CN116790782A - Method for rapidly verifying radish salt stress response gene function based on non-tissue culture - Google Patents

Method for rapidly verifying radish salt stress response gene function based on non-tissue culture Download PDF

Info

Publication number
CN116790782A
CN116790782A CN202211442705.XA CN202211442705A CN116790782A CN 116790782 A CN116790782 A CN 116790782A CN 202211442705 A CN202211442705 A CN 202211442705A CN 116790782 A CN116790782 A CN 116790782A
Authority
CN
China
Prior art keywords
radish
tissue culture
root
stress response
salt stress
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211442705.XA
Other languages
Chinese (zh)
Inventor
王燕
易小芳
王爽
秦跳姣
柳李旺
徐良
梅燚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN202211442705.XA priority Critical patent/CN116790782A/en
Publication of CN116790782A publication Critical patent/CN116790782A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
    • A01G7/00—Botany in general
    • A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Ecology (AREA)
  • Forests & Forestry (AREA)
  • Mycology (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Environmental Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method for rapidly verifying radish salt stress response gene functions based on non-tissue culture, which comprises the following steps: sprouting and sowing radish seeds; activating agrobacterium rhizogenes carrying a target gene; preparing an aggressive dyeing liquid; cutting off the root under the non-tissue culture condition to obtain a root-free seedling and immersing the seedling into an invasion dye solution for infection; transplanting the infected root-free seedlings to nutrient soil and inducing hairy roots; identifying positive composite plants by phenotypic screening and PCR detection; to the compoundPlants were subjected to salt treatment by phenotype and superoxide anion radical content (O 2 ‑ ) The salt tolerance of the positive composite plants was evaluated by measurement. The invention not only improves the efficiency of the agrobacterium rhizogenes for inducing the hairy roots of the radishes and shortens the rooting time, but also avoids aseptic operation. Successfully verifies the function of the radish salt stress response gene and provides technical reference for the functional verification of the radish body gene.

Description

Method for rapidly verifying radish salt stress response gene function based on non-tissue culture
Technical Field
The invention belongs to the technical field of radish transgenic systems, and relates to a method for producing agrobacterium rhizogenes mediated radish transgenic composite plants under non-tissue culture conditions, which aims to rapidly verify the function of radish in response to salt stress genes.
Background
Radish (Raphanus sativus L.) is a first and second year herb of the genus Raphanus of the family Brassicaceae and plays an important role in the production and annual supply of vegetables in China. At present, with the rapid development of modern biotechnology such as radish genome sequence publication, transgenic engineering and the like, new ideas and choices are provided for radish germplasm genetic improvement. The saline-alkali soil in China is widely distributed, and in the production practice, the problem of soil salinization seriously affects the yield and quality of radishes, so that the development of the radish industry is limited.
In recent years, researchers have been working on developing methods for verifying the function of radish genes, however, stable genetic transformation of radishes often has problems such as low transformation rate, long period, difficult regeneration, lack of proper genotypes and the like, which have hampered the development of functional verification of radish genes and breeding work of good varieties. Agrobacterium rhizogenes (Agrobacterium rhizogenes) can induce plants to generate physiological traits and genetically stable hairy roots through Ri plasmids, and simultaneously integrate exogenous genes into plant genomes, so that genetic transformation of target genes is realized. Agrobacterium rhizogenes mediated genetic transformation has the advantages of short period, simple operation, wide application range and the like, and becomes a powerful tool for plant gene function verification and root system biological research.
Disclosure of Invention
The invention provides a method for simply and rapidly obtaining a radish transgenic composite plant based on a non-tissue culture condition. Provides an effective means for verifying the gene function of the radish. Compared with other transient transformation and heterologous transformation methods, the agrobacterium rhizogenes-mediated genetic transformation system established under the non-tissue culture condition is quicker, more stable and more reliable.
The specific technical scheme of the invention is as follows:
a method for rapidly verifying the functions of radish salt stress response genes based on non-tissue culture comprises the following steps:
(1) Accelerating germination of radish seeds, and sowing the seeds after accelerating germination into matrix soil to obtain radish seedlings.
(2) Activating Agrobacterium rhizogenes carrying the gene of interest.
(3) The day before infection was shaken with LB liquid medium and the invaded solution was prepared.
(4) And (3) when the radish seedlings grow to 4-5d, cutting off the real roots to obtain the root-free seedlings, and infecting the root-free seedlings by adopting the infection liquid in the step (3).
(5) Transplanting the infected root-free seedlings into the matrix soil, and ensuring that the surface of the matrix soil is always wet, and completely burying the infected wounds into the matrix soil.
(6) The hairy roots with green fluorescent protein markers (GFP) were extracted and the DNA was subjected to PCR detection.
(7) And (5) growing the root-free seedlings after infection to a period of four leaves and one heart, and carrying out salt treatment.
(8) Judging the role of the target gene in salt stress according to the phenotype.
In the step (1), qualitative filter paper and a culture dish are adopted for germination, the qualitative filter paper is kept moist in the germination process, and the germination is carried out under the condition of darkness at room temperature for 24 hours.
In the step (2), the agrobacterium rhizogenes bacterial liquid carrying the target genes is stored in a refrigerator at the temperature of minus 80 ℃ and activated by adopting an LB solid culture medium;
the agrobacterium rhizogenes is MSU440 strain, belonging to agro-rod alkali type agrobacterium rhizogenes; the LB solid medium is: 100mg/L Kanamycin (Kanamycin, kan) +50mg/L Streptomycin (Streptomycin, str) +15g/L agar was added to each liter of LB medium.
In the step (2), 20 mu L of bacterial liquid is sucked by a sterilized gun head, the bacterial liquid is streaked on an LB solid culture medium and then sealed, and the bacterial liquid is inverted and cultured in a constant temperature incubator at 28 ℃ for 2d, and the bacterial colony grows out.
In the step (3), a sterilized gun head is adopted to scrape colonies, and the colonies are transferred into LB liquid medium and are subjected to shaking culture for 8-12 hours at a constant temperature of 28 ℃ and 220 rmp.
The LB liquid culture medium is as follows: LB liquid medium+100 mg/L Kan+50mg/L Str.
In the step (4), the infection liquid OD adopted in the infection process 600 The value was 1.0.
In the step (4), the infection time is 40-60min.
In the step (4), 300. Mu. Mol/L Acetosyringone (AS) is added to the dyeing solution.
In the step (5), the wound of the infected root-free seedling is downwards vertically inserted into the matrix soil, so that the wound is ensured to be completely buried in the matrix soil.
In the step (6), DNA is extracted by a CTAB method.
In the step (6), the PCR amplification reaction system is as follows: the total volume was 10. Mu.L, in which Taq enzyme Mix 5. Mu.L, primer F (10. Mu.M) and primer R (10. Mu.M) were each 0.5. Mu.L, and template DNA (20 ng/. Mu.L) 1. Mu. L, ddH 2 O 3μL。
PCR reaction procedure:
in step (7), the salt treatment was carried out with a salt solution concentration of 150mM.
In the step (8), the phenotype judgment indexes are plant growth vigor and survival rate.
The invention has the beneficial effects that:
aiming at the problem of difficult verification of the function of the radish body gene, the invention provides a method for inducing a radish transgenic composite plant by agrobacterium rhizogenes under a non-tissue culture condition, and the method can be used for rapidly and effectively verifying the function of the radish response salt stress related gene in the radish body. And the GFP fluorescent marker is used for screening the transgenic hairy roots, thereby providing a rapid and simple method for screening the transgenic hairy roots.
Drawings
FIG. 1 shows the procedure for obtaining transgenic composite plants in example 1 (A: LHZ at seedling age of 4D; B: removing the main root, leaving 0.5-1cm hypocotyl below the growing point; C: agrobacterium rhizogenes infection; D: transplanting into soil without root seedlings; E: starting growing hairy roots at 4D after infection; F: 6D after infection; G: GFP observation at 25D after infection);
FIG. 2 is a GFP fluorescence map of the composite plant of example 1 (1300: turning empty composite plant; rsPIP2;6: turning RsPIP2;6 Gene composite plant);
FIG. 3 shows the PCR detection results of transgenic composite plants in example 1 (CK 1-CK3: empty composite plant hairy roots; OE1-OE6: rsPIP 2-transgenic composite plant hairy roots; 6-gene composite plant hairy roots);
FIG. 4 is a schematic diagram of the salt treatment test in example 2;
FIG. 5 shows the composite plant after 6d treatment in example 2 (CK 1: composite plant before fresh water treatment; CK2: composite plant before 150mM NaCl treatment; T1: composite plant after fresh water treatment; T2: composite plant after 150mM NaCl treatment);
FIG. 6 shows the composite plant treated for 6d in example 2 (A: clean water-treated composite plant; B:150mM NaCl-treated composite plant);
FIG. 7 is a staining chart of nitrotetrazolium chloride (NBT) in example 3 (CK 1 clear water treated empty composite plant: CK2 clear water treated transgenic composite plant; T1:150mM NaCl treated empty composite plant; T2:150mM NaCl treated transgenic composite plant)
Detailed Description
Example 1 RsPIP2;6 obtaining transgenic composite plants
1. Radish seedling obtaining
(1) Selecting uniform-sized NAU-LHZ radish seeds, placing the seeds in a culture dish filled with wet filter paper, and accelerating germination under the condition of darkness at room temperature for 24 hours.
(2) Seeds for accelerating germination are sown in the hole trays filled with moist matrix soil.
(3) Watering every day to ensure that the surface of the substrate soil is moist, and obtaining the radish seedlings after 4-5 days.
2. Preparation of dyeing liquor
(1) Taking pCAMBIA1300-RsPIP2 carried in a refrigerator at-80deg.C; 6. MSU440 Agrobacterium rhizogenes bacteria liquid of the over-expression vector, sucking 20 mu L of bacteria liquid on a solid culture medium of LB+100mg/L Kan+50mg/L Str by a pipetting gun in an ultra-clean workbench, sealing a flat plate after the bacteria liquid is dried, and culturing in a constant temperature incubator at 28 ℃ for 2d after inversion.
(2) The activated bacterial blocks are scraped and transferred into a liquid culture medium of LB+100mg/L Kan+50mg/L Str for 8-12h at 28 ℃ in 220rmp shaking bed.
(3) The bacterial liquid is centrifuged for 5min at 11200rmp, the supernatant is removed, 1/2MS is adopted to re-suspend the agrobacterium, and OD is regulated 600 The value was 1.0.
(4) Adding 300 mu mol/LAS, and mixing to obtain the dyeing solution.
3. Root-free seedling preparation
(1) And (3) when the agrobacterium is activated, selecting radish seedlings with uniform growth vigor, and rapidly cutting off and removing the real roots from the position 0.5-1cm below the growth point to obtain the root-free seedlings.
4. Agrobacterium infection
(1) Immersing the root-free seedlings in the bacterial liquid to ensure that the wounds are completely immersed in the infection liquid, and infecting the wounds in a 220rmp shaking table at the temperature of 28 ℃ for 40-60min.
(2) And after infection is finished, vertically inserting the root-free seedling wound into matrix soil downwards and compacting to ensure that the wound is fully contacted with the matrix soil.
5. Hairy root induction and composite plant obtaining
(1) When hairy roots are induced, the plant growth environment temperature is ensured to be about 25 ℃, the higher humidity of matrix soil in the earlier stage of induction is ensured, and a moisturizing cover is covered if necessary.
(2) After about 5 days, the hairy roots start to emit, and after 14 days, a composite plant with a luxuriant hairy root system can be obtained.
6. Transgenic composite plant screening and identification
(1) pCAMBIA1300-RsPIP2;6, the over-expression vector carries GFP marker genes and is transferred into pCAMBIA1300-RsPIP2;6 the hairy root of the over-expression vector shows green fluorescence under LUYOR-3415RG double fluorescent protein observation lamp; transgenic composite plants were screened by phenotypic identification and PCR detection.
The PCR amplification reaction system is as follows: the total volume was 10. Mu.L, in which Taq enzyme Mix 5. Mu. L, pCAMBIA1300F (10. Mu.M) and pCAMBIA1300R (10. Mu.M) were each 0.5. Mu.L, and template DNA (20 ng/. Mu.L) 1. Mu. L, ddH 2 O3. Mu.L. The amplification primers are respectively as follows:
pCAMBIA1300F：AGCAAGAACGGAATGCGCGTGAC
RsPIP2；6R：gcccttgctcaccatggtaccGACGTTTGCAGCACTTCTGAAA
PCR reaction procedure:
of the 6 GFP-labeled hairy roots and 3 empty hairy roots detected, the 6 GFP-labeled hairy roots detected RsPIP2;6 gene bands, 3 empty hairy roots all detected pCAMBIA1300 bands. The probability that GFP-labeled hairy roots are transgenic hairy roots is 100%.
In the embodiment, rsPIP2;6 is a target gene, but is not limited to the gene, the target gene can be replaced equally, and a transgenic composite plant is obtained by the method of example 1.
Example 2 RsPIP2;6 exploration of salt tolerance of transgenic composite plants
TABLE 1 Effect of salt treatment on composite plants
CK1: carrying out clear water treatment on empty-load composite plants; CK2: transgenic composite plants treated by clear water; t1:150mM NaCl treated empty composite plants; t2: transgenic composite plants treated with 150mM NaCl
Note that: the data in the table are mean ± standard deviation, and the different letters of the same column represent the 0.05 level difference under Duncan multiple comparisons. "X" means the intensity of flourishing, the more X "the flourishing
Selecting four leaves with the same growth vigor and a one-heart period, turning into pCAMBIA1300 to idle load and turning into RsPIP2;6, treating the composite plant of the gene with 150mM NaCl solution to obtain T1 and T2, and treating with clear water to obtain CK1 and CK2.
After 6d treatment, CK1 and CK2 grow well and uniformly, no wilting and wilting plants appear, and the survival rate of the plants is 100%; t1 and T2 grow and flourish to a degree obviously weaker than CK1 and CK2, T2 grow and flourish to a degree stronger than T1, and survival rates are 88.89% and 55.56% respectively. Specifying RsPIP2;6, the salt tolerance of the transgenic composite plant is stronger than that of the composite plant without load, and RsPIP2; the 6 gene may play an important role in relieving radish salt stress.
Example 3 RsPIP2;6 transgenic hairy root superoxide anion radical (O) 2 - ) Content determination
The four treated plants in example 2 were excised from the aerial parts to obtain hairy roots. Staining with 0.05% nitrotetrazolium chloride (NBT) staining solution. The root system was completely immersed in the staining solution, vacuum treated for 20min, followed by staining in a 220rmp shaker at 28℃for 12h. After the dyeing is finished, 95% ethanol is adopted for decoloring until chlorophyll is completely removed, and the dyeing condition of hairy roots is observed.
The results show that the dyeing conditions of the hairy roots of CK1 and CK2 are not significantly different, and are shallower than those of T1 and T2, which indicates that O in the hairy roots is caused by salt treatment 2 - The content is increased. T2 was less stained than T1, indicating that T2 was O under salt treatment 2 - Is less, over-expresses RsPIP2; the 6 gene may promote O in hairy roots 2 - Is a clean-up of (a).
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (7)

1. A method for rapidly verifying the functions of radish salt stress response genes based on non-tissue culture comprises the following steps:
(1) Accelerating germination and sowing of radish seeds;
(2) Preparing agrobacterium rhizogenes bacterial liquid activation and infection liquid carrying target genes;
(3) Obtaining and infecting root-free seedlings;
(4) Transplanting the root-free seedlings into soil and inducing rooting;
(5) Screening transgenic hairy roots according to the reporter gene;
(6) Extracting transgenic hairy root DNA and detecting by PCR;
(7) Salt treatment and gene function verification of transgenic composite plants.
2. The method for rapidly verifying the function of a radish salt stress response gene based on non-tissue culture of claim 1, wherein the method comprises the following steps: in the step (1), tissue culture is not needed in the whole process, the germination accelerating process is carried out in a culture dish filled with wet qualitative filter paper, seeds are uniformly spread on the filter paper, and germination accelerating is carried out for 24 hours under the condition of room temperature and darkness. The seeds after germination accelerating are sowed in the hole tray filled with matrix soil for 4-5d growth.
3. The method for rapidly verifying the function of a radish salt stress response gene based on non-tissue culture of claim 1, wherein the method comprises the following steps: the agrobacterium rhizogenes bacterial liquid containing the target genes in the step (2) is stored in a refrigerator at the temperature of minus 80 ℃, and the culture medium for activating the agrobacterium is as follows: 20g/L LB+15g/L agar+100 mg/L Kanamycin (Kanamycin, kan) +50mg/L streptomycin (Streptomycin sulfate, str), 2d before infection; the culture medium is as follows: 20g/L LB+100mg/L Kan+50mg/L Str; when the invasive dye solution is prepared, a 1/2MS liquid culture medium is adopted to make the bacterial solution OD 600 The value was adjusted to 1.0, 300. Mu. Mol/LAS was added to the dip, the infestation was carried out in a 220rmp shaker at 28℃and the course was carried out one day before the infestation; the 1/2MS liquid medium has a composition of 4.6 g/L1/2MS+30 g/L sucrose.
4. The method for rapidly verifying the function of a radish salt stress response gene based on non-tissue culture of claim 1, wherein the method comprises the following steps: taking 4-5d seedlings in the step (3), rapidly cutting from 0.5-1cm downwards from the growing point to obtain root-free seedlings, and immersing the root-free seedlings into OD 600 Infection in the aggressive solution=1.0 for 40-60min.
5. The method for rapidly verifying the function of a radish salt stress response gene based on non-tissue culture of claim 1, wherein the method comprises the following steps: and (3) the substrate soil for inducing rooting of the root-free seedlings in the step (4) is required to be kept moist, and the surface is always kept moist.
6. The method for rapidly verifying the function of a radish salt stress response gene based on non-tissue culture of claim 1, wherein the method comprises the following steps: the method for extracting DNA in the step (6) is a CTAB method; the PCR reaction system for DNA detection is as follows: the total volume was 10. Mu.L, in which Taq enzyme Mix 5. Mu.L, primer F (10. Mu.M) and primer R (10. Mu.M) were each 0.5. Mu.L, and template DNA (20 ng/. Mu.L) 1. Mu. L, ddH 2 O 3μL。
PCR reaction procedure:
7. the method for rapidly verifying the function of a radish salt stress response gene based on non-tissue culture of claim 1, wherein the method comprises the following steps: the NaCl concentration used for the salt treatment in the step (7) is 150mM; the gene function verification adopts a phenotype observation method and a nitro tetrazolium blue chloride (NBT) staining method, and the concentration of the NBT staining solution is 0.05 percent.
CN202211442705.XA 2022-11-17 2022-11-17 Method for rapidly verifying radish salt stress response gene function based on non-tissue culture Pending CN116790782A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211442705.XA CN116790782A (en) 2022-11-17 2022-11-17 Method for rapidly verifying radish salt stress response gene function based on non-tissue culture

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211442705.XA CN116790782A (en) 2022-11-17 2022-11-17 Method for rapidly verifying radish salt stress response gene function based on non-tissue culture

Publications (1)

Publication Number Publication Date
CN116790782A true CN116790782A (en) 2023-09-22

Family

ID=88045638

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211442705.XA Pending CN116790782A (en) 2022-11-17 2022-11-17 Method for rapidly verifying radish salt stress response gene function based on non-tissue culture

Country Status (1)

Country Link
CN (1) CN116790782A (en)

Similar Documents

Publication Publication Date Title
CN101679997B (en) Methods for inducing cotton embryogenic callus
CN111893138B (en) Agrobacterium-mediated sugarcane growth point genetic transformation method
CN113388526B (en) Endophytic fungus FO-R20 and application thereof
CN110699361A (en) Rice salt stress resistance related gene Os16 and encoding protein and application thereof
CN110862995B (en) Construction and application of soybean sclerotiniose resistant gene GmPR5 and GmPR5 transgenic plants
CN112143730B (en) Soybean GmEF1B gene mutant plant and preparation method and application thereof
CN114836468B (en) Betula alba root transgenic method
US20230132082A1 (en) Agrobacterium-mediated genetic transformation method for sea barleygrass
CN116790782A (en) Method for rapidly verifying radish salt stress response gene function based on non-tissue culture
CN112708634B (en) Agrobacterium-mediated peanut rapid genetic transformation method
CN115491380A (en) Plant lipoxygenase gene LOX and application thereof in broad-spectrum disease resistance of plants
CN104774826B (en) A kind of histone deacetylase and its encoding gene and application
CN114350673A (en) Rice KOB1 gene for regulating seed vigor and regulating method thereof
CN114958904B (en) Method for rapidly obtaining radish transgenic material
CN117187294B (en) Application of BnaC5.ACBP4 gene in improving flooding resistance of plants
CN112410367B (en) Genetic transformation system for lean fruit
CN117089570B (en) Application of BnaC2 WRKY22 gene in improving flooding resistance of plants
CN118147165B (en) Application of FTO gene in improving total solid content of latex
CN114807219B (en) Agrobacterium-mediated sesame cotyledon transgenic method
CN102329817B (en) Agrobacterium-mediated method for culturing transgenic populus wutunensis plants
CN109892218B (en) Method for rapidly and efficiently screening plants without transgenic components in rice gene editing strain
KR100614221B1 (en) A transgenic Platycodon grandiflorm resistant to a herbicide
CN117467696A (en) Application of BnaA7 WRKY70-OE gene in improvement of flooding resistance of plants
CN116445508A (en) Soybean GmMATE109 gene and application thereof
CN115992173A (en) Method for preparing transgenic material for resisting petal infection diseases

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination