculoviruses. Cytomegalovirus (CMV) and SV40 promoters are commonly used in mammalian expression vectors to drive gene expression. Non-viral promoters, such as the Elongation Factor (EF) -1 promoter, are also known.

The control sequence for expression may be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used.

For example, exemplary transcription terminators for filamentous fungal host cells can be obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin-like protease.

Exemplary terminators for yeast host cells can be obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase.

The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' end of the nucleic acid sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used. Exemplary leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase. The leader sequences suitable for use in a yeast host cell are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH 2/GAP).

The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleic acid sequence and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention. Exemplary polyadenylation sequences for filamentous fungal host cells can be from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin-like protease, and Aspergillus niger alpha-glucosidase.

The control sequence may also be a signal peptide coding region, which codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region.

Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide. However, any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of choice may be used.

The effective signal peptide coding region of the bacterial host cell is the signal peptide coding region obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus stearothermophilus alpha-amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase, Bacillus stearothermophilus neutral proteases (nprT, nprS, nprM), and Bacillus subtilis prsA. Simonen and Palva, 1993, Microbiol Rev 57: 109-.

The effective signal peptide coding region of the filamentous fungal host cell may be a signal peptide coding region obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase.

Useful signal peptides for yeast host cells can be derived from the genes for Saccharomyces cerevisiae alpha factor and Saccharomyces cerevisiae invertase. Signal peptides from other host cell systems are also well known.

The control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resulting polypeptide is called a proenzyme or propolypeptide (or zymogen in some cases). A propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and myceliophthora thermophila lactase (WO 95/33836).

When both the signal peptide and the propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.

It may also be desirable to add regulatory sequences that allow the expression of the Taq DNA polymerase mutant to be regulated relative to the growth of the host cell. Examples of regulatory systems are those that cause gene expression to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In prokaryotic host cells, suitable regulatory sequences include the lac, tac, and trp control systems. In yeast host cells, suitable regulatory systems include, for example, the ADH2 system or GAL1 system. In filamentous fungi, suitable regulatory sequences include the TAKA alpha-amylase promoter, Aspergillus niger glucoamylase promoter, and Aspergillus oryzae glucoamylase promoter. Other host cell regulatory systems are also well known.

Other examples of regulatory sequences are sequences that allow gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene amplified in the presence of methotrexate and the metallothionein genes amplified with heavy metals. In these cases, the nucleic acid sequence encoding the polypeptide of the present invention will be operably linked to a control sequence.

One specific embodiment includes a recombinant expression vector comprising a polynucleotide encoding an engineered Taq DNA polymerase mutant, and one or more expression regulatory regions, such as a promoter and a terminator, and an origin of replication, depending on the type of host into which they are to be introduced. The various nucleic acid and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleic acid sequence encoding the Taq DNA polymerase mutant at these sites. Alternatively, the nucleic acid sequence of the Taq DNA polymerase mutant may be expressed by inserting the nucleic acid sequence or a nucleic acid construct comprising the sequence into a suitable expression vector. In constructing an expression vector, the coding sequence is located in the vector such that the coding sequence is operably linked with the appropriate control sequences for expression.

The recombinant expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the Taq DNA polymerase mutant polynucleotide sequence. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.

The expression vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may comprise any means for ensuring self-replication. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. In addition, a single vector or plasmid, or two or more vectors or plasmids, which together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.

The expression vectors of the invention preferably comprise one or more selectable markers which allow easy selection of transformed cells. A selectable marker is a gene the product of which provides biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like. Examples of bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers that confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol (example 1), or tetracycline resistance. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and URA 3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5' -phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Embodiments for use in an Aspergillus cell include the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus. Selectable markers for insect, plant and mammalian cells are also well known.

The expression vectors of the invention preferably contain elements that allow the vector to integrate into the host cell genome or that allow the vector to replicate autonomously in the cell, independent of the genome. For integration into the host cell genome, the vector may rely on the nucleic acid sequence encoding the polypeptide or any other element of the vector for integration of the vector into the genome by homologous or nonhomologous recombination.

Alternatively, the expression vector may comprise additional nucleic acid sequences for directing integration by homologous recombination into the genome of the host cell. The additional nucleic acid sequences enable the vector to be integrated into the host cell genome at a precise location in the chromosome. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleic acid sequences. Alternatively, the vector may be integrated into the genome of the host cell by non-homologous recombination.

For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. Examples of bacterial origins of replication are the P15Aori, or the origin of replication of plasmids pBR322, pUC19, pACYC177 (which plasmid has the P15Aori) or pACYC184, which are allowed to replicate in E.coli, and the origin of replication of pUB110, pE194, pTA1060 or pAM31, which are allowed to replicate in Bacillus. Examples of origins of replication used in yeast host cells are the 2 micron origins of replication ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN 6. The origin of replication may be a mutation that makes it temperature sensitive in the host cell (see, e.g., Ehrlich,1978, Proc NatlAcad Sci. USA75: 1433).

More than one copy of the nucleic acid sequence of the Taq DNA polymerase mutant may be inserted into the host cell to increase production of the gene product. An increase in the copy number of a nucleic acid sequence can be obtained by integrating at least one additional copy of the sequence into the genome of the host cell or by including an amplifiable selectable marker gene in the nucleic acid sequence, wherein additional copies of the nucleic acid sequence can be selected for by culturing the cells in the presence of the appropriate selectable agent to select for cells containing amplified copies of the selectable marker gene.

Expression vectors for the Taq DNA polymerase mutant polynucleotides are commercially available. Suitable commercial expression vectors include the p3xFLAGTM expression vector from Sigma-Aldrich Chemicals, St.Louis Mo., which includes a CMV promoter and a hGH polyadenylation site for expression in mammalian host cells, and a pBR322 origin of replication and an ampicillin resistance marker for amplification in E.coli. Other suitable expression vectors are pBluescriptII SK (-) and pBK-CMV, which are commercially available from Stratagene, LaJolla CA, and plasmids from pBR322(Gibco BRL), pUC (Gibco BRL), pREP4, pCEP4(Invitrogen) or pPoly (Lathe et al, 1987, Gene 57: 193-.

Suitable host cells for expressing polynucleotides encoding Taq DNA polymerase mutants are well known in the art and include, but are not limited to, bacterial cells such as E.coli, Lactobacillus kefir, Lactobacillus brevis, Lactobacillus parvus, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells (e.g., saccharomyces cerevisiae or pichia pastoris (ATCC application No. 201178)); insect cells, such as Drosophila S2 and Spodoptera exigua Sf9 cells; animal cells such as CHO, COS, BHK, 293, and Bowes melanoma cells; and plant cells.

The polynucleotide for expressing the Taq DNA polymerase mutant can be introduced into cells by various methods known in the art. Techniques include electroporation, biolistic particle bombardment, liposome-mediated transfection, calcium chloride transfection, and protoplast fusion, among others.

The polynucleotide encoding the Taq DNA polymerase mutant can be prepared by standard solid phase methods according to known synthetic methods. In some embodiments, fragments of up to about 100 bases can be synthesized separately and then ligated (e.g., by enzymatic or chemical litigation methods, or polymerase mediated methods) to form any desired contiguous sequence. For example, polynucleotides may be prepared by chemical synthesis using, for example, the classical phosphoramidite method described by Beaucage et al, 1981, Tet Lett 22:1859-69, or the method described by Matthes et al, 1984, EMBO J.3:801-05, which is typically practiced in automated synthetic methods, for example. According to the phosphoramidite method, oligonucleotides are synthesized, for example, purified, annealed, ligated and cloned into suitable vectors in an automated DNA synthesizer. In addition, essentially any nucleic acid can be obtained from a variety of commercial sources, for example, Midland Certified Reagent Company, Midland, tex; great American Gene Company, Ramona, calif; ExpressGen inc. chicago, il.; and Operon Technologies inc, Alameda, Calif.

Engineered Taq DNA polymerase mutants expressed in host cells can be recovered from the cells and/or culture medium using any one or more of the well-known protein purification techniques, including lysozyme treatment, sonication, filtration, salting out, ultracentrifugation, and chromatography. Suitable solutions for lysis and efficient extraction of proteins from bacteria (e.g., E.coli) are commercially available from Sigma-Aldrich, St.Louis Mo under the trade name CelLytic B.TM.

The chromatographic techniques for separating the Taq DNA polymerase mutant comprise reversed phase chromatography, high performance liquid chromatography, ion exchange chromatography, gel electrophoresis, affinity chromatography and the like. Purification conditions will depend in part on factors such as net charge, hydrophobicity, hydrophilicity, molecular weight, molecular shape, and the like, and will be apparent to those skilled in the art.

In some embodiments, affinity techniques can be used to isolate the Taq DNA polymerase mutants. For affinity chromatography purification, any antibody that specifically binds to the Taq DNA polymerase mutant can be used. To produce antibodies, various host animals, including but not limited to rabbits, mice, rats, etc., can be immunized by injection with the compound. The compound may be attached to a suitable carrier, such as bovine serum albumin, via a side chain functional group or a linker attached to a side chain functional group. Depending on the host species, various adjuvants may be used to increase the immune response, including but not limited to Freund's adjuvant (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.

Example 1

This example prepares Taq DNA polymerase mutants.

Taq DNA polymerase mutants exhibit higher reverse transcriptase activity compared to wild-type Taq DNA polymerase, are engineered, characterized and screened by polymerase chain reaction, visualized by agarose gel electrophoresis, and after initial screening using probe-based real-time fluorescent quantitative pcr (qpcr), designated ribonucleic acid (RNA) target sequences are detected using a typical reverse transcription cycling protocol.

The Taq DNA polymerase mutant was generated by mutagenesis of SEQ NO ID.1 by conventional inverse PCR. All mutants are subjected to sequencing verification, expressed and purified in escherichia coli, and C-terminal tags are added to all Taq DNA polymerase mutants and wild Taq DNA polymerase (the amino acid sequence is SEQ ID NO.1, and the nucleic acid sequence is SEQ ID NO.2) so as to facilitate purification.

The DNA sequence (wild type) of Taq DNA polymerase with Histag at the C terminal is shown in SEQ ID NO. 2.

SEQ ID NO.2：

atgcgcggtatgctgccgttatttgaaccgaaaggtcgtgtgctgctggttgatggtcatcacttagcatatcgtacctttcatgccctgaaaggcctgaccacctctcgcggcgaaccggttcaggcagtgtatggttttgccaaatcactgctgaaagcattaaaagaagatggcgatgcagtgattgttgtgtttgatgccaaagccccgagctttcgtcatgaagcctatggcggctacaaagcaggtcgcgccccgaccccggaagattttccgcgtcagctggccttaattaaagaattagttgacttgctgggcttagcacgtctggaagttccgggctatgaagcagatgatgttttagcctcactggccaaaaaagccgaaaaagaaggctatgaagttcgcattctgaccgcagataaggatctgtatcagctgctgagcgatcgtattcatgtgttacatccggaaggctatctgattaccccggcatggttatgggaaaaatatggtttacgtccggatcagtgggcagattatcgtgcactgaccggtgacgaatcagataatctgccgggcgttaaaggtattggtgaaaaaaccgcccggaaattattagaagaatggggtagtctggaagcattactgaaaaatctggatcgcctgaaaccggcaattcgcgaaaaaattttagcccacatggatgacttaaaactgtcttgggatctggccaaagtgcgtaccgatctgccgttagaagttgattttgccaaacgtcgcgaaccggatcgtgaacgcctacgagcctttctggaacgcttagaatttggctcactgttacatgaatttggcttactggaatctccgaaagcattagaagaagccccgtggccgccgccggaaggcgcctttgtgggctttgtgctgagtaggaaagaaccgatgtgggcagacttgctggccctggccgcagcacgcggcggtcgcgttcatcgtgccccggaaccgtacaaagccctgcgtgacctgaaagaagcacgcggcttattagccaaagacctgagtgttctggcattaagggaaggcttaggcctgccgccgggcgatgatccgatgctgctggcctatctgcttgacccgagtaataccaccccggaaggcgttgcacgtcgctatggcggcgagtggaccgaagaagcaggcgaacgtgcagccctgtcagaacgtctgtttgccaatctgtggggtcgcttagaaggcgaagaacgcttactgtggttatatcgtgaagtggaacgtccgctgagcgcagtgctggcacacatggaagccaccggtgtgcgcttagatgttgcatatctgcgtgccctgtctctggaagttgcagaagaaattgcacgcttagaagccgaagtttttcgcttagcaggtcatccgtttaacttaaatagtcgcgatcagctggaaagggttctgtttgatgaattaggcctgccggcaattggcaagaccgaaaaaaccggtaaacgctctacctcagccgcagttctggaagccctgcgcgaagcccatccgattgttgaaaaaattttacagtatcgtgaactgaccaaactgaaatctacctatattgatccgttaccggatctaattcatccgcgtaccggtcgcttacatacccgttttaatcagaccgccaccgccaccggtcgcttatcaagtagcgatccgaacttgcagaatattccggtgcgtaccccgttaggtcagcgcattcgtcgtgcctttattgcagaagaaggttggttattagttgcattagattatagtcagattgaactgcgtgtgttagcccatctgagcggcgacgaaaatctgattcgtgtgtttcaggaaggtcgcgatattcataccgaaaccgcctcttggatgtttggtgttccgcgcgaagcagttgatccgttaatgcgccgtgcagccaaaaccattaattttggtgtgctgtatggtatgagcgcacatcgcctgtcacaggaactggcaattccgtatgaagaagcacaggcctttattgaacgctattttcagtcttttccgaaagttcgcgcatggattgaaaaaaccttagaagaaggtcgtcgtcgcggctatgtggaaaccctgtttggtcgtcgtcgctatgttccggatctggaagcgagagttaaatcagtgcgtgaagccgccgaacgcatggcctttaatatgccggttcagggaacggcagctgaccttatgaaactggcaatggttaaactgtttccgcgcctggaagaaatgggtgcacgaatgctgttacaggttcatgatgaattagttctggaagccccgaaagaacgcgccgaagcagttgcacgtctggccaaagaagtgatggaaggtgtgtatccgttagcagttccgttagaagtggaagtgggtattggtgaagattggctgagcgccaaagaaggttctggcagttcaggtcatcaccaccatcatcactaa。

qPCR was performed under the following conditions, wherein the target gene was the 28s gene.

A forward primer: 5'-CCGCTGCGGTGAGCCTTGAA-3'

Reverse primer: 5'-TCTCCGGGATCGGTCGCGTT-3'

Target gene: 28s RNA, derived from total RNA-human tumor cell lines: hela (Biochain Cat # R1255811-50).

Each 10. mu.L reaction system contained 1.5. mu.L of 50 ng/. mu.L Taq DNA polymerase, 0.4. mu.L 10. mu.M forward primer, 0.4. mu.L 10. mu.M reverse primer, 1. mu.L of 10 ng/. mu.L target RNA, 0.4. mu.L 10mM equimolar dNTPs, 0.1. mu.L 1M DTT and 1. mu.L 10 Xreaction buffer (final composition 20mM Tris-HCl, 80mM Tris-acetate, 10mM ammonium sulfate, 10mM potassium chloride, 2mM magnesium sulfate, 3mM magnesium acetate, 0.1% Triton X-100, pH 8.8(25 ℃)), made up to 10. mu.L with water.

The thermal cycler used for the qPCR assay was Bio-Rad T100, the reaction program was as follows: incubation at 60 ℃ for 20 min, denaturation at 95 ℃ for 5 min, followed by 35 cycles (denaturation at 95 ℃ for 10 sec, extension at 60 ℃ for 30 sec) followed by incubation at 75 ℃ for 5 min. To each sample was added 3. mu.L of 6 × stop dye containing 6 × GelRed nucleic acid dye (Biotium Cat # 41003). Each 10. mu.L sample was loaded on a 2% agarose gel and compared to Wild Type (WT) Taq polymerase and a low molecular weight DNA length marker (New England Biolabs, Cat # N3233).

As shown in FIGS. 1-5, compared with wild Taq polymerase, the amplified products amplified by each Taq DNA polymerase mutant of the present invention have obvious target product bands, which indicates that the Taq DNA polymerase mutant of the present invention can efficiently convert cDNA using RNA as a substrate and amplify the cDNA under standard reaction conditions, i.e., has high reverse transcriptase activity and polymerase activity.

Example 2

This example provides the use of Taq DNA polymerase mutants in real-time fluorescent quantitative pcr (qpcr).

The Taq DNA polymerase mutant obtained by the invention can be used for quantifying RNA in a sample by using a conventional qPCR scheme and detecting the RNA without adding additional reverse transcriptase in a reaction mixture.

In conclusion, the Taq DNA polymerase mutant obtained by point mutagenesis has high-efficiency and stable reverse transcriptase activity, is different from wild Taq DNA polymerase, can convert cDNA with an RNA substrate as high-efficiency, amplifies the cDNA under standard reaction conditions, does not need to additionally add reverse transcriptase, can obviously improve the efficiency of detecting target ribonucleic acid (RNA) by real-time fluorescent quantitative PCR, and can simplify a scheme and facilitate scheme optimization.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> Wuhan Ebola Biotech Co., Ltd

<120> Taq DNA polymerase mutant and application thereof

<130> 2022-06-29

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 844

<212> PRT

<213> Artificial sequence

<400> 1

Met Arg Gly Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu Leu

1 5 10 15

Val Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys Gly

20 25 30

Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe Ala

35 40 45

Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile Val

50 55 60

Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Gly Gly

65 70 75 80

Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg Gln Leu

85 90 95

Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala Arg Leu Glu

100 105 110

Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala Ser Leu Ala Lys Lys

115 120 125

Ala Glu Lys Glu Gly Tyr Glu Val Arg Ile Leu Thr Ala Asp Lys Asp

130 135 140

Leu Tyr Gln Leu Leu Ser Asp Arg Ile His Val Leu His Pro Glu Gly

145 150 155 160

Tyr Leu Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg Pro

165 170 175

Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp Asn

180 185 190

Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys Leu Leu

195 200 205

Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu Asp Arg Leu

210 215 220

Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met Asp Asp Leu Lys

225 230 235 240

Leu Ser Trp Asp Leu Ala Lys Val Arg Thr Asp Leu Pro Leu Glu Val

245 250 255

Asp Phe Ala Lys Arg Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala Phe

260 265 270

Leu Glu Arg Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu Leu

275 280 285

Glu Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Pro Glu Gly

290 295 300

Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp Ala Asp

305 310 315 320

Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg Val His Arg Ala Pro

325 330 335

Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala Arg Gly Leu Leu

340 345 350

Ala Lys Asp Leu Ser Val Leu Ala Leu Arg Glu Gly Leu Gly Leu Pro

355 360 365

Pro Gly Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser Asn

370 375 380

Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr Glu

385 390 395 400

Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn Leu

405 410 415

Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr Arg Glu

420 425 430

Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala Thr Gly

435 440 445

Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser Leu Glu Val Ala

450 455 460

Glu Glu Ile Ala Arg Leu Glu Ala Glu Val Phe Arg Leu Ala Gly His

465 470 475 480

Pro Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe Asp

485 490 495

Glu Leu Gly Leu Pro Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys Arg

500 505 510

Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro Ile

515 520 525

Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys Leu Lys Ser Thr

530 535 540

Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly Arg Leu

545 550 555 560

His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser

565 570 575

Ser Asp Pro Asn Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln

580 585 590

Arg Ile Arg Arg Ala Phe Ile Ala Glu Glu Gly Trp Leu Leu Val Ala

595 600 605

Leu Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser Gly

610 615 620

Asp Glu Asn Leu Ile Arg Val Phe Gln Glu Gly Arg Asp Ile His Thr

625 630 635 640

Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp Pro

645 650 655

Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly

660 665 670

Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile Pro Tyr Glu Glu

675 680 685

Ala Gln Ala Phe Ile Glu Arg Tyr Phe Gln Ser Phe Pro Lys Val Arg

690 695 700

Ala Trp Ile Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr Val

705 710 715 720

Glu Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala Arg

725 730 735

Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met Pro

740 745 750

Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val Lys Leu

755 760 765

Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln Val His

770 775 780

Asp Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala Glu Ala Val Ala

785 790 795 800

Arg Leu Ala Lys Glu Val Met Glu Gly Val Tyr Pro Leu Ala Val Pro

805 810 815

Leu Glu Val Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys Glu

820 825 830

Gly Ser Gly Ser Ser Gly His His His His His His

835 840

<210> 2

<211> 2535

<212> DNA

<213> Artificial sequence

<400> 2

atgcgcggta tgctgccgtt atttgaaccg aaaggtcgtg tgctgctggt tgatggtcat 60

cacttagcat atcgtacctt tcatgccctg aaaggcctga ccacctctcg cggcgaaccg 120

gttcaggcag tgtatggttt tgccaaatca ctgctgaaag cattaaaaga agatggcgat 180

gcagtgattg ttgtgtttga tgccaaagcc ccgagctttc gtcatgaagc ctatggcggc 240

tacaaagcag gtcgcgcccc gaccccggaa gattttccgc gtcagctggc cttaattaaa 300

gaattagttg acttgctggg cttagcacgt ctggaagttc cgggctatga agcagatgat 360

gttttagcct cactggccaa aaaagccgaa aaagaaggct atgaagttcg cattctgacc 420

gcagataagg atctgtatca gctgctgagc gatcgtattc atgtgttaca tccggaaggc 480

tatctgatta ccccggcatg gttatgggaa aaatatggtt tacgtccgga tcagtgggca 540

gattatcgtg cactgaccgg tgacgaatca gataatctgc cgggcgttaa aggtattggt 600

gaaaaaaccg cccggaaatt attagaagaa tggggtagtc tggaagcatt actgaaaaat 660

ctggatcgcc tgaaaccggc aattcgcgaa aaaattttag cccacatgga tgacttaaaa 720

ctgtcttggg atctggccaa agtgcgtacc gatctgccgt tagaagttga ttttgccaaa 780

cgtcgcgaac cggatcgtga acgcctacga gcctttctgg aacgcttaga atttggctca 840

ctgttacatg aatttggctt actggaatct ccgaaagcat tagaagaagc cccgtggccg 900

ccgccggaag gcgcctttgt gggctttgtg ctgagtagga aagaaccgat gtgggcagac 960

ttgctggccc tggccgcagc acgcggcggt cgcgttcatc gtgccccgga accgtacaaa 1020

gccctgcgtg acctgaaaga agcacgcggc ttattagcca aagacctgag tgttctggca 1080

ttaagggaag gcttaggcct gccgccgggc gatgatccga tgctgctggc ctatctgctt 1140

gacccgagta ataccacccc ggaaggcgtt gcacgtcgct atggcggcga gtggaccgaa 1200

gaagcaggcg aacgtgcagc cctgtcagaa cgtctgtttg ccaatctgtg gggtcgctta 1260

gaaggcgaag aacgcttact gtggttatat cgtgaagtgg aacgtccgct gagcgcagtg 1320

ctggcacaca tggaagccac cggtgtgcgc ttagatgttg catatctgcg tgccctgtct 1380

ctggaagttg cagaagaaat tgcacgctta gaagccgaag tttttcgctt agcaggtcat 1440

ccgtttaact taaatagtcg cgatcagctg gaaagggttc tgtttgatga attaggcctg 1500

ccggcaattg gcaagaccga aaaaaccggt aaacgctcta cctcagccgc agttctggaa 1560

gccctgcgcg aagcccatcc gattgttgaa aaaattttac agtatcgtga actgaccaaa 1620

ctgaaatcta cctatattga tccgttaccg gatctaattc atccgcgtac cggtcgctta 1680

catacccgtt ttaatcagac cgccaccgcc accggtcgct tatcaagtag cgatccgaac 1740

ttgcagaata ttccggtgcg taccccgtta ggtcagcgca ttcgtcgtgc ctttattgca 1800

gaagaaggtt ggttattagt tgcattagat tatagtcaga ttgaactgcg tgtgttagcc 1860

catctgagcg gcgacgaaaa tctgattcgt gtgtttcagg aaggtcgcga tattcatacc 1920

gaaaccgcct cttggatgtt tggtgttccg cgcgaagcag ttgatccgtt aatgcgccgt 1980

gcagccaaaa ccattaattt tggtgtgctg tatggtatga gcgcacatcg cctgtcacag 2040

gaactggcaa ttccgtatga agaagcacag gcctttattg aacgctattt tcagtctttt 2100

ccgaaagttc gcgcatggat tgaaaaaacc ttagaagaag gtcgtcgtcg cggctatgtg 2160

gaaaccctgt ttggtcgtcg tcgctatgtt ccggatctgg aagcgagagt taaatcagtg 2220

cgtgaagccg ccgaacgcat ggcctttaat atgccggttc agggaacggc agctgacctt 2280

atgaaactgg caatggttaa actgtttccg cgcctggaag aaatgggtgc acgaatgctg 2340

ttacaggttc atgatgaatt agttctggaa gccccgaaag aacgcgccga agcagttgca 2400

cgtctggcca aagaagtgat ggaaggtgtg tatccgttag cagttccgtt agaagtggaa 2460

gtgggtattg gtgaagattg gctgagcgcc aaagaaggtt ctggcagttc aggtcatcac 2520

caccatcatc actaa 2535

Claims

1. A Taq DNA polymerase mutant, which is characterized in that the Taq DNA polymerase mutant generates the following mutations on the basis of an amino acid sequence SEQ ID NO. 1:

the combination of the combinations of E39, E742, E39, E578, D732, E742, E39, E46, E189, and E.236, D237, D244, K247, L281, P291, L294, V310, K314, R349, L379, S383, Y394, G395, A442, E507, E537, E507, T507, P550, D578, D732, D742, D732, D742, E39, E46, E39, E189, E39, E742, E39, E46, E39, E189, E39, E742, E39, E742, E39, E46, E742, E39, E39, E189, E46, and E189, and E46, and E189, The combination of E189K and D578R, the combination of E189K and D732R, the combination of E189K and E742K, the combination of E230K and E520K, the combination of E230K and E537K, the combination of E230K and D578R, the combination of E230K and D732R, the combination of E230K and E742K, the combination of E520K and E537K, the combination of E520K and D K, the combination of E520 and D732K, the combination of E520 and E742K, the combination of E K and E537, the combination of E537 and E537K, the combination of E K and E K, the combination of D36732, the combination of D K and E36578, the combination of E537 and K, the combination of E36732 and E K, the combination of E K and K, the combination of E K, the combination of 36537 and K, the combination of E K, the combination of 36537 and K, the combination of E K, the combination of K, the combination of 36537, the combination of E K, the combination of K, the combination of 36537, the combination of E537, the combination of K, the combination of E537, the combination of E K, the combination of E537, the combination of E K, the combination of K, the combination of E537, the combination of K, the combination of E537, the combination of K, the combination of E537, the combination of K, the combination of E537 and K, the combination of K, the combination of the K, the combination of the K, the combination of the K, the combination of the K, the combination of the, The combination of E189 and E520 and D578, the combination of E189 and E520 and D732, the combination of E189/E520/E742, the combination of E189/E537/D578, the combination of E189 and E537 and D732, the combination of E189 and E537 and E742, the combination of E189 and D578 and D732, the combination of E189 and D578 and E742, the combination of E189 and D732 and E742, the combination of E230 and E520 and E537, the combination of E230 and E520 and D732, the combination of E230 and E520 and E742, the combination of E230 and E537 and D578, the combination of E230 and E537 and D732, the combination of E230 and D742, the combination of E230 and D578 and E732, the combination of E742 and E578, the combination of E742 and E732, the combination of E537 and D732, the combination of E732, E537, E732, D732, E732, D537, D732, E732, D732, E742, E732, D732, E732, D537, D732, E732, D732, E732, D732, E732, D732, and D732, E732, D732, and E742, G46D and E189K and D578R and F667Y in combination.

2. A nucleic acid molecule comprising a nucleic acid sequence encoding the Taq DNA polymerase mutant according to claim 1.

3. An expression vector comprising the nucleic acid molecule of claim 2;

preferably, the expression vector comprises a plasmid vector or a viral vector.

4. A recombinant cell comprising the nucleic acid molecule of claim 2 or the expression vector of claim 3.

5. The use of the Taq DNA polymerase mutant of claim 1 for preparing a reagent for reverse transcription reaction.

6. A reverse transcription kit comprising the Taq DNA polymerase mutant of claim 1;

preferably, the kit further comprises a PCR reaction solution.

7. The use of the Taq DNA polymerase mutant according to claim 1 in a reverse transcription reaction.

8. A method of reverse transcription PCR, comprising:

reverse transcription PCR is performed using the Taq DNA polymerase mutant according to claim 1 using RNA as a template.

9. The use of the Taq DNA polymerase mutant according to claim 1 for RNA detection.

10. A method for detecting RNA, comprising:

the Taq DNA polymerase mutant of claim 1 is used to perform real-time fluorescent quantitative PCR using the RNA to be detected as a template, and the fluorescent result is analyzed.