CN116790462A

CN116790462A - Universal platform strain with high-carbon-atom economical central metabolic network, and construction method and application thereof

Info

Publication number: CN116790462A
Application number: CN202310723612.2A
Authority: CN
Inventors: 赵广; 郭李坤; 刘敏; 毕钰佳; 王纪超
Original assignee: Shandong University
Current assignee: Shandong University
Priority date: 2023-06-16
Filing date: 2023-06-16
Publication date: 2023-09-22

Abstract

The invention belongs to the technical fields of genetic engineering and microorganisms, and particularly relates to a strain with a high-carbon-atom economic central metabolic network, and a construction method and application thereof. The invention is realized by the method for preparing the escherichia coliThe central metabolism network is reconstructed, and the specific intermediate product and enzyme are named as SCTPK circulation, so that the universal platform strain with high carbon atom economy central metabolism network is successfully obtained, and the strain background glycolysis path can be effectively reduced, and the acetyl coenzyme A generated by pyruvic acid releases CO ₂ The carbon atom loss caused by the method can simultaneously carry out high-efficiency biosynthesis on acetyl coenzyme A derivatives (such as 3-hydroxy propionic acid, mevalonic acid, polyhydroxy butyric acid and the like), and has great innovation and application potential. The platform strain is suitable for biosynthesis of acetyl-CoA derivative products, and therefore has good practical application value.

Description

Universal platform strain with high-carbon-atom economical central metabolic network, and construction method and application thereof

Technical Field

The invention belongs to the technical fields of genetic engineering and microorganisms, and particularly relates to a strain with a high-carbon-atom economic central metabolic network, and a construction method and application thereof.

Background

The information disclosed in the background of the invention is only for enhancement of understanding of the general background of the invention and is not necessarily to be taken as an admission or any form of suggestion that this information forms the prior art already known to a person of ordinary skill in the art.

Acetyl coenzyme A is an important molecule in living bodies, plays a central pivot role in the carbon metabolism process of microorganisms, is connected with glycolysis, tricarboxylic acid cycle, glyoxylate branch, acetic acid and other metabolic pathways, and simultaneously participates in various enzymatic reactions, is an important precursor for synthesizing various bio-based chemicals, such as isoprene, terpenes, polyketones, polyhydroxyalkanoates, lipids and the like, and has been widely applied to various fields of medicines, food additives, chemical industry, agriculture, cosmetics and the like.

At present, the biosynthesis of acetyl-CoA derivatives is more studied at home and abroad, and a lot of important research progress is achieved. For example, 3-hydroxy propionic acid (3 HP) is one of the most potential chemical products in the 21 st century, and the third among the 12 important platform chemicals is used as an adhesive, a plastic package, a fiber, a cleaner, a resin, etc., and has a wide prospect. Researchers have expressed acetyl-CoA carboxylase (ACC), pyridine nucleotide transhydrogenase (pyridine nucleotide transhydrogenase, pntAB) and malonate monoacyl-CoA reductase from orange green flexor Chloroflexus aurantiacus Malonyl-CoA reduction, MCR) finally yields 0.19 g/L3 HP. Mevalonic acid (MVA) is a synthetic precursor of various isoprenoid compounds, and can be applied to food, pharmaceutical, chemical industries, and the like. Researchers optimized the fermentation process and used methylobacterium torvum as a host, and the MVA yield was 450.74mg/L. Polyhydroxybutyrate (PHB) is the most representative biodegradable and biocompatible thermoplastic, and is suitable for the industries of packaging, medicine, pharmacy, food and the like. Researchers over-expressed the Ralstonia eutropha-derived polyhydroxyalkanoate synthesis operon gene phaCAB to give PHB yield of 0.51g/L. The inventors found that although studies on the above single acetyl-CoA derived products have been reported, the following problems still remain. Firstly, in the microbial background central metabolic network, the maximum theoretical conversion rate from glucose to acetyl-CoA is only 67% due to the existence of a natural glycolytic pathway. The carbon atom economy of the carbon metabolism network is low, and the production performance and the conversion efficiency of a microbial cell factory are directly affected; at the same time lost carbon atoms as CO ₂ The form of emissions is contrary to the goal of low emissions sustainability in biological manufacturing. Secondly, the reported researches are conducted on a single acetyl-CoA derivative, and a general platform strain with high carbon atom economy is lacked for microbial synthesis of various acetyl-CoA derivatives.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a universal platform strain with a high carbon atom economy center metabolic network, and a construction method and application thereof. Specifically, the invention successfully obtains the universal platform strain with the high-carbon-atom economic central metabolic network by reconstructing the central metabolic network of the escherichia coli, and using the peculiar intermediate products and enzymes thereof as SCTPK (sedohepulose-1, 7-bisphosphatase Cycle with Trifunctional PhosphoKetolase) circulation, which not only can effectively reduce the background glycolysis path of the strain to release CO from acetyl-CoA generated by pyruvic acid ₂ Resulting in loss of carbon atoms and simultaneously high biosynthesis of acetyl-CoA derivatives (e.g. 3-hydroxypropionic acid, mevalonic acid)And polyhydroxybutyrate, etc.). Based on the above results, the present invention has been completed.

Specifically, the technical scheme of the invention is as follows:

the first aspect of the invention provides a universal platform strain with a high carbon atom economy center metabolic network, which specifically takes escherichia coli as an initial strain, and knocks out a pyruvate formate lyase gene pflB, a lactate dehydrogenase gene ldhA, an alcohol dehydrogenase gene adhE, a pyruvate oxidase gene poxB, a pyruvate dehydrogenase gene aceE, a transketolase gene tktAB and a transaldolase gene talAB; overexpression of the phosphoketolase gene xfspk, sedoheptulose-1,7-bisphosphatase gene slr2094; and inhibiting 6-phosphofructokinase gene pfkA, glyceraldehyde-3-phosphate dehydrogenase gene gapA and erythrose-4-phosphate dehydrogenase gene gapB.

In a second aspect of the present invention, there is provided a method for constructing the above-mentioned universal platform strain having a high carbon atom economy center metabolic network, the method comprising:

s1, respectively knocking out a pyruvate formate lyase gene pflB, a lactate dehydrogenase gene ldhA, an alcohol dehydrogenase gene adhE, a pyruvate oxidase gene poxB, a pyruvate dehydrogenase gene aceE, a transketolase gene tktAB and a transaldolase gene talAB on the genome of escherichia coli to obtain a mutant strain I;

s2, screening sedoheptulose-1, 7-bisphosphatase activity of different hosts, inserting a sedoheptulose-1, 7-bisphosphatase coding gene with highest activity into the genome of the mutant strain I obtained in the step S1, and continuing over-expressing a phosphoketolase gene xfspk in host bacteria inserted with the sedoheptulose-1, 7-bisphosphatase gene to obtain a mutant strain II;

s3, identifying the efficiency of antisense RNA mediated gene expression inhibition, and determining the strength of the promoter and the length of the antisense RNA under the conditions of strong inhibition, medium inhibition and weak inhibition;

s4, utilizing the antisense RNA elements with different inhibition efficiencies obtained in the step S3 to carry out grading inhibition on key genes of the SCTPK competition pathway in the mutant strain II obtained in the step S2, wherein the key genes at least comprise 6-phosphofructokinase gene pfkA, glyceraldehyde-3-phosphate dehydrogenase gene gapA and erythrose-4-phosphate dehydrogenase gene gapB, and thus the universal platform strain is obtained.

In a third aspect of the application there is provided the use of a universal platform strain having a high carbon economy central metabolic network as described above for the fermentative production of acetyl-coa derived products.

Wherein the acetyl-coa derived products include, but are not limited to, 3-hydroxypropionic acid, mevalonic acid, and polyhydroxybutyric acid.

In a fourth aspect of the application, there is provided a method of fermentatively producing an acetyl-coa derived product, the method comprising:

s1, activating the universal platform strain, and inoculating the activated universal platform strain into an antibiotic-free LB (LB) culture medium to prepare competent cells;

s2, introducing the recombinant plasmid of the target acetyl-CoA derived product to be produced into the competent cells prepared in the step S1 to obtain recombinant bacteria of the acetyl-CoA derived product to be produced;

s3, inoculating the recombinant bacteria obtained in the step S2 into a liquid culture medium containing antibiotics for fermentation culture, and separating and extracting to obtain the acetyl coenzyme A derivative product.

Such acetyl-coa derived products include, but are not limited to, 3-hydroxypropionic acid, mevalonic acid, and polyhydroxybutyric acid.

In addition, it should be noted that, although the above-mentioned Escherichia coli (Escherichia coli) BW25113 is taken as an example of a starting strain, a universal platform strain having a high carbon atom economy center metabolic network is constructed and an acetyl-coa derivative is studied, based on the inventive concept of the present application, a corresponding universal platform strain or the like is obtained by conventionally replacing other starting strains or related biological elements without performing creative labor, and the method also falls within the protection scope of the present application.

One or more of the above technical solutions has the beneficial technical effects:

1. due to the microorganisms inCO is released during cardiac metabolism ₂ The economical efficiency of carbon atoms in the fermentation process is reduced, and the maximum theoretical yield of the carbon atoms is only 67%. The platform strain of the invention reconstructs the original central metabolic network, so that one molecule of glucose does not release CO ₂ Is completely converted into three molecules of acetyl phosphate, and the maximum theoretical yield of carbon atoms is improved to 100 percent. Meanwhile, the SCTPK cycle constructed by the research only needs 6 enzymes to participate, and is the carbon sequestration cycle with the shortest path at present, so that the protein expression requirement is reduced, and the SCTPK cycle reconstructed by the escherichia coli central metabolic network has both carbon atom economy and protein economy. On the other hand, most of the recombinant bacteria constructed in the prior art are only suitable for biosynthesis of single acetyl-CoA derived products, have no universality, and the direct product of the SCTPK cycle after reconstruction is acetyl phosphate and can be further converted into acetyl-CoA, so that the recombinant bacteria are suitable for microbial synthesis of various acetyl-CoA derived products, and have universality.

2. The technical proposal is that the pyruvic acid lyase gene pflB, the lactic acid dehydrogenase gene ldhA, the ethanol dehydrogenase gene adhE, the pyruvic acid oxidase gene poxB, the pyruvic acid dehydrogenase gene aceE, the transketolase gene tktAB and the transaldolase gene talAB are knocked out on the basis of the E.coli BW 25113; overexpression of the phosphoketolase gene xfspk, sedoheptulose-1, 7-bisphosphatase gene slr2094; weakening 6-phosphofructokinase gene pfkA, glyceraldehyde-3-phosphate dehydrogenase gene gapA and erythrose-4-phosphate dehydrogenase gene gapB to obtain the universal platform strain with high carbon atom economy center metabolic network. The platform strain converts metabolic flow from glycolysis to SCTPK circulation, and reduces CO ₂ Reduces the synthesis of byproducts such as acetic acid, improves the yield and the yield of acetyl-CoA derived products including but not limited to 3-hydroxy propionic acid, mevalonic acid and polyhydroxy butyric acid, and has larger application potential and wide application range.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention. FIG. 1 is the design and construction of the initial SCTPK pathway of E.coli.

FIG. 2 shows the purification of sedoheptulose-1, 7-bisphosphatase, fructose-1, 6-bisphosphate aldolase and phosphoketolase from different hosts.

FIG. 3 shows the screening of sedoheptulose-1, 7-bisphosphatase enzyme activity.

FIG. 4 shows the selection of fructose-1, 6-bisphosphatase enzyme activity.

FIG. 5 shows catalytic activity of phosphoketolase with X5P, F P and S7P as substrates, respectively.

FIG. 6 is a growth coupling strategy to test strain growth (c) with knock-out aceE (a) and gnd (b) to verify whether SCTPK is functioning.

FIG. 7 shows intracellular pyruvate (a) and acetyl phosphate (b) levels after initial SCTPK establishment in E.coli.

FIG. 8 is a graph showing the effect of promoter strength and asRNA length on inhibition efficiency.

FIG. 9 is a graph of the gene for split SCTPK and will be inhibited using asRNA interference.

FIG. 10 shows the level of acetyl phosphate (a) and strain growth (b) after inhibition of single genes of split SCTPK by asRNA interference.

FIG. 11 shows the mRNA levels of gapA, gapB and pfkA in qRT-PCR assay of strains with and without the corresponding asRNA.

FIG. 12 shows the acetyl phosphate level of the strain (a) and the growth of the strain (b) after combined fractionation of the multiple genes of split SCTPK using asRNA interference.

FIG. 13 is a graph showing the combined staged suppression of multiple genes of split SCTPK using asRNA interference ₂ And the relative discharge amount (b).

FIG. 14 shows intracellular pyruvate (a) and acetate (b) levels after combined fractionation of multiple genes of split SCTPK using asRNA interference.

FIG. 15 shows the fermentation results of a universal platform strain applied to acetyl-CoA derived products 3-hydroxypropionic acid (a), mevalonic acid (b) and polyhydroxybutyrate (c).

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the present invention. As used herein, the singular is also intended to include the plural unless the context clearly indicates otherwise, and furthermore, it is to be understood that the terms "comprises" and/or "comprising" when used in this specification are taken to specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof.

The invention will now be further illustrated with reference to specific examples, which are given for the purpose of illustration only and are not intended to be limiting in any way. If experimental details are not specified in the examples, it is usually the case that the conditions are conventional or recommended by the reagent company; reagents, consumables, etc. used in the examples described below are commercially available unless otherwise specified.

Definitions, abbreviations or acronyms referred to in this disclosure and description of related terms:

pyruvate formate lyase gene: pflB; lactate dehydrogenase gene: ldhA; ethanol dehydrogenase gene: adhE; pyruvate oxidase gene: poxB; pyruvate dehydrogenase gene: aceE; transketolase gene: tktAB; transaldolase gene: talAB; phosphoketolase gene: xfspk; sedoheptulose-1, 7-bisphosphatase gene: slr2094; 6-phosphofructokinase gene: pfkA; glyceraldehyde-3-phosphate dehydrogenase gene: gapA; erythrose-4-phosphate dehydrogenase gene: gapB; antisense RNA: asRNA; carbon dioxide: CO ₂ The method comprises the steps of carrying out a first treatment on the surface of the 3-hydroxypropionic acid: 3HP; mevalonic acid: MVA; polyhydroxybutyrate: PHB; xylulose 5-phosphate: X5P; fructose 6-phosphate: F6P; sedoheptulose 7-phosphate: S7P; high performance liquid chromatography: HPLC; coli (Escherichia coli): e.coli.

"Heat shock transformation" or "thermal transformation" refers to a technique of transfection in molecular biology for integrating and stably expressing a foreign gene into a host gene by introducing the foreign gene into the host gene or introducing a foreign plasmid into a host protoplast after heat shock, heat shock transformation or thermal transformation, etc., using a slit in the cell membrane after heat shock.

"overexpression" or "overexpression" refers to the substantial expression of a particular gene in an organism, with an amount of expression that exceeds normal levels (i.e., wild-type expression levels) that can be achieved by enhancing endogenous expression or introducing exogenous genes.

"antisense RNA inhibition" refers to a mode of regulation of gene expression in molecular biology that can inhibit the expression of a particular gene without knocking out the gene required for growth.

As described above, although studies on single acetyl-CoA derived products have been reported in the prior art, there are problems such as low economy of carbon atoms in the carbon metabolic network and lack of general-purpose platform strains with high economy of carbon atoms for microbial synthesis of various acetyl-CoA derived products.

However, the E.coli universal platform strain of the invention is a recombinant of the background central metabolic network, bypassing the release of CO from the glycolytic product pyruvate ₂ Acetyl-coa is produced with carbon loss, and SCTPK cycle dependent on phosphoketolase is comprehensively constructed and optimized using a "push-pull-boost" strategy. Specifically, the irreversible reaction catalyzed by Xfspk and the gene slr2094 encoding product SBPase provides a driving force to push carbon flux into the carbon sequestration cycle; enhancing expression of the gene encoding the rate-limiting enzyme by placing the gene xfspk on a high copy number plasmid to promote synthesis of AcP from xylulose 5-phosphate (X5P), fructose 6-phosphate (F6P) and sedoheptulose 7-phosphate (S7P); genes involved in the production of acetic acid, lactic acid, ethanol and formate were knocked out to eliminate carbon loss, this portion of byproduct carbon was pulled into the target pathway, and expression of PykA, gapA and GapB proteins that shunted the SCTPK cycle was suppressed by combining antisense RNA arrays in stages to further pull the competitively metabolized carbon flux into our desired SCTPK cycle. In this way, one molecule of glucoseComplete conversion to three molecules of acetyl-CoA, resulting in a theoretical conversion of glucose to acetyl-CoA of 67% to 100%. And then through over-expressing phosphoacetyl transferase gene pta, promoting the generation of acetyl coenzyme A, and further being used for the synthesis of various acetyl coenzyme A derivative products. The invention takes biosynthesis of three important acetyl-CoA derivative products, namely 3-hydroxy propionic acid, mevalonic acid and polyhydroxybutyric acid as an example to illustrate the universality of the platform strain, but the platform strain is not limited to the biosynthesis of the three listed acetyl-CoA derivative products, and is also applicable to the biosynthesis of other acetyl-CoA derivative products, and only recombinant plasmids of different target acetyl-CoA derivative products need to be introduced into the competence of the platform strain.

In view of this, in an exemplary embodiment of the present invention, a universal platform strain with a high carbon economy central metabolic network is provided, wherein the universal platform strain specifically uses escherichia coli as an initial strain, and the pyruvate formate lyase gene pflB, the lactate dehydrogenase gene ldhA, the alcohol dehydrogenase gene adhE, the pyruvate oxidase gene poxB, the pyruvate dehydrogenase gene aceE, the transketolase gene tktAB, and the transaldolase gene talAB are knocked out; overexpression of the phosphoketolase gene xfspk, sedoheptulose-1, 7-bisphosphatase gene slr2094; and inhibiting 6-phosphofructokinase gene pfkA, glyceraldehyde-3-phosphate dehydrogenase gene gapA and erythrose-4-phosphate dehydrogenase gene gapB.

The Escherichia coli can be Escherichia coli (Escherichia coli) BW25113.

GenBank accession of the pyruvate formate lyase gene pflB is AIN31371.1; genBank accession of the lactate dehydrogenase gene ldhA is AIN31834.1; genBank accession of the alcohol dehydrogenase gene adhE is AIN31697.1; genBank accession of the pyruvate oxidase gene poxB is AIN31340.1; genBank accession of the pyruvate dehydrogenase gene aceE is AIN30644.1; genBank accession of transketolase gene tktA is AIN33296.1; genBank accession of transketolase gene tktB is AIN32864.1; genBank accession of the transaldolase gene talA is AIN32863.1; genBank accession of the transaldolase gene talB is AIN30546.1; genBank accession of the phosphoketolase gene xfspk is AAN24771.1; genBank accession of the sedoheptulose-1, 7-bisphosphatase gene slr2094 is P73922.1; genBank accession of the phosphofructokinase 6 gene pfkA is AIN34215.1; genBank accession of the glyceraldehyde-3-phosphate dehydrogenase gene gapA is AIN32216.1; genBank accession of the erythrose-4-phosphate dehydrogenase gene gapB was AIN33289.1.

Wherein the inhibition of 6-phosphofructokinase gene pfkA, glyceraldehyde-3-phosphate dehydrogenase gene gapA and erythrose-4-phosphate dehydrogenase gene gapB are specifically strong inhibition of 6-phosphofructokinase gene pfkA using antisense RNA, moderate inhibition of glyceraldehyde-3-phosphate dehydrogenase gene gapA using antisense RNA and weak inhibition of erythrose-4-phosphate dehydrogenase gene gapB using antisense RNA.

In still another embodiment of the present invention, there is provided a method for constructing the above-mentioned universal platform strain having a high carbon atom economy center metabolic network, the method comprising:

In the step S1, the escherichia coli may specifically be escherichia coli e.coli BW25113; the knockout can be performed according to standard methods of operation using any known gene editing, particularly gene knockout techniques. In one embodiment of the present invention, the knockout may employ CRISPR/Cas9 technology, and thus, in particular, the method of step S1 comprises: the sgRNA sequence of the target gene is designed, and the CRISPR/Cas9 is utilized to knock out pyruvate formate lyase gene pflB, lactate dehydrogenase gene ldhA, alcohol dehydrogenase gene adhE, pyruvate oxidase gene poxB, pyruvate dehydrogenase gene aceE, transketolase gene tktAB and transaldolase gene talAB on the genome of the escherichia coli BW25113 of the original strain respectively, so as to obtain a mutant strain I, which is named as Q3952 (E.coli BW25113 delta pflB delta ldhA delta adhE delta poxB delta aceE delta tktAB delta talAB).

In step S2, the host comprises Bacillus methanolicus, saccharomyces cerevisiae cen.pk, e.coli BW25113, serratia marcescens, synechocystis sp.pcc6803 and Thermosynechococcus elongatus; further preferred is Synechocystis sp.pcc 6803; specifically, the method of step S2 includes: the highest enzyme activity sedoheptulose-1, 7-bisphosphatase gene slr2094 from Synechocystis sp.PCC6803 is inserted into the genome of mutant strain I by CRISPR/Cas9, and the promoter can be P _j23119 Cloning of the gene xfspk derived from Bifidobacterium longum NCC2705 into the vector pETDuet-1, the promoter may be P _phlf The recombinant plasmid pETD-xfspk was obtained, and the plasmid was further transformed into a mutant strain inserted into slr2094 to obtain mutant strain II.

In the step S3, the promoter includes a strong promoter P _j23119 Moderate-strength promoter P _j23118 And weak promoter P _j23116 The method comprises the steps of carrying out a first treatment on the surface of the Antisense RNA lengths include 50, 80, 100, 150 and 200nt. Replicons include high copy repliconsColE1, medium-copy replicon p15A, and low-copy replicon pSC101; further, the green fluorescent protein is used as a reporter gene, and a plasmid without antisense RNA is used as a control, so that the promoter strength and the length of the antisense RNA fragment under the condition of three different inhibition efficiencies of strong inhibition, medium inhibition and weak inhibition of the antisense RNA are confirmed.

In yet another embodiment of the present invention, the replicon is ColE1, when the promoter is P _j23119 When the antisense RNA length is 100nt, defined as strong inhibition (+ ++). The promoter is P _j23119 When the antisense RNA length is 80nt, the antisense RNA is defined as moderate inhibition (++); the promoter is P _j23118 When the antisense RNA length is 80nt, it is defined as weakly inhibitory (+).

In the step S4, the 6-phosphofructokinase gene pfkA is strongly inhibited, the glyceraldehyde-3-phosphate dehydrogenase gene gapA is moderately inhibited, and the erythrose-4-phosphate dehydrogenase gene gapB is weakly inhibited.

In still another embodiment of the present invention, the specific method of step S4 includes: amplifying 6-phosphofructokinase gene pfkA with the length of 100nt and containing ribosome binding site by taking E.coli BW25113 genome as a template, amplifying glyceraldehyde-3-phosphate dehydrogenase gene gapA with the length of 80nt, amplifying erythrose-4-phosphate dehydrogenase gene gapB with the length of 80nt, cloning the three antisense RNA fragments into recombinant plasmid pETD-xfspk respectively, placing the recombinant plasmid pETD-xfspk into a stem-loop structural sequence, and setting promoters as P respectively _j23119 ，P _j23119 And P _j23118 Obtaining recombinant plasmid pETD-xfspk-aspfkA-asgapA-asgapB, and transforming the plasmid into mutant strain II to obtain the recombinant bacteria of central metabolic network.

In yet another embodiment of the present invention there is provided the use of a universal platform strain having a high carbon economy central metabolic network as described above for the fermentative production of acetyl-coa derived products.

In yet another embodiment of the present invention, the acetyl-CoA derived products include, but are not limited to, 3-hydroxypropionic acid, mevalonic acid, and polyhydroxybutyric acid.

In yet another embodiment of the present invention, there is provided a method for fermentatively producing an acetyl-coa derived product, the method comprising:

In step S1, competent cells can be prepared by methods conventional in the art, and in one embodiment of the present invention, competent cells are prepared by a calcium chloride method.

In addition, in step S2, the recombinant plasmid may be introduced into the competence by heat shock transformation, which is also a conventional method in the art, and will not be described herein.

In step S3, the initial OD is specifically selected ₆₀₀ An inoculum size of 0.02-0.03 was inoculated into the medium, followed by culturing at 37℃and 180rpm until the fermentation was completed.

Further, the method comprises the steps of,

when the acetyl-CoA derived product is 3-hydroxypropionic acid, the recombinant plasmid in the step S2 may be pRSF-P _j23119 -pta-accADBC-mcrn-mcrc(N940V/K1106W/S1114R)；

When the acetyl-CoA derived product is mevalonate, the recombinant plasmid in the step S2 may be pRSF-P _j23119 -pta-mvaES；

When the acetyl-coa derived product is polyhydroxy butyric acidIn the step S2, the recombinant plasmid may be pRSF-P _j23119 -pta-phaCAB。

The materials, reagents, instruments and methods used in the examples below, without any particular description, are conventional in the art and are commercially available.

The enzyme reagent is purchased from Nanjinofuzan company, beijing TaKaRa company, shanghai Ind, etc., the kit for extracting plasmid and the kit for recovering DNA fragment are purchased from OMEGA company in America, and the corresponding operation steps are carried out according to the product specification; all media were formulated with deionized water unless otherwise indicated.

The formula of the culture medium comprises:

1) Seed liquid shaking flask culture medium

LB medium: 5g/L yeast powder, 10g/L NaCl,10g/L peptone and the balance water, and sterilizing at 121 ℃ for 20 min.

2) Shaking flask culture medium for fermentation production

3HP fermentation medium: 14g/L K ₂ HPO ₄ ·3H ₂ O，5.2g/L KH ₂ PO ₄ ，1g/L NaCl,1g/LNH ₄ Cl，0.25g/L MgSO ₄ ·7H ₂ O,5g/L yeast extract, 20g/L glucose.

MVA and PHB fermentation media: 9.8g/L K ₂ HPO ₄ ·3H ₂ O,2.1g/L citric acid monohydrate, 0.3g/L ferric ammonium citrate, 0.25g/L MgSO ₄ ·7H ₂ O,5g/L beef extract powder, 20g/L glucose, 1000 Xtrace elements (3.7 g/L (NH) ₄ ) ₆ Mo ₇ O ₂₄ ·4H ₂ O，2.9g/L ZnSO ₄ ·7H ₂ O，24.7g/LH ₃ BO ₃ ，2.5g/L CuSO ₄ ·5H ₂ O，15.8g/L MnCl ₂ ·4H ₂ O)。

During the actual culture, antibiotics may be added to the above medium at a concentration to maintain the stability of plasmids such as 100mg/L ampicillin, 50mg/L chloramphenicol and 50mg/L kanamycin.

Example 1: reprogramming of E.coli central metabolism by constructing SCTPK pathway

1. Screening of sedoheptulose-1, 7-bisphosphatase (SBPase) from different host sources

The SBPase/FBPase activity assay was performed as follows, with a reaction system containing 50mM Tris/HCl (pH 8.0), 15mM MgCl ₂ 10mM DTT,10mM E4P,10mM DHAP and purified FbaA and SBPase/FBPase were reacted at 37℃for 30min and stopped by the addition of 0.2M perchloric acid. And centrifuging to obtain supernatant for quantitative analysis of phosphate. 20. Mu.L of the same amount of sample and standard (0-0.5 mM KH ₂ PO ₄ ) With 340. Mu.L of molybdate solution (0.3% ammonium molybdate in 0.55. 0.55M H) ₂ SO ₄ ) Incubate for 10min at room temperature. 60. Mu.L of malachite green solution (0.035% malachite green, 0.35% polyvinyl alcohol) was added, incubated for 45min, and absorbance at 620nm was measured by a microplate reader (Spark, tecan).

The design and construction of the initial SCTPK cycle of E.coli is shown in FIG. 1.SCTPK contains six enzymes, all of which are already present in e.coli, except Xfspk and SBPase. For SBPase Shb17 from Saccharomyces cerevisiae was identified as catalyzing the specific dephosphorylation of sedoheptulose-1, 7-bisphosphate (SBP). Some fructose-1, 6-bisphosphatases (fbpases) having a highly conserved lithium binding domain still have SBPase activity. Thus, the genes of FBPase with this characteristic from Saccharomyces cerevisiae Shb as well as from different bacteria were synthesized and expressed in E.coli BL21 (DE 3) strain, and the corresponding proteins were purified after fusion with His6 tag (FIG. 2). In addition, fructose-1, 6-bisphosphate aldolase FbaA from E.coli was also purified, which catalyzes the condensation of erythrose-4-phosphate (E4P) and dihydroxyacetone phosphate (DHAP) to provide a commercially unavailable SBP for in vitro activity assays of SBPase and Xfspk. As shown in FIG. 3, glpX (SyGlpX, encoded by the slr2094 gene) from Synechocystis sp.PCC6803 exhibited the highest SBPase activity, probably because SBPase activity is used for CO in cyanobacteria ₂ The immobilized Calvin-Benson cycle. Since both SBPase and FBPase activities are required for the construction of SCTPK: SBPase provides the second irreversible driving force for this cycle, while FBPase reduces glycolytic flux and pushes carbon flow into SCTPK. Therefore, the FBP is continuously examinedAs shown in FIG. 4, syGlpX with higher activity was still selected.

2. Phosphorylase activity detection of phosphoketolase Xfspk using X5P, F P and S7P as substrates, respectively

The phosphoketolase activity was detected by the following method, the reaction system contained 50mM Tris/HCl (pH 8.0), 15mM MgCl ₂ ，10mM DTT，5mM KCl，20mM KH ₂ PO ₄ 1mM thiamine pyrophosphate,0.25. Mu.M phosphoketolase and 10mM substrate. For activity at S7P as substrate, 10mM DHAP and E4P and 0.25. Mu.M FbaA and SBPase were added; for the activities of F6P and X5P substrates, 10mM F6P and X5P were added, respectively. The reaction was stopped by adding 25. Mu.L of hydroxylamine reagent. AcP concentration was measured. The AcP assay is as follows, with a volume sample added to 0.5 volumes of hydroxylamine reagent (4M hydroxylamine hydrochloride: 3.5M sodium hydroxide = 1:1, v/v) and held at room temperature for 10min to form hydroxylamine. Thereafter, 1.5 volumes of ferric chloride solution (5% ferric chloride: 12% trichloroacetic acid: 3 mhcl=1:1:1, v/v/v) was added, and the reaction was kept at room temperature for 5 minutes, and absorbance was measured at 540nm using a microplate reader (Spark, tecan).

Using Xfspk from Bifidobacterium longum NCC2705, the enzyme was tested to catalyze the aldehyde cleavage reaction of S7P, F P and X5P to produce AcP. The protein was purified and assayed for in vitro enzymatic activity (FIG. 5). Since the activity of Xfspk is lower than that of SBPase, in the following strain construction, the Xfspk gene is carried by the high copy plasmid pETDuet to increase its expression level, whereas the slr2094 gene of Synechocystis sp.PCC6803 will be in the constitutive promoter P _j23119 Is integrated into the E.coli genome using CRISPR/Cas9 under the control of (E.coli).

3. Assembly and validation of E.coli initial SCTPK cycle

To assemble SCTPK in E.coli, E.coli BW25113 mutant Q3952 was used as the starting strain in which genes related to by-products acetic acid, lactic acid, ethanol and formic acid (poxB, ldhA, adhE, pflB) were deleted to eliminate carbon loss, and the tktAB and talAB genes responsible for carbon rearrangement were knocked out to exclude interference of the NOG pathway (Bogorad IW, linTS, liao JC.synthetic non-oxidative glycolysis enables complete carbon control. Nature 502,693-697 (2013)).

It will be appreciated by those skilled in the art that the above-described gene editing experiments for E.coli BW25113 were performed according to standard molecular cloning techniques.

1. Taking the construction of the pTarget-. DELTA.poxB plasmid for knocking out the poxB gene in E.coli BW25113 as an example, the following was exemplified:

(1) And (5) amplifying a plasmid skeleton. The plasmid pTaregt was used as a template, pTaregtF (5'cctgttatccctactcgag 3') and pTaregtF (5'actagtattatacctaggactgagc 3') were used as primers, and the resulting mixture was amplified using Phanta Flash Master and recovered after DpnI cleavage.

(2) sgRNA-scaffold amplification. Using pTarget plasmid as template and sgRNA_poxBF (5'

cctaggtataatactagttttggcatcggtcgggtagagttttagagctagaaatagca 3 ') and sgRNA_poxBR (5'gtaatagatctaagcttctgc 3 ') as primers, amplified and purified using PrimeSTAR.

(3) Amplifying the left and right homology arms. E.coli BW25113 genome was used as template, prepoxBF (5'

gtattcccgcggcaacacttt 3 ') and prepoxBR (5'agcggtctgaaattcaccaaact 3 ') as primers, amplified and purified by Phanta Flash Master. Using this product as template, poxB_HLF (5 'respectively'

gaagcttagatctattacttaccttagccagtttgttttcgcc 3 ') and poxB_HLR (5'

cggcacgttatctaaaaatgaacgg 3 '), poxB_HRF (5 ' ttttagataacgtgccgtggcagttttaacgc3 ') and poxB_HRR (5'tcgagtagggataacaggccccctccgtcagatgaact 3 ') were used as primers, amplified and purified by Phanta Flash Master to obtain left and right homology arm fragments, respectively.

(4) And recombining the multiple segments in vitro. According to the in vitro multi-fragment recombination kit, the four fragments are recombined, and the reaction product is transformed into E.coli DH5 alpha and is coated with spectinomycin for flat-plate culture. Colony PCR was performed using colonies as templates and pTestF (5'acatgaagcacttcactgac 3') and pTestR (5'ttgacagctagctcagtcctaggtataatac 3') as primers, and Rapid Taq Mix was used to verify that positive colonies were sequenced using the primers pTestF and pTestR and correct preservation was confirmed, thus obtaining plasmid pTarget- ΔpoxB for poxB gene knockout.

Plasmids for gene knockout of ldhA, adhE, pflB, tktAB, talAB and gnd were constructed in a similar manner as above.

Gene editing the sgrnas selected were as follows:

TABLE 1 sgRNA sequences for Gene editing

To verify whether the assembled SCTPK cycle was run in E.coli, the pyruvate dehydrogenase subunit aceE gene, which catalyzes the decarboxylation of pyruvate to acetyl-CoA, was knocked out and the strain showed growth defects in minimal medium after knockdown, which could be restored by exogenous addition of potassium acetate (FIGS. 6a and 6 c). Strains Q3964, obtained by introducing Xfspk and SyGlpX into Q3952 ΔaceE, also recovered from growth defects (FIGS. 6a and 6 c), indicating that acetyl-CoA can be supplemented by constructed SCTPK. Furthermore, the tktAB and taaab genes involved in the carbon rearrangement reaction in strain Q3964 were knocked out, which should lead to exhaustion of ribose-5-phosphate (R5P) if the 6-phosphogluconate dehydrogenase encoding gene gnd is knocked out and the SCTPK cycle is not operated, since R5P is a precursor for nucleotide and histidine synthesis. However, the growth status before and after Q3964 knockout gnd is similar (fig. 6b and 6 c), suggesting that R5P may be produced as an intermediate product of SCTPK, which is further confirmed: even in the presence of potassium acetate, gnd mutants with incomplete SCTPK were unable to grow (fig. 6b and 6 c). The above results indicate that the central metabolic network of E.coli is reconfigured and the SCTPK cycle is successfully assembled and functions to bypass the carbon release process of pyruvate to acetyl-CoA to produce acetyl-CoA.

4. Detection of E.coli related metabolites integrating the initial SCTPK cycle

The content of related metabolites in the strain integrated with SCTPK was detected, and the pyruvic acid was detected and analyzed by High Performance Liquid Chromatography (HPLC) as follows. The chromatographic detection conditions are as follows: the organic acid column model is Amin HPX-87H column (Bio-Rad, hercules, calif., USA), the ultraviolet detection wavelength is 210nm, the temperature of the column temperature box is 40 ℃, the liquid inlet amount is 10 mu L, the flow rate is 0.6mL/min, and the mobile phase is 5mmol/L dilute sulfuric acid. The samples were diluted to the appropriate fold and subjected to membrane filtration treatment of 0.22 μm.

The assay showed that the concentration of acetophosphoric acid was 1.79-fold higher than that of the wild-type strain (FIG. 7 a). In strain Q3952 Δacee, intracellular pyruvate concentration was 2.34-fold higher than that of the wild-type strain (fig. 7 b), strain Q3964 obtained by over-expressing Xfspk and SyGlpX had significantly reduced pyruvate concentration but still higher than that of the wild-type strain (fig. 7 b). These results indicate that further optimization is required to continue pulling carbon flux into the SCTPK to increase carbon production.

Example 2: optimization of the SCTPK pathway to increase AcP yield

1. The effect of different biological elements on the antisense RNA inhibition efficiency was screened and determined.

In strains that integrate SCTPK, some competing metabolic pathway enzymes may shunt SCTPK, resulting in carbon loss (fig. 8). Wherein PfkA catalyzes the reaction of F6P to FBP and S7P to SBP, both of which are reverse reactions of SBPase; gapA allows the production of glycerol 1, 3-diphosphate (BPG), which enters glycolysis to produce pyruvate; gapB converts E4P to 4-phospho-D-erythrose (4 PE), an inhibitor of the R5P isomerase (Rpi) involved in SCTPK. It is therefore contemplated that antisense RNA (asRNA) interference could attenuate the expression of these genes.

The factors of antisense RNA on gene inhibition efficiency were explored, and different promoters were selected (P _j23116 、P _j23118 、P _j23119 ) The effect of asRNA inhibition was verified by the target sequence length (0, 50,80, 100, 150, 200 nt) and the different copy number replicons (ColE 1, p15A and SC 101). The results indicate that the length and transcript levels of the asrnas synergistically determine the efficiency of asRNA silencing (fig. 9). Setting the replicon to ColE1 when the promoter is P _j23119 When the asRNA length is 100nt, the asRNA is defined as strong inhibition; the promoter is P _j23119 At an asRNA length of 80nt, defined as moderate inhibition; the promoter is P _j23118 When the asRNA length is 80nt, it is defined as weak inhibition. Thereafter, first of all the promoter P is used _j23119 Purpose of single inhibition of transcribed 100nt asRNAGenes pfkA, gapA and gapB, and the AcP content was examined. As shown in FIG. 10a, when the expression of pfkA gene was inhibited, the concentration of AcP was 2.23-fold and 1.24-fold higher than that of the wild-type strain and Q3964, respectively. However, a strong degree of inhibition of asRNAs against gapA and gapB greatly reduced the content of AcP and the final cell density and specific growth rate (fig. 10 b). The transcript levels of strains strongly inhibiting gapA, gapB and pkfA were examined. And extracting RNA from each proper amount of bacterial liquid by using an EASYspin Plus bacterial RNA rapid extraction kit (Beijing Aidelai, cat#RN4302). Reverse transcription was performed using Evo M-MLvf reverse transcription kit II (Beijing Edley, cat#AG 11711-S), followed by RT-PCR assay using specific primers using SYBR Green Pro Taq HS premix qPCR kit (Beijing Edley, cat#AG 11701). The primers used for gapA are RTgapAF (5'TTTGGCCGTATCGGTCGCATTG 3') and RTgapAR (5'AGCGTCTAACAGGTCGTTGATTGC 3'); primers used for pkfA were RTpkfAF (5'ATTCGCGGGGTTGTTCGTTCTG 3') and RTpkfAR (5'ATCATGTCAGACACGCTGTAACGG 3'); the primers used for gapB were RTgapBF (5'GGAAATTACCGTGGTGGCAATCAAC 3') and RTgapBR (5'GCGTTCCTGTCGTACTTCCCATG 3'). In the strains with the corresponding asRNAs, the transcript levels of gapA, gapB and pkfA were reduced to 4.9%, 6.7% and 27.2%, respectively, of the control strain without the asRNA sequence (fig. 11). These results indicate that strong inhibition of gapA and gapB expression severely impairs cell growth, probably due to their irreplaceable role in glycolysis and vitamin B6 synthesis.

2. Combined asRNA array optimization of SCTPK cycle

First, a combination regulatory strain (80 nt asRNA together with P, respectively) was constructed which strongly inhibited pfkA and moderately or weakly inhibited gapB _j23119 Or P _j23118 A promoter). Phenotypic assays showed that weak inhibition of gapB gene increased intracellular AcP concentration 2.45 fold compared to wild type strain despite a slight decrease in final cell density and growth rate (fig. 12). Followed by the introduction of a moderate or weak inhibition module that mediates gapA: the moderate inhibition of gapA increased the AcP concentration to the highest level, 2.83 times that of the wild-type strain, and did not have a severe effect on strain growth (FIG. 12). The strain Q4531 strongly inhibited pfkA, moderately inhibited gapA and weakly inhibited gapB. As a means ofCompared with the prior art, the strain with three genes inhibited by medium strength has relatively poor performance in the aspects of AcP production and cell growth, which shows that the hierarchical regulation and control system of different genes is beneficial to improving the carbon yield of SCTPK.

3. Coli-associated phenotype detection of SCTPK cycle after integration optimization

CO from wild E.coli BW25113 and Q4531 strains ₂ The amount of release was measured. To detect CO ₂ Is carried out using a gas analysis system (BCP-CO) ₂ Bluesense, germany) to record and analyze the real-time changes in carbon dioxide in shake flasks during culture. Cultures were grown at 37℃and 180rpm. The detector monitors CO every 1min ₂ And transmits the information to the computer. The results show CO ₂ The release rate was significantly changed during the culture, the maximum CO of the Q4531 strain ₂ The release rate was 4.20mL/h, less than one third of the BW25113 strain (FIG. 13 a). CO of the Q4531 strain compared with wild E.coli ₂ The total release was reduced to 47.4% (fig. 13 b). Furthermore, the pyruvate concentration of the Q4531 strain was significantly reduced relative to the wild-type strain and Q3964 (fig. 14 a), indicating that the metabolic flux was more shifted to SCTPK after fractionation of the key target genes pfkA, gapA and gapB with the combined asRNA array. The detection of the acetic acid content produced by Q4531 was continued. The acetic acid detection method is as follows, and acetic acid is detected and analyzed by High Performance Liquid Chromatography (HPLC). The chromatographic detection conditions are as follows: the organic acid column model is Amin HPX-87H column (Bio-Rad, hercules, calif., USA), the ultraviolet detection wavelength is 210nm, the temperature of the column temperature box is 40 ℃, the liquid inlet amount is 10 mu L, the flow rate is 0.6mL/min, and the mobile phase is 5mmol/L dilute sulfuric acid. The samples were diluted to the appropriate fold and subjected to membrane filtration treatment of 0.22 μm. Strain Q4531 exhibited acetate accumulation capacity of only 11% of the wild-type strain (fig. 14 b). Thus, the combined asRNA array further pulls the carbon flux of the competitive metabolic pathway into the SCTPK designed by the invention, enhances the production of AcP and inhibits CO ₂ And the release of by-products and the accumulation of by-products, thereby improving the economy of carbon atoms.

Example 3: biosynthesis of acetyl-CoA derived products

This example illustrates the synthesis experiments of three important acetyl-CoA derived products 3-hydroxypropionic acid (3 HP), mevalonic acid (MVA) and Polyhydroxybutyrate (PHB) to demonstrate the versatility of the platform strain of the present invention in the biosynthesis of acetyl-CoA derived products.

1. Biosynthesis detection of 3HP

1. Construction of 3HP synthetic strains

Preparation of competent wild-type control Strain E.coli BW25113 and acetyl-CoA derived product Universal platform Strain Q4531 constructed in example 2 according to the procedure of Sangon competent preparation kit recombinant plasmid pRSF-P of the 3HP synthetic pathway of acetyl-CoA derived product _j23119 The pta-accADBC-mcrn-mcrc (N940V/K1106W/S1114R) (plasmid construction method is referred to Cao Y, et al improved phloroglucinol production by metabolically engineered Escherichia coll.Appl Microb Biotechnol 2011,91 (6): 1545-1552) was transformed by heat shock method into competent cells of wild-type control strain and the platform strain of the present invention, respectively, to obtain 3HP synthetic strain E.coll BW25113/pRSF-P _j23119 -pta-accADBC-mcrn-mcrc (N940V/K1106W/S1114R) and Q4531/pRSF-P _j23119 -pta-accADBC-mcrn-mcrc(N940V/K1106W/S1114R)。

2. Establishment of 3HP detection method

1) Fermentation of 3HP was detected by High Performance Liquid Chromatography (HPLC). 10000g of fermentation broth is centrifuged for 10min at 4 ℃, the product is filtered by a 0.22 μm water filter membrane and detected by HPLC, and the concentration of 3HP is calculated according to a standard curve.

2) The HPLC detection system is as follows: adopts Agilent 1200 system, adopts HPX-87H column (300 mm×7.8mm) as detection column, ultraviolet detects 210nm absorption peak, flow rate is 0.4mL/min, and mobile phase is 0.5mM H ₂ SO ₄ The detection temperature was 60 ℃.

3) And (3) standard curve preparation: 10g/L of 3HP pure solution was prepared, properly diluted to 0.05g/L,0.1g/L,0.5g/L,1.0g/L,2.0g/L and 5.0g/L, HPLC analysis was performed, the measured peak areas were linearly fitted to the known concentrations, and a standard curve was drawn.

3. Fermentation experiment of 3HP

In this embodiment, two experiments were performed to illustrate the beneficial effects that can be obtained by the present invention, and the specific experiments are as follows:

control strain Q4607: e.coli BW25113/pRSF-P _j23119 -pta-accADBC-mcrn-mcrc(N940V/K1106W/S1114R)

Experimental Strain Q4608: Q4531/pRSF-P _j23119 -pta-accADBC-mcrn-mcrc(N940V/K1106W/S1114R)。

1) The activated control strain and experimental strain were set at the initial OD ₆₀₀ 0.02-0.03 was inoculated into a 250mL shake flask (50 mg/L kanamycin) containing 50mL of 3HP fermentation medium, and shake-cultured at 37℃and 180rpm until the fermentation was completed.

2) 1mL of the fermentation broth was centrifuged at 12000rpm at 4℃for 10min, and the supernatant was subjected to HPLC detection, and the concentration of 3HP was calculated according to a standard curve.

3) According to the procedure of this example, the recombinant plasmid pRSF-P was synthesized in a cell containing the same 3HP synthesis pathway _j23119 pta-accADBC-mcrn-mcrc (N940V/K1106W/S1114R, shake flask level), 3HP yield of the control strain of 0.933g/L, yield of 0.087g/g, 3HP yield of the experimental strain of 1.750g/L, yield of 0.227g/g. This shows that under the same 3HP synthesis pathway conditions, the yield and yield of acetyl-CoA derived product 3HP of the platform strain provided by the invention are improved by 1.87 and 2.61 times, respectively, compared to the wild host strain E.coli BW25113 (FIG. 15 a).

2. Biosynthesis detection of MVA

1. Construction of MVA synthetic strains

Preparation of competent wild-type control Strain E.coli BW25113 and acetyl-CoA derived product Universal platform Strain Q4531 constructed in example 2 according to the procedure of Sangon competent preparation kit recombinant plasmid pRSF-P of the 3HP synthetic pathway of acetyl-CoA derived product _j23119 Pta-mvae (plasmid construction methods are described in Cao Y, et al improved phloroglucinol production by metabolically engineered Escherichia coll. Appl Microb Biotechnol 2011,91 (6): 1545-1552.). The strain E is obtained by transforming competent cells of the wild type control strain and the platform strain of the invention respectively by a heat shock method .coli BW25113/pRSF-P _j23119 Pta-mvae and Q4531/pRSF-P _j23119 -pta-mvaES。

2. Establishment of MVA detection method

1) Fermentation of MVA was detected by High Performance Liquid Chromatography (HPLC). 10000g of fermentation broth is centrifuged for 10min at 4 ℃, filtered by a 0.22 mu m water filter membrane, and the product is detected by HPLC, and the MVA concentration is calculated according to a standard curve.

2) The HPLC detection system is as follows: adopts Agilent 1200 system, adopts HPX-87H column (300 mm×7.8mm) as detection column, ultraviolet detects 210nm absorption peak, flow rate is 0.5mL/min, and mobile phase is 5mM H ₂ SO ₄ The detection temperature was 60 ℃.

3) And (3) standard curve preparation: 10g/L of MVA pure substance solution is prepared, and is diluted to 0.05g/L,0.1g/L,0.5g/L,1.0g/L,2.0g/L and 5.0g/L appropriately, HPLC analysis is carried out, the measured peak area is linearly fitted with the known concentration, and a standard curve is drawn.

3. Fermentation experiments of MVA

control strain: e.coli BW25113/pRSF-P _j23119 -pta-mvaES

Experimental strains: Q4531/pRSF-P _j23119 -pta-mvaES。

1) The activated control strain and experimental strain were set at the initial OD ₆₀₀ 0.02-0.03 was inoculated into 250mL shake flasks (50 mg/L kanamycin) containing 50mL of MVA fermentation medium, and shake-cultured at 37℃and 180rpm until the fermentation was completed.

2) 1mL of the fermentation broth was centrifuged at 12000rpm at 4℃for 10min, and the supernatant was subjected to HPLC detection, and the MVA concentration was calculated according to a standard curve.

3) According to the procedure of this example, the recombinant plasmid pRSF-P was synthesized in a cell containing the same MVA synthesis pathway _j23119 Pta-mvae, shake flask level, MVA yield of control strain of 0.78g/L, yield of about 0.1g/g, MVA yield of experimental strain of 1.25g/L, yield of 0.229g/g. Thus, it was shown that under the same MVA synthesis pathway-containing conditions,the yield and the yield of the MVA of the acetyl-CoA derivative product of the platform strain provided by the invention are respectively improved by 1.6 times and 2.29 times compared with the yield of the MVA of the wild host strain E.coli BW25113 (figure 15 b).

3. Biosynthesis detection of PHB

1. Construction of PHB synthetic Strain

Preparation of competent wild-type control Strain E.coli BW25113 and acetyl-CoA derived product Universal platform Strain Q4531 constructed in example 2 according to the procedure of Sangon competent preparation kit recombinant plasmid pRSF-P of the 3HP synthetic pathway of acetyl-CoA derived product _j23119 pta-phaCAB (plasmid construction method is described in Cao Y, et al improved phloroglucinol production by metabolically engineered Escherichia coll. Appl Microb Biotechnol 2011,91 (6): 1545-1552.). The strain E.coli BW25113/pRSF-P is obtained by transforming competent cells of the wild type control strain and the platform strain of the invention respectively by a heat shock method _j23119 -pta-phaCAB and Q4531pRSF-P _j23119 -pta-phaCAB。

2. Establishment of PHB detection method

PHB detection method referring to Mohammadi, et al, efficiency polyhydroxyalkanoate recovery from recombinant Cupriavidus necator by using low concentration of NaOH. Method is as follows: the fermentation broth was centrifuged at 12000rpm at 4℃for 10min. The supernatant is removed and the cells are separated from the fermentation broth. The cell pellet was washed twice with distilled water and lyophilized. 20mL of 0.05M NaOH solution was used for 3h, and then centrifuged at 15000rpm at 4℃for 20min. The supernatant was removed and the cells were separated from the solution. The cell pellet was washed twice with pre-chilled ethanol (95%, analytical grade) and freeze-dried, and the dried powder was weighed.

3. Fermentation experiment of PHB

control strain: e.coli BW25113/pRSF-P _j23119 -pta-phaCAB

Experimental strains: Q4531/pRSF-P _j23119 -pta-phaCAB

1) The activated control strain and experimental strain were set at the initial OD ₆₀₀ 0.02-0.03 was inoculated into 250mL shake flasks (50 mg/L kanamycin) containing 50mL PHB fermentation medium, and shake-cultured at 37℃and 180rpm until fermentation was completed.

2) The dried powder was weighed according to the PHB detection method described above and the PHB concentration was calculated.

3) According to the procedure of this example, the recombinant plasmid pRSF-P was synthesized in a cell containing the same MVA synthesis pathway _j23119 The PHB yield of the control strain was 0.417g/L, the yield was about 0.089g/g glucose, the PHB content was 20.16% of the dry cell weight, the PHB yield of the experimental strain was 1g/L, the yield was 0.183g/g glucose, and the PHB content was 48.9% of the dry cell weight. Therefore, under the condition of containing the same PHB synthesis pathway, the yield and the yield of the PHB of the acetyl-CoA derived product of the platform strain provided by the invention are respectively improved by 2.4 times and 2.06 times compared with the wild host strain E.coli BW25113 (figure 15 c).

The invention takes three important biological synthesis examples of acetyl-CoA derivative products, namely 3-hydroxy propionic acid, mevalonic acid and polyhydroxybutyric acid, to illustrate the universality of the platform strain with high-carbon atom economic center metabolic network, but the platform strain is not limited to the application of the three acetyl-CoA derivative products, but is applied to the biological synthesis of all acetyl-CoA derivative products.

The above embodiments are provided to illustrate the technical concept and features of the present invention and are intended to enable those skilled in the art to understand the content of the present invention and implement the same, and are not intended to limit the scope of the present invention. All equivalent changes or modifications made in accordance with the spirit of the present invention should be construed to be included in the scope of the present invention.

Claims

1. The universal platform strain is characterized in that escherichia coli is taken as an initial strain, and a pyruvate formate lyase gene pflB, a lactate dehydrogenase gene ldhA, an alcohol dehydrogenase gene adhE, a pyruvate oxidase gene poxB, a pyruvate dehydrogenase gene aceE, a transketolase gene tktAB and a transaldolase gene talAB are knocked out; overexpression of the phosphoketolase gene xfspk, sedoheptulose-1, 7-bisphosphatase gene slr2094; and inhibiting 6-phosphofructokinase gene pfkA, glyceraldehyde-3-phosphate dehydrogenase gene gapA and erythrose-4-phosphate dehydrogenase gene gapB.

2. The universal platform strain according to claim 1, wherein the Escherichia coli is in particular Escherichia coli (Escherichia coli) BW25113.

3. The universal platform strain of claim 1, wherein GenBank accession of the pyruvate formate lyase gene pflB is AIN31371.1; genBank accession of the lactate dehydrogenase gene ldhA is AIN31834.1; genBank accession of the alcohol dehydrogenase gene adhE is AIN31697.1; genBank accession of the pyruvate oxidase gene poxB is AIN31340.1; genBank accession of the pyruvate dehydrogenase gene aceE is AIN30644.1; genBank accession of transketolase gene tktA is AIN33296.1; genBank accession of transketolase gene tktB is AIN32864.1; genBank accession of the transaldolase gene talA is AIN32863.1; genBank accession of the transaldolase gene talB is AIN30546.1; genBank accession of the phosphoketolase gene xfspk is AAN24771.1; genBank accession of the sedoheptulose-1, 7-bisphosphatase gene slr2094 is P73922.1; genBank accession of the phosphofructokinase 6 gene pfkA is AIN34215.1; genBank accession of the glyceraldehyde-3-phosphate dehydrogenase gene gapA is AIN32216.1; genBank accession of the erythrose-4-phosphate dehydrogenase gene gapB is AIN33289.1;

4. A method of constructing a universal platform strain having a high carbon economy center metabolic network according to any one of claims 1 to 3, comprising:

5. The method according to claim 4, wherein in the step S1, the E.coli BW25113; the knockout adopts CRISPR/Cas9 technology;

specifically, the method of step S1 includes: the sgRNA sequence of the target gene is designed, and the CRISPR/Cas9 is utilized to knock out pyruvate formate lyase gene pflB, lactate dehydrogenase gene ldhA, alcohol dehydrogenase gene adhE, pyruvate oxidase gene poxB, pyruvate dehydrogenase gene aceE, transketolase gene tktAB and transaldolase gene talAB on the genome of the escherichia coli BW25113 of the original strain respectively, so as to obtain a mutant strain I, which is named as Q3952 (E.coli BW25113 delta pflB delta ldhA delta adhE delta poxB delta aceE delta tktAB delta talAB).

6. The method of construction according to claim 4, wherein in step S2, the host comprises Bacillus methanolicus, saccharomyces cerevisiae cen.pk, e.coli BW25113, serratia marcescens, synchocystis sp.pcc 6803 and Thermosynechococcus elongatus; further preferred is Synechocystis sp.pcc 6803;

specifically, the method of step S2 includes: the highest enzyme activity sedoheptulose-1, 7-bisphosphatase gene slr2094 from Synechocystissp.PCC 6803 is inserted into the genome of mutant strain I by CRISPR/Cas9, and the promoter can be P _j23119 Cloning of the gene xfspk derived from Bifidobacterium longum NCC2705 into the vector pETDuet-1, the promoter may be P _phlf The recombinant plasmid pETD-xfspk was obtained, and the plasmid was further transformed into a mutant strain inserted into slr2094 to obtain mutant strain II.

7. The method of construction according to claim 4, wherein in step S3, the promoter comprises a strong promoter P _j23119 Moderate-strength promoter P _j23118 And weak promoter P _j23116 The method comprises the steps of carrying out a first treatment on the surface of the Antisense RNA lengths include 50, 80, 100, 150 and 200nt; replicons include high-copy replicon ColE1, medium-copy replicon p15A, and low-copy replicon pSC101; further, the green fluorescent protein is used as a reporter gene, and a plasmid without antisense RNA is used as a control, so that the promoter strength and the length of the antisense RNA fragment under the conditions of three different inhibition efficiencies of strong inhibition, medium inhibition and weak inhibition of the antisense RNA are confirmed;

Further, the replicon was set to ColE1 when the promoter was P _j23119 When the antisense RNA length is 100nt, the antisense RNA is defined as strong inhibition; the promoter is P _j23119 When the antisense RNA length is 80nt, the inhibition is defined as medium-intensity inhibition; the promoter is P _j23118 Antisense RNA length 80nt, defined as weak inhibition.

8. The construction method according to claim 4, wherein in the step S4, strong inhibition is performed on the 6-phosphofructokinase gene pfkA, medium-intensity inhibition is performed on the glyceraldehyde-3-phosphate dehydrogenase gene gapA, and weak inhibition is performed on the erythrose-4-phosphate dehydrogenase gene gapB;

further, the specific method of step S4 includes: amplifying 6-phosphofructokinase gene pfkA with the length of 100nt and containing ribosome binding site by taking E.coli BW25113 genome as a template, amplifying glyceraldehyde-3-phosphate dehydrogenase gene gapA with the length of 80nt, amplifying erythrose-4-phosphate dehydrogenase gene gapB with the length of 80nt, cloning the three antisense RNA fragments into recombinant plasmid pETD-xfspk respectively, placing the recombinant plasmid pETD-xfspk into a stem-loop structural sequence, and setting promoters as P respectively _j23119 ，P _j23119 And P _j23118 Obtaining recombinant plasmid pETD-xfspk-aspfkA-asgapA-asgapB, and transforming the plasmid into mutant strain II to obtain the recombinant bacteria of central metabolic network.

9. Use of a universal platform strain having a high carbon economy center metabolic network according to any one of claims 1 to 3 for the fermentative production of acetyl-coa derived products;

wherein the acetyl-CoA derived products include 3-hydroxypropionic acid, mevalonic acid, and polyhydroxybutyric acid.

10. A method of fermentatively producing an acetyl-coa derived product, the method comprising:

s1, activating the universal platform strain according to any one of claims 1-3, and inoculating the activated universal platform strain into an antibiotic-free LB culture medium to prepare competent cells;

s3, inoculating the recombinant bacteria obtained in the step S2 into a liquid culture medium containing antibiotics for fermentation culture, and separating and extracting to obtain the acetyl coenzyme A derivative product;

further, the method comprises the steps of,

when the acetyl-CoA derived product is 3-hydroxypropionic acid, the recombinant plasmid in the step S2 is pRSF-P _j23119 -pta-accADBC-mcrn-mcrc(N940V/K1106W/S1114R)；

When the acetyl-CoA derived product is mevalonate, the recombinant plasmid in the step S2 is pRSF-P _j23119 -pta-mvaES；

When the acetyl-CoA derived product is polyhydroxybutyrate, the recombinant plasmid in step S2 is pRSF-P _j23119 -pta-phaCAB。