CN116803387A - Application of Vidofludimus in preparation of hepatitis E medicines - Google Patents

Application of Vidofludimus in preparation of hepatitis E medicines Download PDF

Info

Publication number
CN116803387A
CN116803387A CN202310920852.1A CN202310920852A CN116803387A CN 116803387 A CN116803387 A CN 116803387A CN 202310920852 A CN202310920852 A CN 202310920852A CN 116803387 A CN116803387 A CN 116803387A
Authority
CN
China
Prior art keywords
hev
vidofludimus
hepatitis
medicament
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310920852.1A
Other languages
Chinese (zh)
Inventor
王文世
郭虹波
郑葵阳
刘丹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xuzhou Medical University
Original Assignee
Xuzhou Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xuzhou Medical University filed Critical Xuzhou Medical University
Priority to CN202310920852.1A priority Critical patent/CN116803387A/en
Publication of CN116803387A publication Critical patent/CN116803387A/en
Pending legal-status Critical Current

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention relates to the technical field of antiviral drugs, and provides an application of Vidofludimus in preparation of a hepatitis E drug. Experiments prove that the Vidofludimus can inhibit HEV RNA replication and HEVORF2 protein expression, and has antiviral effect on HEV mutant strains related to clinical ribavirin treatment failure. Therefore, vidofludimus can provide a new medicine and treatment idea for treating chronic hepatitis E patients and a new scheme for treating clinical ribavirin-resistant HEV patients.

Description

Application of Vidofludimus in preparation of hepatitis E medicines
Technical Field
The invention relates to the technical field of antiviral drugs, in particular to application of Vidofludimus in preparation of hepatitis E drugs.
Background
Hepatitis E is a viral hepatitis caused by the hepatitis E virus (Hepatitis E Virus, HEV). HEVs are important pathogens that pose a global public health burden. According to world health organization statistics, about 2000 tens of thousands of people worldwide infect HEV each year, about 330 tens of thousands of clinical cases, ultimately leading to 4.4-7 tens of thousands of deaths. HEV is generally susceptible to people, and clinically, the HEV is mostly manifested as hidden infection or acute hepatitis. However, HEV persistent infection is caused by the infection of HEV by immunocompromised or organ transplanted patients, and gradually progresses to chronic hepatitis E, liver cirrhosis, liver cancer, etc. There is increasing evidence that it can also lead to extrahepatic injury such as neurological symptoms. It is reported that infection of pregnant women with HEV may progress to fulminant hepatitis with mortality rates as high as 20% to 30%. For HEV infection, there is currently no accepted therapeutic treatment. Ribavirin and interferon-alpha are the first drugs to treat hepatitis E. Although ribavirin has been successfully used for chronic HEV infection, ribavirin is teratogenic, is prohibited from being used in the treatment of pregnant patients, and HEV mutants resistant to ribavirin have now appeared clinically; and interferon-alpha treatment may lead to graft rejection in organ transplant recipients. At present, no direct antiviral drug for HEV exists, so that the search of a safer and effective novel HEV-resistant drug has great significance for treating chronic hepatitis E.
Vidofludimus is a potent dihydroorotate dehydrogenase (DHODH) inhibitor that inhibits IL-17 secretion without affecting lymphocyte proliferation. Is also a novel modulator of the Farnesol X Receptor (FXR) and has oral activity. Vidofludimus is used as an immunomodulator and can be used for researching autoimmune diseases, and clinical phase III research for treating rheumatoid arthritis is currently being carried out. Vidofludimus can also be used for fatty liver studies by targeting FXR. However, there is no report on the anti-hepatitis E virus effect of Vidofludimus.
Disclosure of Invention
The invention aims to provide an application of Vidofludimus in preparing a hepatitis E drug, provides a new drug and a treatment thought for treating chronic hepatitis E patients, and also provides a new scheme for treating clinical ribavirin-resistant HEV patients.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides an application of Vidofludimus in preparing a hepatitis E drug.
Preferably, the hepatitis E is caused by HEV.
Preferably, the HEV is a hepatitis c virus.
Preferably, the hepatitis C virus comprises hepatitis C virus A, B, C and D.
The invention also provides a medicament for treating hepatitis E, which comprises Vidofludimus.
Preferably, the concentration of Vidofludimus in the medicament is 0.04-20 mu mol/L.
Preferably, the medicine also contains pharmaceutically acceptable auxiliary materials and carriers.
Preferably, the auxiliary materials and the carrier are one or more of diluents, excipients, fillers, binders, wetting agents, disintegrants, absorption promoters, surfactants, adsorption carriers and lubricants.
Preferably, the dosage forms of the medicine comprise injection, tablet, powder, granule, capsule, oral liquid, ointment and cream.
The invention provides an application of Vidofludimus in preparing a hepatitis E drug. Experiments prove that the Vidofludimus can inhibit HEV RNA replication and HEV ORF2 protein expression, and has antiviral effect on HEV mutant strains related to clinical ribavirin treatment failure. Therefore, vidofludimus can provide a new medicine and treatment idea for treating chronic hepatitis E patients and a new scheme for treating clinical ribavirin-resistant HEV patients.
Drawings
FIG. 1 is a graph showing the effect of Vidofludimus in inhibiting HEV-p6Gluc replication;
FIG. 2 is a graph showing the effect of Vidofludimus on cell safety (using CC50 as a detection index);
FIG. 3 is a graph showing the effect of Vidofludimus in inhibiting RNA replication in HEV;
FIG. 4 is a graph showing the effect of Vidofludimus in inhibiting HEV ORF2 protein expression;
FIG. 5 is a graph showing the effect of Vidofludimus in inhibiting HEV RNA replication in human liver organoid model;
FIG. 6 is a graph of the effect of Vidofludimus on inhibiting HEV replication in the liver organoids HEV-p6Gluc replication model of different donors.
Detailed Description
The invention provides an application of Vidofludimus in preparing a hepatitis E drug.
In the present invention, the formula of the Vidofludimus is:
in the present invention, the hepatitis E is caused by HEV.
In the present invention, the HEV is a hepatitis c virus.
In the present invention, the hepatitis C virus includes hepatitis C virus A, B, C and D.
The invention provides a medicament for treating hepatitis E, which comprises Vidofludimus.
In the present invention, the concentration of Vidofludimus in the drug is preferably 0.04 to 20. Mu. Mol/L, more preferably 0.5 to 15. Mu. Mol/L, still more preferably 5 to 10. Mu. Mol/L.
In the invention, the medicine also contains pharmaceutically acceptable auxiliary materials and carriers.
In the invention, the auxiliary materials and the carrier are one or more of diluents, excipients, fillers, adhesives, wetting agents, disintegrants, absorption promoters, surfactants, adsorption carriers and lubricants.
In the invention, the dosage forms of the medicine comprise injection, tablet, powder, granule, capsule, oral liquid, ointment and cream.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
The methods described in the examples below are conventional methods unless otherwise specified. The starting materials are available from published commercial sources unless otherwise specified.
The experimental methods used in the examples below are conventional, unless otherwise specified
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Vidofliudimus, a DMSO solution of Vidofliudimus, was used in the examples below. Vidofludimus manufacturer: selleck, cat No. S7262.
In the following examples, "FBS" is fetal bovine serum.
The BTX cell electroporator used in the examples below is the ECM630 product of BTX corporation in the united states.
The methods for constructing the HEV replicon model and the wild type and mutant full-length HEV replicon models used in the following examples were as follows:
wild type HEV plasmids containing the full-length genome of HEV (Kernow-C1 p6 gt3, genBank: JQ 679013.1) and HEV-p6Gluc replicon plasmids (Wenshi Wang et al, geometry, VOLUME 151,ISSUE 6,P1251-1253;Wenshi Wang et al, science Signaling,2017,25;10 (476); wenshi Wang et al, hepatology.2018,67 (6): 2096-2112), HEV genome plasmid carrying RdRp mutation (Y1320H, G1634R) (construction and preservation in the laboratory), respectively, enzyme-cutting by restriction enzyme Mlu I (adding enzyme-cutting reaction system according to table 1, placing the sample in a water bath kettle at 37 ℃ for enzyme-cutting for 1 h), purifying and recovering linearized plasmid (adding 5 times VOLUME of BufferPB into enzyme-cutting product for mixing, adding the mixed solution into an adsorption column, standing for adsorption for 2min, centrifuging for 1min at 12000R/min, adding 500 μl of BufferPW for washing, centrifuging for 1min at 12000R/min, idling for 1min, adding 30 μl of Buffer into the middle of the adsorption column, standing for 2min, centrifuging for 1min at 12000R/min, recovering plasmid), respectively transcribing viral RNA by using T7 in vitro transcription kit (adding in an in vitro transcription reaction system according to table 2, incubating for 2h in a water bath at 37 ℃, then adding 0.5 μl TURBO DNase, removing residual DNA, incubating at 37 ℃ for 2min, adding 15 μl into water bath for 120R for 20min, centrifuging for 20min at 120R/20 min, precipitating for 20min, and removing 1 μl of 1min, precipitating, washing by centrifugation for 20min at 120R/20 min, and precipitating for 20% of 3R/min, washing by centrifugation for 20min, washing after the supernatant after the adsorption column is added into ethanol, and washingin centrifugation for 10min, ethanol was discarded, 30. Mu.L DEPC was added to resuspend RNA, and RNA was electrotransferred into HEK 293T and Huh7 cells (stored in the present laboratory) by electroporation at 270V, 975. Mu.F, respectively (3X 10 before electrotransfer) 6 Each HEK 293T, huh7 was plated in 60mm dishes with DMEM medium containing 10% FBS at 37deg.C, 5% CO 2 Culturing in an incubator for 24 hours, discarding the culture medium, and washing with 1mLPBS twice. Cells were digested with 1mL of pancreatin for 1min, pancreatin was gently discarded after cell shrinkage rounding, 3mL of serum-containing medium was added, the cells were blown down into 15mL centrifuge tubes, centrifuged at 1000r/min at room temperature for 5min, medium was discarded, the cells were resuspended with 3mL of PBS, washed once again, centrifuged at 1000r/min for 5min, PBS was discarded, the cells were resuspended with 400. Mu.L of Opti-MEM, then transferred to 1.5mL of coreless enzyme EP, 3. Mu.g of RNA was added and mixed and then added to a 4mm electroporation cup (BTX) for electroporation experiments, HEK 293T-HEV-p6Gluc and Huh7-HEV-p6Gluc replicon models, huh7-HEV wild type and mutant replication models were constructed, respectively.
TABLE 1 cleavage reaction System
Component (A) Volume of
MluI 2μL
10×Buffer 5μL
Plasmid template 5μg
ddH 2 O Complement to
Total volume 50μL
TABLE 2 in vitro transcription reaction System
Component (A) Volume of
2×T7 NTP 5μL
Linearization of plasmid templates 500ng
GTP 0.5μL
10×buffer 1μL
Enzyme Mix 1μL
The organoid HEV replication model used in the following examples was constructed as follows:
organoids were collected in cold advanced DMEM/F12 medium. The organoids were then resuspended in Opti-MEM, centrifuged at 500g at 8℃for 5min, 200. Mu.L of the Opti-MEM organoid suspension was thoroughly mixed with 6. Mu.g HEV RNA, added to a 4mm electroporation cuvette and electroporated according to the following procedure: the voltage was 700V and the pulse length was 4ms, washed 3 times with Opti-MEMRemoving residual RNA, embedding organoids in matrigel, and heating at 37deg.C with 5% CO 2 Is cultured in EM.
The WST-1 cell proliferation and cytotoxicity assay kit used in the examples described below was a product of KeyGen, inc. under the product number C0036.
The gaussian luciferase assay kit used in the following examples is manufactured by Beyotime corporation under the product number RG 062M.
First-Strand cDNA Synthesis Kit, SYBR GreenqPCR MasterMix (2X) used in the following examples is the product of APExBIO company having the product numbers K1072 and K1070, respectively.
The secondary antibody of FITC-labeled goat anti-rabbit IgG used in the following examples was a secondary antibody having a product number of 111-585-003, trade name Alexa Flour 594-comjugated Affinipure GoatAnti-Rabbit IgG (H+L), manufactured by Jackson corporation.
Example 1 in vitro experiments with Vidofludimus inhibiting replication of HEV replicons
(1) Culture of HEV replicon model cells
HEK 293T and Huh7 cells containing HEV replicons were cultured in 60mm dishes, respectively, DMEM high-sugar medium (Bio-Channel) +10% FBS (Bio-Channel), and cultured in a 5% carbon dioxide incubator at 37℃until the cells were full (about 3X 10) 6 And a) plating and dosing treatment.
(2) Experimental grouping and processing
Two HEV replicon model cells were seeded into 96-well plates, 2X 10 each 4 Cells were treated with 10% FBS (Bio-Channel) +DMEM high-sugar medium for 24h, and 3 wells per group were grouped as follows:
a. experimental group: vidofludimus treatment (final concentration in medium 0.2, 1, 5, 10, 50. Mu.M) was applied for 72 hours.
b. Blank control group: treatment with 1% dmso was added to group a.
(3) Experimental method
After the 2 groups are respectively processed for 72 hours, the activity of the Gaussian luciferase is detected by a Gaussian luciferase detection kit, and the situation that the replication of the HEV replicon is inhibited by the Vidofludus is analyzed.
(4) Results
The experimental results are shown in FIG. 1. As can be seen from fig. 1, the reduced gaussian luciferase activity in the effective concentration range compared to the blank (1% dmso) after Vidofludimus treatment, demonstrated that Vidofludimus has an inhibitory effect on HEV replicon replication. Mean±sem; **** P<0.0001。
example 2 in vitro experiments of Vidofludimus on cell safety
(1) Culture of Huh7-HEV replicon model cells
Resuscitate Huh7 cells transformed with HEV replicon RNA for culture, firstly taking out the frozen cells from a refrigerator at-80 ℃, quickly thawing the frozen cells in a water bath kettle at 37 ℃, transferring the cells to 3mL of complete culture medium (10% FBS+DMEM) after thawing the cells, centrifuging at 1000r/min for 5min, discarding the culture medium, adding 10% FBS (Bio-Channel) DMEM high sugar culture medium (Bio-Channel), and placing the culture medium at 37 ℃ and 5% CO 2 Culturing in an incubator, and carrying out passage after the cells grow fully. The cells were passaged, the medium in the petri dish was first discarded, washed twice with sterile PBS, digested with 1mL pancreatin (Bio-Channel), discarded after cell retraction and rounding, and passaged with complete medium at a 1:4 ratio.
(2) Experimental grouping and processing
Huh7-HEV replicon cells were used at 2X 10 per well 4 The cells were inoculated into 96-well plates, and after 24h of cell attachment, the cells were treated with drugs in groups of 3 duplicate wells each, as follows:
a. experimental group: vidofludimus treatment (final concentration in medium of 0.2, 1, 5, 10, 50, 200. Mu.M) was applied for 72 hours.
b. Blank control group: treatment with 1% dmso was added to group a.
(3) Experimental method
After the above 2 groups were treated for 72 hours, the proliferation activity of the cells was measured using a WST-1 cell proliferation and cytotoxicity assay kit (KeyGen), and Half-toxicity concentration (Half-maximal Cytotoxicity Concentration, CC 50) was calculated by Graphpadprism 9 to analyze the safety of Vidofludus on Huh7 cells.
(4) Results
The experimental results are shown in FIG. 2. As can be seen from FIG. 2, the CC50 of Vidofludimus against Huh7 cells was 160. Mu.M.
Example 3 in vitro experiments in which Vidofludimus inhibited wild type HEV RNA replication
(1) Culture of Huh7-HEV replication model cells
Resuscitate Huh7 cells which have been electroporated with wild type HEV RNA for culture, firstly, taking out the frozen cells from a refrigerator at-80 ℃, rapidly thawing the frozen cells in a water bath kettle at 37 ℃, transferring the cells to 3mL of complete medium (10% FBS+DMEM) after thawing the cells, centrifuging at 1000r/min for 5min, discarding the medium, adding 10% FBS (Bio-Channel) DMEM high sugar medium (Bio-Channel), and placing the medium at 37 ℃ and 5% CO 2 Culturing in an incubator, and carrying out passage after the cells grow fully. The cells were passaged, the medium in the petri dish was first discarded, washed twice with sterile PBS, digested with 1mL pancreatin (Bio-Channel), discarded after cell retraction and rounding, and passaged with complete medium at a 1:4 ratio.
(2) Experimental grouping and processing
Huh7 cells electroporated with wild type HEV RNA were plated at 5X 10 cells per well 4 The cells were inoculated into 24-well plates, and after 24h of cell attachment, the cells were treated with drugs in groups of 2 duplicate wells each, as follows:
a. experimental group: vidofludimus treatment (final concentration in medium 1, 5. Mu.M) was added for 72 hours.
b. Blank control group: treatment with 1% dmso was added to group a.
(3) Experimental method
After the above 2 groups are respectively processed for 72 hours, huh7 cell total RNA containing wild HEV is extracted by using a TRIzol method, is reversely transcribed into cDNA and is used as a template (an RNA denaturation system is added according to table 3, heating is carried out at 65 ℃ for 5 minutes, a reverse transcription system is added according to table 4, reverse transcription is carried out after gentle mixing is carried out according to 25 ℃ for 2min, 45 ℃ for 50min and 70 ℃ for 15 min), then the transcription levels of HEV RNA and GAPDH genes are respectively detected by a qPCR method (a qPCR reaction system is added according to table 5, a reaction program is shown in table 6), the primer sequences are shown in table 7, and the influence of Vidofludimus on the replication level of HEV RNA is analyzed.
TABLE 3RNA denaturation system
Composition of the components Volume of
Random Primers(50μM) 1μL
10mM dNTP Mixture 1μL
RNA 1μL
RNase-free Water Up to 10μL
TABLE 4 reverse transcription system
Composition of the components Volume of
The denatured reaction solution 10μL
5×First-Strand Buffer 4μL
RNase Inhibitor 1μL
Reverse Transcriptase 1μL
RNase-free Water Up to 20μL
TABLE 5 qPCR reaction System
Composition of the components Volume of
2×SYBR Green qPCR Master Mix 10μL
Forward Primer(10μM) 0.5μL
Reverse Primer(10μM) 0.5μL
cDNA 4μL
RNase-free Water Up to 20μL
TABLE 6 qPCR reaction procedure
TABLE 7 primer sequences
Primer name Primer sequence (5 '-3') Sequence number
HEV-genome-F TTGCCTCCGAGTTAGTCATC SEQ ID NO.1
HEV-genome-R TGCAAAGCATTACCAGACCG SEQ ID NO.2
GAPDH-F GTCTCCTCTGACTTCAACAGCG SEQ ID NO.3
GAPDH-R ACCACCCTGTTGCTGTAGCCAA SEQ ID NO.4
(4) Results
The experimental results are shown in FIG. 3. As can be seen from FIG. 3, vidofludimuAfter s treatment, vidofludimus reduced HEV RNA levels to around 50% at 5 μm compared to the blank control (1% dmso). Mean±sem; **** P<0.0001。
example 4 in vitro experiments in which Vidofludimus inhibited HEV ORF2 protein expression
(1) Culture of wild type Huh7-HEV and ribavirin drug resistance related mutant HEV cell replication model
The constructed wild type HEV replication model cells and mutant HEV replication model cells are respectively cultured in a 60mm culture dish, DMEM high sugar medium (Bio-Channel) +10% FBS (Bio-Channel) at 37 ℃ in a 5% carbon dioxide incubator, and are plated and dosed after the cells grow full.
(2) Experimental grouping and processing
Wild-type and three mutant (Y1320H, G1634R single and double mutations) HEV replication models were run at 3X 10 per well, respectively 4 The cells were inoculated into 48-well plates, and after 24h of cell attachment, the cells were treated with drugs in groups of 2 duplicate wells each, as follows:
a. experimental group: vidofludimus treatment (final concentration in medium 0.04, 0.2, 1, 5, 20. Mu.M) was applied for 72 hours.
b. Blank control group: treatment with 1% dmso was added to group a.
(3) Experimental method
After the above 2 groups were treated for 72 hours, the cell culture supernatant was discarded, and the cells were subjected to cell culture with 4% paraformaldehyde at room temperature for 30min, PBS and 0.3% Triton X-100 for 15min. After 5% skim milk was blocked at room temperature for 1h, rabbit anti-HEV ORF2 protein (dilution ratio 1:3000, preserved in this laboratory, rabbit) was used as primary antibody, incubated overnight at 4℃with FITC-labeled goat anti-Rabbit IgG (1:500, jackson, 111-585-003) as secondary antibody, incubated for 1h at room temperature, and washed three times with PBS. The nuclei were stained with Hoechst (1:500, invitrogen, 33342) fluorescent dye and then photographed with an inverted fluorescent microscope (Olympus) to analyze the effect of red HEV ORF2 protein expression levels. And the positive rate of HEV ORF2 protein was analyzed by Image J to calculate the IC50.
(4) Results
The experimental results are shown in FIG. 4. As can be seen from FIG. 4, HEV ORF2 protein expression was reduced after Vidofludimus treatment compared to the blank (1% DMSO), and the IC50 is shown in Table 8.
TABLE 8 IC50 of Vidofludimus for wild type and mutant HEV
p6 p6_Y1320H p6_G1634R p6_Y1320HG1634R
Vidofludimus 2.32900 2.40800 2.02300 2.23000
Example 5 in vitro experiments in which Vidofludimus inhibited HEV RNA replication in organoids
(1) Organoid HEV replication models embedded in matrigel at 3X 10 per well 4 After the cells were seeded in 24-well plates and cultured in advanced DMEM/F12 medium (Invitrogen) for 24 hours, they were grouped for dosing treatment as follows:
a. experimental group: vidofludimus treatment (final concentration in medium 25. Mu.M) was added for 72 hours.
b. Blank control group: treatment with 1% dmso was added to group a.
(2) Experimental method
After the 2 groups are respectively processed for 72 hours, the organoid HEV RNA is extracted and quantified by using a TRIzol method, and the influence of Vidofludimus on the replication level of the HEV RNA in the organoid is analyzed.
(3) Results
The experimental results are shown in FIG. 5. As can be seen from fig. 5, HEV RNA replication was reduced after Vidofludimus treatment compared to the blank control (1% dmso).
Example 6 effect of Vidofludimus on inhibition of liver organoids HEV-p6Gluc replication models of different donors
(1) Experimental grouping and processing
The organoid HEV replication model was grouped and medicated as follows:
a. experimental group: vidoflimius was added at various concentrations for 72 hours.
b. Blank control group: treatment with 1% dmso was added to group a.
(2) Experimental method
After the 2 groups are respectively processed for 72 hours, the supernatant is collected, the Gaussian luciferase activity is detected by using a Gaussian luciferase detection kit, and the situation that the Vidofludimus inhibits the replication of the HEV replicon in liver organoids of different donors is analyzed.
(4) Results
The experimental results are shown in FIG. 6. As can be seen from fig. 6, HEV replication subsystem replication was significantly reduced after Vidofludimus treatment compared to the placebo group (1% dmso).
From the above examples, the present invention provides an application of Vidofludimus in preparing hepatitis E drugs. Experiments prove that the Vidofludimus can inhibit HEV RNA replication and HEV ORF2 protein expression, and has antiviral effect on HEV mutant strains related to clinical ribavirin treatment failure. Therefore, vidofludimus can provide a new medicine and treatment idea for treating chronic hepatitis E patients and a new scheme for treating clinical ribavirin-resistant HEV patients.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (9)

  1. Use of vidofludimus in the preparation of a medicament for hepatitis e.
  2. 2. The use according to claim 1, wherein the hepatitis e is caused by HEV.
  3. 3. The use according to claim 2, wherein the HEV is a hepatitis c virus.
  4. 4. The use according to claim 3, wherein the hepatitis C virus comprises hepatitis C virus species a, B, C and D.
  5. 5. A medicament for treating hepatitis e, the medicament comprising Vidofludimus.
  6. 6. The medicament according to claim 5, wherein the concentration of Vidofludimus in the medicament is 0.04-20 μmol/L.
  7. 7. The medicament according to claim 6, wherein the medicament further comprises pharmaceutically acceptable excipients and carriers.
  8. 8. The medicament according to claim 7, wherein the auxiliary materials and carriers are one or more of diluents, excipients, fillers, binders, wetting agents, disintegrants, absorption promoters, surfactants, adsorption carriers, lubricants.
  9. 9. The medicament according to claim 8, wherein the dosage form of the medicament comprises injection, tablet, powder, granule, capsule, oral liquid, ointment and cream.
CN202310920852.1A 2023-07-25 2023-07-25 Application of Vidofludimus in preparation of hepatitis E medicines Pending CN116803387A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310920852.1A CN116803387A (en) 2023-07-25 2023-07-25 Application of Vidofludimus in preparation of hepatitis E medicines

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310920852.1A CN116803387A (en) 2023-07-25 2023-07-25 Application of Vidofludimus in preparation of hepatitis E medicines

Publications (1)

Publication Number Publication Date
CN116803387A true CN116803387A (en) 2023-09-26

Family

ID=88079571

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310920852.1A Pending CN116803387A (en) 2023-07-25 2023-07-25 Application of Vidofludimus in preparation of hepatitis E medicines

Country Status (1)

Country Link
CN (1) CN116803387A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102458389A (en) * 2009-05-04 2012-05-16 4Sc股份有限公司 Anti-inflammatory agents as virostatic compounds
CN113456817A (en) * 2020-03-30 2021-10-01 华东理工大学 DHODH inhibitor of anti-RNA virus medicine and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102458389A (en) * 2009-05-04 2012-05-16 4Sc股份有限公司 Anti-inflammatory agents as virostatic compounds
CN113456817A (en) * 2020-03-30 2021-10-01 华东理工大学 DHODH inhibitor of anti-RNA virus medicine and application thereof

Similar Documents

Publication Publication Date Title
Yan et al. Neurotrophin-3 promotes the neuronal differentiation of BMSCs and improves cognitive function in a rat model of alzheimer's disease
CN111557951A (en) Novel method for treating virus infection patient by mesenchymal stem cells
WO2018209848A1 (en) Sirna molecule for inhibiting hbv and use thereof
Li et al. Combined transplantation of neural stem cells and bone marrow mesenchymal stem cells promotes neuronal cell survival to alleviate brain damage after cardiac arrest via microRNA-133b incorporated in extracellular vesicles
CN105418410A (en) Emodin derivatives and application thereof in preparation of anti-HIV-1 medicines
WO2010053350A1 (en) Inhibition of viral infection and replication by mesenchymal stem cells (msc) and msc-derived products
CN111803494B (en) Application of melatonin in preparation of anti-enterovirus drugs
CN116803387A (en) Application of Vidofludimus in preparation of hepatitis E medicines
CN113069445A (en) Application of bovine ledebouriella seseloides as effective component in preparing medicine for treating hepatitis B
CN111671749A (en) Application of dicoumarol in preparation of HBx protein stability inhibitor
CN102337263B (en) siRNA (Small interfering ribonucleic acid) capable of inhibiting expression of enterovirus 71 type gene, composition and application
WO2005024004A1 (en) Method of differentiating mesenchymal stem cell into liver cell and artificial human liver cell
CN116870005A (en) Application of Farudstat in preparation of anti-hepatitis E virus drugs
CN116808058A (en) Application of Pyrazofurin in preparation of medicines for treating hepatitis E diseases
CN113768947B (en) Application of gene inhibitor in preparation of ischemic heart disease treatment medicine
CN115369077A (en) MEFLC cell strain, and construction method and application thereof
CN112516124B (en) Application of tanshinol or its pharmaceutically acceptable salt in preparing antiviral medicine
Wang et al. MiR-29c inhibits HCV replication via activation of type I IFN response by targeting STAT3 in JFH-1-infected Huh7 cells
CN107308178B (en) A medicine for treating parenteral nutrition-related liver disease
CN107446952B (en) Preparation method of medicine for treating parenteral nutrition-related liver disease
CN111514167A (en) Application of donkey-hide gelatin in product for relieving oxidative stress injury of cells
Lajevardi et al. Impact of interplay between autophagy and interferon alpha in HCV and HCV/HIV infection.
CN106619591B (en) The purposes and pharmaceutical composition of oxetacaine in medicine preparation
CN103667423B (en) The purposes and its related drugs of people&#39;s IFITM3 genes
WO2018079753A1 (en) Synoviolin expression inhibitor containing mesenchymal stem cell or culture supernatant thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination