CN116783288A

CN116783288A - Genetically modified natural killer cells for CD70 directed cancer immunotherapy

Info

Publication number: CN116783288A
Application number: CN202180055753.0A
Authority: CN
Inventors: J·B·特雷格; A·L·L·拉泽蒂克; I·陈; C·郭; K·詹博雷茨
Original assignee: Nkarta Inc
Current assignee: Nkarta Inc
Priority date: 2020-06-12
Filing date: 2021-06-10
Publication date: 2023-09-19

Abstract

Several embodiments of the methods and compositions disclosed herein relate to immune cells engineered to express Chimeric Antigen Receptors (CARs) and/or genetically modified to reduce potential side effects of cellular immunotherapy. Several embodiments relate to genetic modification of the immune cells, such as Natural Killer (NK) cells, to reduce, significantly reduce or eliminate expression of a marker effected by the immune cells, which would otherwise result in its self-targeting by the CAR. In several embodiments, the CAR targets CD70, and in some embodiments is used for renal cell carcinoma immunotherapy.

Description

Genetically modified natural killer cells for CD70 directed cancer immunotherapy

Cross Reference to Related Applications

The present application claims priority from U.S. provisional patent application No. 63/038,645, filed on 12 months 6 and 2020, U.S. provisional patent application No. 63/090,041, filed on 25 months 1 and 2021, and U.S. provisional patent application No. 63/141,411, and filed on 30 months 4 and 2021, each of which is incorporated herein by reference in its entirety.

Technical Field

Several embodiments disclosed herein relate to methods and compositions comprising genetically engineered cells for cancer immunotherapy, particularly cells engineered to have reduced expression of specific markers also present on target cells. In several embodiments, the disclosure relates to cells engineered to express chimeric antigen receptors and having reduced expression of one or more markers that enhance efficacy and/or reduce potential side effects when the cells are used in cancer immunotherapy.

Background

With further insight into the various cancers and which features the cancer cells possess to use to distinguish them clearly from healthy cells, therapeutic agents are being developed that take advantage of the unique features of cancer cells. Immunotherapy using engineered immune cells is a method of treating cancer.

Incorporating material by reference in the form of ASCII text files

The present application incorporates by reference the sequence listing contained in the following simultaneously filed ASCII text file: file name: nkt.056wo_st25.txt; created at 2021, 6 and 10 days and sized 1,550,527 bytes.

Disclosure of Invention

Immunotherapy represents a new technological advance in the treatment of diseases, in which immune cells are engineered to express specific targeting and/or effector molecules that specifically recognize and react with diseased or damaged cells. This represents a promising advance, due at least in part to the potential for specific targeting of diseased or damaged cells, in contrast to more traditional methods (such as chemotherapy, where all cells are affected and the desired outcome is sufficient healthy cell survival to allow patient survival). One method of immunotherapy is to recombinantly express chimeric receptors in immune cells to achieve targeted recognition and destruction of abnormal cells of interest.

In some cases, the population of immune cells used for immunotherapy may express one or more endogenous markers that overlap in scope with those expressed by the population of tumor cells. Targeting such common markers may limit the efficacy of therapeutic cells to the extent that therapeutic cells target both the tumor population and other members of the therapeutic cell population. Thus, in several embodiments, a population of genetically engineered immune cells, such as Natural Killer (NK) cells, T cells, or a combination thereof, for use in cancer immunotherapy is provided, the population comprising a plurality of immune cells that have been expanded in culture, wherein the plurality of immune cells are engineered to express a Chimeric Antigen Receptor (CAR) comprising a tumor binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the tumor binding domain targets CD70, wherein the immune cells are genetically edited to express reduced levels of CD70 as compared to unedited immune cells that have been expanded in culture, and wherein the reduced CD70 expression is engineered by editing an endogenous CD70 gene.

In several embodiments, the cells are genetically edited to express reduced levels of a cytokine-inducible SH 2-Containing (CIS) protein encoded by a CISH gene as compared to unedited cells. In several embodiments, the reduced (e.g., reduced, eliminated, or otherwise undetectable) CIS expression is achieved by editing the CISH gene. Such editing imparts one or more of enhanced expansion capacity, enhanced cytotoxicity to target cells, and enhanced persistence to the edited cells as compared to cells expressing native levels of CIS. In several embodiments, the cells are subjected to additional editing, such as editing, to produce reduced expression levels of the adenosine receptor. In several embodiments, the reduced adenosine receptor expression is achieved by editing one or more genes encoding the adenosine receptor, which results in one or more of enhanced expansion capacity, enhanced cytotoxicity to target cells, and enhanced persistence as compared to cells expressing native levels of the adenosine receptor. In several embodiments, the editing and engineering of the cell works together because the polynucleotide encoding the CAR is inserted into the edited gene. However, in several embodiments, the editing site does not comprise a polynucleotide encoding the CAR.

In several embodiments, the tumor binding domain of the CAR comprises a heavy chain variable region (VH), wherein the VH is encoded by a polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 1104, 1053, 1091, 1047, 1106, 1052, 1077, 1064, 1098, and 1088. In several embodiments, the tumor binding domain of the CAR comprises a light chain variable region (VL), wherein the VL is encoded by a polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 1178, 1127, 1165, 1121, 1180, 1126, 1151, 1138, 1171, and 1162. In several embodiments, the tumor binding domain comprises a single chain variable fragment (scFv), wherein said scFv is encoded by a polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90% or at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 104, 53, 91, 47, 106, 52, 77, 64, 98 and 88.

In several embodiments, the tumor binding domain comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3, and wherein the CDR-H1 comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 494, 443, 481, 437, 496, 442, 467, 454, 488, and 478; the CDR-H2 comprises a sequence having at least 80%, at least 85%, at least 90% or at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 568, 517, 555, 511, 570, 516, 541, 528, 562 and 552; the CDR-H3 comprises a sequence having at least 80%, at least 85%, at least 90% or at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 642, 591, 629, 585, 644, 590, 615, 602, 636 and 626; the CDR-L1 comprises a sequence having at least 80%, at least 85%, at least 90% or at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 734, 683, 721, 677, 736, 682, 707, 694, 728, and 718; the CDR-L2 comprises a sequence having at least 80%, at least 85%, at least 90% or at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 808, 757, 795, 751, 810, 756, 781, 768, 802 and 792; and the CDR-L3 comprises a sequence having at least 80%, at least 85%, at least 90% or at least 95% sequence identity to one or more sequences selected from 882, 831, 869, 825, 884, 830, 855, 842, 876 and 855.

In several embodiments, the tumor binding domain comprises a VH, wherein the VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 956, 905, 943, 899, 958, 904, 929, 916, 950, and 940. In several embodiments, the tumor binding domain comprises a VL, wherein the VL comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOS 1030, 979, 1017, 973, 1032, 978, 1003, 990, 1024, and 1014.

In several embodiments, the tumor binding domain comprises an scFv, wherein the scFv comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 296, 245, 283, 239, 298, 244, 269, 256, 290, 280.

In several embodiments, the immune cells are engineered to express membrane-bound IL-15 (mbIL 15). In several embodiments, the mbIL15 is bicistronic encoded on a polynucleotide encoding the CAR. In several embodiments, the polynucleotides encoding the CAR and the mbiL15 comprise sequences having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 204, 153, 191, 147, 206, 152, 177, 164, 198, and 188. In several embodiments, the CAR comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 379, 328, 366, 322, 381, 327, 352, 339, 373, and 363. In several embodiments, the mbIL15 is encoded by a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID No. 1188.

In several embodiments, the cytotoxic signaling complex comprises an OX-40 subdomain and a CD3 zeta subdomain. In several embodiments, the OX40 subdomain is encoded by a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO. 5. In several embodiments, the CD3ζ subdomain is encoded by a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO. 7.

In several embodiments, expression of CIS achieved by the edited cells is significantly reduced compared to cells that have not been edited for CISH. In several embodiments, the edited cell does not express a detectable level of CIS protein. In several embodiments, the expression of the adenosine receptor is significantly reduced compared to cells not edited for the adenosine receptor. In several embodiments, the edited cell does not express detectable levels of adenosine receptors. In several embodiments, the edited adenosine receptor comprises one or more of an A2A adenosine receptor, an A2B adenosine receptor, an A3 adenosine receptor, or an A1 adenosine receptor. In several embodiments, the edited adenosine receptor comprises an A2A adenosine receptor (A2 AR). In several embodiments, the cells are further genetically edited to express reduced levels of Transforming Growth Factor Beta Receptor (TGFBR), beta-2 microglobulin (B2M), CIITA (class II major histocompatibility complex transactivator), natural killer group 2 member a (NKG 2A) receptor, cbbl proto-oncogene B protein encoded by the CBLB gene, triple motif-containing protein 29 protein encoded by the TRIM29 gene, and cytokine signaling inhibitor 2 protein encoded by the SOCS2 gene, as compared to unedited NK cells. In several embodiments, gene editing for reduced expression or gene editing for induced expression is performed using a CRISPR-Cas system. In several embodiments, the CRISPR-Cas system comprises Cas selected from Cas9, csn2, cas4, cpf1, C2C3, cas13a, cas13b, cas13C, casX, casY, and combinations thereof. In one embodiment, the Cas is Cas9 (optionally reduced activity Cas 9).

In several embodiments, the Cas is directed to the CD70 gene by one or more guide RNAs that have at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID No. 121, SEQ ID No. 122, or SEQ ID No. 123. In several embodiments, the Cas is directed to the CISH gene by one or more guide RNAs that have at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID No. 130, SEQ ID No. 131, SEQ ID No. 132, SEQ ID No. 133, or SEQ ID No. 134. In several embodiments, the Cas is directed to the adenosine receptor gene by one or more guide RNAs that have at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID No. 396, SEQ ID No. 397, or SEQ ID No. 398. In several embodiments, the Cas is directed to the TGFBR2 gene by one or more guide RNAs that have at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID No. 130, SEQ ID No. 131, SEQ ID No. 132, SEQ ID No. 133, or SEQ ID No. 134.

In several embodiments, zinc Finger Nucleases (ZFNs) are used for gene editing to reduce expression or for gene editing to induce expression. In alternative embodiments, gene editing for reduced expression or gene editing for induced expression is performed using a transcription activator-like effector nuclease (TALEN).

In several embodiments, the engineered and edited immune cells comprise NK cells. In several embodiments, the engineered and edited immune cells consist of or consist essentially of NK cells.

In several embodiments, provided herein are methods of treating cancer in a subject, the methods comprising administering to the subject a population of genetically engineered and edited immune cells (e.g., NK cells) as provided herein. In several embodiments, the cancer is renal cell carcinoma or metastasis of renal cell carcinoma. Also provided herein is the use of genetically engineered and edited immune cells (e.g., NK cells) as provided herein in the treatment of cancer. Further provided is the use of genetically engineered and edited immune cells (e.g., NK cells) as provided herein in the manufacture of a medicament for the treatment of cancer.

Further provided herein are methods for treating cancer in a subject, the methods comprising administering to the subject a population of genetically engineered immune cells, the population comprising a plurality of immune cells (e.g., NK cells, T cells, or a combination thereof) that have been expanded in culture, wherein the plurality of NK cells are engineered to express a Chimeric Antigen Receptor (CAR) comprising a tumor binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the tumor binding domain targets CD70, and wherein the cells are genetically edited to express reduced levels of CD70 as compared to unedited cells that have been expanded in culture, and wherein the reduced CD70 expression is engineered by editing an endogenous CD70 gene.

In several embodiments, the cells are further genetically edited to express reduced levels of a cytokine-induced SH 2-Containing (CIS) protein encoded by a CISH gene as compared to unedited cells, wherein the reduced CIS expression is engineered by editing of the CISH gene, and wherein the genetically edited cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target cells, and enhanced persistence as compared to cells expressing native levels of CIS. In several embodiments, the cell is further subjected to gene editing to express reduced expression of an adenosine receptor, wherein the reduced adenosine receptor expression is achieved by editing a gene encoding the adenosine receptor, and wherein the gene-edited cell exhibits one or more of enhanced expansion capacity, enhanced cytotoxicity to a target cell, enhanced persistence as compared to a cell expressing a native level of the adenosine receptor.

In several embodiments, the tumor binding domain comprises a heavy chain variable region (VH), wherein the VH is encoded by a polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 1104, 1053, 1091, 1047, 1106, 1052, 1077, 1064, 1098, and 1088, and wherein the tumor binding domain comprises a light chain variable region (VL), wherein the VL is encoded by a polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 1188, 1127, 1165, 1121, 1120, 1126, 1151, 1138, 1171, and 1162.

In several embodiments of these methods, the tumor binding domain comprises a single chain variable fragment (scFv), wherein the scFv is encoded by a polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 104, 53, 91, 47, 106, 52, 77, 64, 98, and 88. In several embodiments of these methods, the tumor binding domain comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3, and wherein the CDR-H1 comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 494, 443, 481, 437, 496, 442, 467, 454, 488, and 478; the CDR-H2 comprises a sequence having at least 80%, at least 85%, at least 90% or at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 568, 517, 555, 511, 570, 516, 541, 528, 562 and 552; the CDR-H3 comprises a sequence having at least 80%, at least 85%, at least 90% or at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 642, 591, 629, 585, 644, 590, 615, 602, 636 and 626; the CDR-L1 comprises a sequence having at least 80%, at least 85%, at least 90% or at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 734, 683, 721, 677, 736, 682, 707, 694, 728, and 718; the CDR-L2 comprises a sequence having at least 80%, at least 85%, at least 90% or at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 808, 757, 795, 751, 810, 756, 781, 768, 802 and 792; and the CDR-L3 comprises a sequence having at least 80%, at least 85%, at least 90% or at least 95% sequence identity to one or more sequences selected from 882, 831, 869, 825, 884, 830, 855, 842, 876 and 855.

In several embodiments of these methods, the tumor binding domain comprises a VH, wherein the VH comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 956, 905, 943, 899, 958, 904, 929, 916, 950, and 940, and wherein the tumor binding domain comprises a VL, wherein the VL comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 1030, 979, 1017, 973, 1032, 978, 1003, 990, 1024, and 1014. In several embodiments of these methods, the tumor binding domain comprises an scFv, wherein the scFv comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 296, 245, 283, 239, 298, 244, 269, 256, 290, 280.

In several embodiments of these methods, the chimeric antigen receptor comprises an OX40 subdomain and a CD3 ζ subdomain, and the cells are engineered to express membrane bound IL-15 (mbIL 15). In several embodiments, the mbIL15 is bicistronic encoded on a polynucleotide encoding the CAR. In several embodiments, the polynucleotides encoding the CAR and the mbiL15 comprise sequences having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 204, 153, 191, 147, 206, 152, 177, 164, 198, and 188. In several embodiments, the CAR comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 379, 328, 366, 322, 381, 327, 352, 339, 373, and 363. In several embodiments, the OX40 subdomain is encoded by a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID No. 5, wherein the cd3ζ subdomain is encoded by a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID No. 7, and wherein the mbIL15 is encoded by a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID No. 1188.

In several embodiments, expression of CIS is significantly reduced as compared to cells that are not edited for CISH and/or cells in which the cells do not express detectable levels of CIS protein. In several embodiments, the expression of the adenosine receptor is significantly reduced as compared to cells not edited for the adenosine receptor and/or cells in which the cells do not express detectable levels of the adenosine receptor. In several embodiments, the adenosine receptor comprises an A2A adenosine receptor, an A2B adenosine receptor, an A3 adenosine receptor, or an A1 adenosine receptor. In several embodiments, the gene editing is performed using a CRISPR-Cas system, and wherein the Cas comprises a Cas9 enzyme. In several embodiments, the engineered and edited immune cells comprise NK cells. In several embodiments, the engineered and edited immune cells consist of or consist essentially of NK cells.

Also provided herein are polynucleotides encoding anti-CD 70 chimeric antigen receptors, wherein the CAR comprises an anti-CD 70 binding domain, wherein the anti-CD 70 binding domain is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of SEQ ID NOs 36-120, 221-229, 1038-1111, 1112-1185, and/or comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 230-312, 890-963, 964-1037, or is capable of generating a portion of a cytotoxic signal upon binding to CD70 on a target cell. In several embodiments, the polynucleotide further encodes an OX40 domain and a CD3 zeta domain, wherein the OX40 subdomain is encoded by a sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO. 5, wherein the CD3 zeta subdomain is encoded by a sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO. 7. In several embodiments, the polynucleotide further encodes mbIL15, wherein said mbIL15 is encoded by a sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID No. 1188. In several embodiments, one or more of SEQ ID NOS 36-120, 221-229, 1038-1111, or 1112-1185, the polynucleotide encoding OX40, the polynucleotide encoding CD3 ζ, and the polynucleotide encoding mbiL15 are arranged in a 5 'to 3' direction within the polynucleotide.

In addition, the invention provides a method of enhancing persistence of a population of immune cells to be used in cancer immunotherapy, the method comprising identifying a target marker on a tumor to be treated, determining whether a population of immune cells to be engineered to express a CAR that binds to the target marker also endogenously expresses the target marker; editing the genome of the population of immune cells to disrupt the gene encoding the endogenous target marker, and engineering the population of immune cells to express the CAR, wherein disruption of endogenous expression of the target marker by the immune cells reduces the ability of the CAR to bind to the endogenous target marker on the immune cells, thereby enhancing persistence of the population of immune cells. In several embodiments, the immune cell is an NK cell, a T cell, or a combination thereof, wherein the target marker is CD70, and wherein the gene editing is performed using a CRISPR-Cas system.

In several embodiments, the method further comprises disrupting expression of a cytokine induced SH 2-Containing (CIS) protein encoded by the CISH gene using a CRISPR-Cas system, and/or further comprises disrupting expression of an adenosine receptor using a CRISPR-Cas system, wherein the adenosine receptor comprises an A2A adenosine receptor, an A2B adenosine receptor, an A3 adenosine receptor, and/or an A1 adenosine receptor.

In several embodiments, provided herein is an anti-CD 70 Chimeric Antigen Receptor (CAR), wherein the CAR comprises an anti-CD 70 binding domain, an OX40 domain, and a cd3ζ domain, wherein the anti-CD 70 CAR is encoded by a polynucleotide having at least 85%, at least 90%, or at least 95% sequence identity to one or more of SEQ ID NOs 138-220. Also provided herein is an anti-CD 70 Chimeric Antigen Receptor (CAR), wherein the CAR comprises an anti-CD 70 binding domain, an OX40 domain, and a CD3 zeta domain, wherein the anti-CD 70 CAR comprises an amino acid sequence having at least 85%, at least 90%, or at least 95% sequence identity to one or more amino acid sequences of SEQ ID NOs 313-395, or a portion thereof capable of generating a cytotoxic signal upon binding to CD70 on a target cell.

Also provided herein is an anti-CD 70 binding domain comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3, and wherein: the CDR-H1 comprises a sequence having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOs 428-501; the CDR-H2 comprises a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs 502-575; the said CDR-H3 comprises a sequence having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS 576-649; the CDR-L1 comprises a sequence having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 668-741; the CDR-L2 comprises a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs 742-815; and said CDR-L3 comprises a sequence having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOS 816-889. In several embodiments, the heavy chain variable domain is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOs 1038-1111. In several embodiments, the light chain variable domain is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOS 1112-1185. Depending on the embodiment, the anti-CD 70 binding domain is an antibody, fab 'fragment, F (ab') ₂ Fragments or scfvs. In several embodiments, provided herein are CARs comprising an anti-CD 70 binding domain disclosed herein. In several embodiments, the CAR further comprises an OX40 subdomain and a cd3ζ subdomain. In several embodiments, provided are cells, such as immune cells, comprising an anti-CD 70 binding domain or CAR provided herein. In several embodiments, the cells comprise, consist of, or consist essentially of NK cells. In several embodiments, wherein the cells are genetically edited to express reduced levels of CISH, adenosine receptor, A2A adenosine receptor, A2B adenosine receptor, A3 adenosine receptor, A1 adenosine receptor, A2AR, TGFBR, B2M, CIITA, NKG2A, CBLB, TRIM29, SOCS2, SMAD3, MAPKAPK3, CEACAM1, or DDIT4, or any combination thereof, as compared to unedited cells. Also provided are methods of treating cancer in a subject, the method comprising administering to the subject an anti-CD 70 binding domain, CAR, cell as provided herein. Also provided are anti-CD 70 binding domains, CARs or cells as provided herein for use in the treatment of cancer and +.Or in the manufacture of a medicament for the treatment of cancer.

Also provided herein is a population of genetically engineered immune cells for use in cancer immunotherapy, the population comprising a plurality of immune cells that have been expanded in culture, wherein the plurality of immune cells are engineered to express a Chimeric Antigen Receptor (CAR) comprising a tumor binding domain that targets CD70, a transmembrane domain, and a cytotoxic signaling complex, wherein the immune cells are genetically edited to express reduced levels of CD70 as compared to unedited immune cells that have been expanded in culture, and wherein the reduced CD70 expression is engineered by editing an endogenous CD70 gene. In several embodiments, the immune cell population comprises, consists of, or consists essentially of an NK cell population.

Also provided in several embodiments is a method of preparing a population of genetically engineered immune cells for cancer immunotherapy, the method comprising engineering a population of immune cells to express a CAR that binds a target marker, wherein at least a portion of the population of immune cells also endogenously expresses the target marker; and editing the genome of the population of immune cells to disrupt the gene encoding the endogenous target marker, wherein disruption of endogenous expression of the target marker by the immune cells reduces the ability of the CAR to bind to the endogenous target marker on the immune cells. In several embodiments, the immune cell population comprises, consists of, or consists essentially of an NK cell population.

In several embodiments, provided herein is a population of genetically engineered Natural Killer (NK) cells for cancer immunotherapy, the population comprising a plurality of NK cells that have been expanded in culture, wherein the plurality of NK cells are engineered to express a Chimeric Antigen Receptor (CAR) comprising a tumor binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the tumor binding domain targets CD70. In several embodiments, the NK cells are genetically edited to express reduced levels of CD70 as compared to unedited NK cells that have been expanded in culture, and wherein the reduced CD70 expression is engineered by the editing of endogenous CD70 genes.

In several embodiments, a method for treating cancer in a subject is provided, the method comprising administering to the subject a population of genetically engineered immune cells, the population comprising a plurality of NK cells that have been expanded in culture, wherein the plurality of NK cells are engineered to express a Chimeric Antigen Receptor (CAR) comprising a tumor binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the tumor binding domain targets CD70, wherein the chimeric antigen receptor comprises an OX40 subdomain and a CD3 zeta subdomain, wherein the NK cells are genetically edited to express reduced levels of CD70 as compared to unedited NK cells that have been expanded in culture, and wherein the reduced CD70 expression is engineered by editing an endogenous CD70 gene.

In several embodiments, the chimeric antigen receptor cytotoxic signaling complex comprises an OX40 subdomain and a cd3ζ subdomain. In several embodiments, the cells are also genetically engineered to express membrane-bound IL-15.

In several embodiments, the NK cells are genetically engineered to express reduced levels of cytokine-induced SH 2-Containing (CIS) protein encoded by a CISH gene as compared to non-engineered NK cells, wherein the reduced CIS expression is engineered by the editing of the CISH gene, and wherein the genetically engineered NK cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target cells, and enhanced persistence as compared to NK cells expressing native levels of CIS. In several embodiments, CISH editing results in significantly reduced expression of CIS compared to cells that have not been edited for CISH. In several embodiments, the edited cell does not express a detectable level of CIS.

In several embodiments, the NK cells are genetically engineered to express reduced levels of an adenosine receptor as compared to non-engineered NK cells, wherein the reduced adenosine receptor expression is engineered by editing of an adenosine receptor encoding gene, and wherein the genetically engineered NK cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target cells, and enhanced persistence as compared to NK cells expressing native levels of the adenosine receptor. In several embodiments, editing of the gene encoding the adenosine receptor results in significantly reduced expression of the adenosine receptor compared to cells not edited for the adenosine receptor. In several embodiments, the edited cell does not express detectable levels of adenosine receptors. Depending on the embodiment, the edited gene may encode an A2A adenosine receptor, an A2B adenosine receptor, an A3 adenosine receptor, or an A1 adenosine receptor. In several embodiments, the edited gene encodes an A2A adenosine receptor (A2 AR). In some embodiments, more than one of the adenosine receptors is edited.

In several embodiments, the CISH and adenosine receptor encoding genes are edited, resulting in significantly reduced expression of CIS and the adenosine receptor as compared to cells not edited for CISH and the adenosine receptor. In several embodiments, the edited cell does not express a detectable level of CIS or the adenosine receptor.

In several embodiments, the tumor binding domain is encoded by a polynucleotide comprising a sequence having at least 85%, at least 90%, or at least 95% sequence identity to one or more of SEQ ID NOs 36 to 120, 221-229, 1038-1111, 1112-1185; and/or comprises an amino acid sequence having at least 85%, at least 90% or at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOS 230-312, 890-963, 964-1037. In several embodiments, the OX40 subdomain is encoded by a sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO. 5. In several embodiments, the OX40 subdomain comprises an amino acid sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO. 6. In several embodiments, the CD3ζ subdomain is encoded by a sequence having at least 85%, at least 90%, at least 95% sequence identity to SEQ ID NO. 7. In several embodiments, the CD3ζ subdomain comprises an amino acid sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO. 8.

In several embodiments, provided herein is an anti-CD 70 binding domain comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3, and wherein the CDR-H1 comprises a sequence having at least 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NO 428-501, the CDR-H2 comprises a sequence having at least 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NO 502-575, the CDR-H3 comprises a sequence having at least 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NO 576-649, the CDR-L1 comprises a sequence having at least 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NO 668-741, and the CDR-L2 comprises a sequence having at least 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NO 88-741, and at least 95%, 99% or 95% or 100% sequence identity to a sequence selected from SEQ ID NO 88-L3. In several embodiments, the heavy chain variable region comprises an amino acid sequence having at least 90%, 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOS 890-963. In several embodiments, the light chain variable region comprises an amino acid sequence having at least 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOS 964-1037. In several embodiments: 1) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 890 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 964; 2) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 891 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 965; 3) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 892 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 966; 4) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 893 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 967; 5) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 894 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 968; 6) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 895 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 969; 7) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 896 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 970; 8) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 897 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 971; 9) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 898 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 972; 10 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 899 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 973; 11 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 900 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 974; 12 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 901 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 975; 13 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 902 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 976; 14 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 903 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 977; 15 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 904 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 978; 16 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 905 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 979; 17 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 906 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 980; 18 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 907 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 981; 19 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 908 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 982; 20 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:909 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 983; 21 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 910 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 984; 22 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 911 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 985; 23 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 912 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 986; 24 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 913 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 987; 25 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 914 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 988; 26 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 915 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 989; 27 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 916 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 990; 28 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 917 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 991; 29 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:918 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 992; 30 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 919 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 993; 31 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:920 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 994; 32 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 921 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 995; 33 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 922 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 996; 34 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 923 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 997; 35 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 924 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 998; 36 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 925 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 999; 37 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 926 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1000; 38 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 927 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1001; 39 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 928 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1002; 40 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 929 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1003; 41 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 930 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1004; 42 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 931 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1005; 43 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 932 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1006; 44 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 933 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1007; 45 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 934 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1008; 46 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 935 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1009; 47 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 936 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1010; 48 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 937 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1011; 49 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 938 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1012; 50 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 939 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1013; 51 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 940 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1014; 52 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 941 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1015; 53 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 942 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1016; 54 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 943 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1017; 55 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 944 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1018; 56 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 945 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1019; 57 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 946 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1020; 58 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 947 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1021; 59 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 948 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1022; 60 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 949 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 1023; 61 The heavy chain variable region comprises H2, CDR-H1 within SEQ ID NO:950, CDR-and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 1024; 62 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 951 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 1025; 63 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 952 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1026; 64 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 953 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1027; 65 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 954 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1028; 66 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 955 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 1029; 67 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:956 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 1030; 68 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:957 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 1031; 69 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:958 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 1032; 70 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:959 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 1033; 71 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 960 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1034; 72 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 961 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 1035; 73 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 962 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1036; and/or 74) the heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 963 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1037.

In several embodiments, 1) the heavy chain variable region comprises SEQ ID NO. 890 and the light chain variable region comprises SEQ ID NO. 964; 2) The heavy chain variable region comprises SEQ ID NO 891 and the light chain variable region comprises SEQ ID NO 965; 3) The heavy chain variable region comprises SEQ ID NO 892 and the light chain variable region comprises SEQ ID NO 966; 4) The heavy chain variable region comprises SEQ ID NO 893 and the light chain variable region comprises SEQ ID NO 967; 5) The heavy chain variable region comprises SEQ ID NO 894 and the light chain variable region comprises SEQ ID NO 968; 6) The heavy chain variable region comprises SEQ ID NO 895 and the light chain variable region comprises SEQ ID NO 969; 7) The heavy chain variable region comprises SEQ ID NO 896 and the light chain variable region comprises SEQ ID NO 970; 8) The heavy chain variable region comprises SEQ ID NO 897 and the light chain variable region comprises SEQ ID NO 971; 9) The heavy chain variable region comprises SEQ ID NO 898 and the light chain variable region comprises SEQ ID NO 972;10 899 and the light chain variable region comprises SEQ ID NO 973;11 900 and the light chain variable region comprises 974;12 901 and the light chain variable region comprises SEQ ID No. 975;13 A) the heavy chain variable region comprises SEQ ID No. 902 and the light chain variable region comprises SEQ ID No. 976;14 903 and the light chain variable region comprises SEQ ID NO 977;15 904 and the light chain variable region comprises SEQ ID No. 978;16 The heavy chain variable region comprises SEQ ID NO. 905 and the light chain variable region comprises SEQ ID NO. 979;17 906 and the light chain variable region comprises SEQ ID No. 980;18 907 and the light chain variable region comprises SEQ ID No. 981;19 908 and the light chain variable region comprises SEQ ID NO. 982;20 -said heavy chain variable region comprises SEQ ID No. 909 and said light chain variable region comprises SEQ ID No. 983;21 The heavy chain variable region comprises SEQ ID NO. 910 and the light chain variable region comprises SEQ ID NO. 984;22 911 and 985;23 912 and the light chain variable region comprises SEQ ID NO. 986;24 A) the heavy chain variable region comprises SEQ ID NO. 913 and the light chain variable region comprises SEQ ID NO. 987;25 914 and the light chain variable region comprises SEQ ID NO. 988;26 915 and the light chain variable region comprises SEQ ID NO. 989;27 916 of said heavy chain variable region and said light chain variable region comprises SEQ ID No. 990;28 The heavy chain variable region comprises SEQ ID NO. 917 and the light chain variable region comprises SEQ ID NO. 991;29 918 and the light chain variable region comprises SEQ ID NO. 992;30 The heavy chain variable region comprises SEQ ID NO. 919 and the light chain variable region comprises SEQ ID NO. 993;31 920 and the light chain variable region comprises SEQ ID NO 994;32 921 and the light chain variable region comprises SEQ ID NO 995;33 922 and the light chain variable region comprises SEQ ID NO 996;34 923 and the light chain variable region comprises SEQ ID NO 997;35 924 and the light chain variable region comprises SEQ ID NO 998;36 The heavy chain variable region comprises SEQ ID NO. 925 and the light chain variable region comprises SEQ ID NO. 999;37 The heavy chain variable region comprises SEQ ID NO. 926 and the light chain variable region comprises SEQ ID NO. 1000;38 927 and the light chain variable region comprises SEQ ID NO 1001;39 928 and the light chain variable region comprises SEQ ID NO 1002;40 929 and the light chain variable region comprises SEQ ID NO 1003;41 The heavy chain variable region comprises SEQ ID NO. 930 and the light chain variable region comprises SEQ ID NO. 1004;42 931 and the light chain variable region comprises SEQ ID NO 1005;43 -said heavy chain variable region comprises SEQ ID No. 932 and said light chain variable region comprises SEQ ID No. 1006;44 The heavy chain variable region comprises SEQ ID NO. 933 and the light chain variable region comprises SEQ ID NO. 1007;45 934 and the light chain variable region comprises SEQ ID NO. 1008;46 A) the heavy chain variable region comprises SEQ ID NO. 935 and the light chain variable region comprises SEQ ID NO. 1009;47 936 and 1010;48 The heavy chain variable region comprises SEQ ID NO. 937 and the light chain variable region comprises SEQ ID NO. 1011;49 938 and the light chain variable region comprises SEQ ID NO 1012;50 The heavy chain variable region comprises SEQ ID NO. 939 and the light chain variable region comprises SEQ ID NO. 1013;51 940 and 1014;52 A) the heavy chain variable region comprises SEQ ID NO. 941 and the light chain variable region comprises SEQ ID NO. 1015;53 942 and the light chain variable region comprises SEQ ID No. 1016;54 943 and the light chain variable region comprises SEQ ID NO 1017;55 944 and 1018;56 945 and the light chain variable region comprises SEQ ID NO 1019;57 946 and the light chain variable region comprises SEQ ID No. 1020;58 947 and the light chain variable region comprises SEQ ID No. 1021;59 948 and the light chain variable region comprises SEQ ID NO 1022;60 949 and the light chain variable region comprises SEQ ID NO 1023;61 The heavy chain variable region comprises SEQ ID No. 950 and the light chain variable region comprises SEQ ID No. 1024;62 951 and the light chain variable region comprises SEQ ID NO 1025;63 The heavy chain variable region comprises SEQ ID NO. 952 and the light chain variable region comprises SEQ ID NO. 1026;64 953 and 1027;65 954 and the light chain variable region comprises SEQ ID NO 1028;66 The heavy chain variable region comprises SEQ ID NO:955 and the light chain variable region comprises SEQ ID NO:1029;67 956 and the light chain variable region comprises SEQ ID NO 1030;68 957 and the light chain variable region comprises SEQ ID NO 1031;69 958 and the light chain variable region comprises SEQ ID No. 1032;70 959 and 1033;71 960 and the light chain variable region comprises SEQ ID No. 1034;72 961 and the light chain variable region comprises SEQ ID NO 1035;73 962 and the light chain variable region comprises SEQ ID NO 1036; and/or 74) the heavy chain variable region comprises SEQ ID NO. 963 and the light chain variable region comprises SEQ ID NO. 1037.

In several embodiments, the heavy chain variable region further comprises FW-H1, FW-H2, FW-H3, and FW-H4, and the light chain variable region further comprises FW-L1, FW-L2, FW-L3, and FW-L4, and wherein: the FW-H1 comprises a sequence having at least 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs 399-402; the FW-H2 comprises a sequence having at least 90%, 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 403-406; the FW-H3 comprises a sequence having at least 90%, 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 407-422; the FW-H4 comprises a sequence having at least 90%, 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 423-427; the FW-L1 comprises a sequence having at least 90%, 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS: 650-653; the FW-L2 comprises a sequence having at least 90%, 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOs 654-657; the FW-L3 comprises a sequence having at least 90%, 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 658-661; and/or the FW-L4 comprises a sequence having at least 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOS: 662-667. In several embodiments, the heavy chain variable domain is encoded by a nucleic acid sequence having at least 90%, 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOS 1038-1111. In several embodiments, the light chain variable domain is encoded by a nucleic acid sequence having at least 90%, 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOS 1112-1185.

In several embodiments, the anti-CD 70 binding domain is an antibody, fab 'fragment, F (ab') ₂ Fragments or scfvs.

In several embodiments, one or more of the anti-CD 70 binding domains as disclosed above are incorporated into a CAR. In several embodiments, such a CAR further comprises an OX40 subdomain and a cd3ζ subdomain (or any of the signaling/costimulatory domains disclosed herein). In several embodiments, the CAR consists of or consists essentially of a CD70 binding domain, a transmembrane domain/hinge, an OX40 domain, and a cd3ζ domain as disclosed herein. In several embodiments, the OX40 subdomain comprises an amino acid sequence having at least 90%, 95%, 99% or 100% sequence identity to SEQ ID NO. 6. In several embodiments, the OX40 subdomain is encoded by a sequence having at least 90%, 95%, 99% or 100% sequence identity to SEQ ID NO. 5. In several embodiments, the cd3ζ subdomain comprises an amino acid sequence having at least 90%, 95%, 99%, or 100% sequence identity to SEQ ID No. 8. In several embodiments, the CD3ζ subdomain is encoded by a sequence having at least 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO. 7. In several embodiments, the CAR comprises at least two anti-CD 70 binding domains, and the CAR is a multivalent CAR. In several embodiments, the multivalent CAR comprises at least two anti-CD 70 binding domains, and the CAR is a bivalent CAR. In several embodiments, the bivalent CAR comprises a first anti-CD 70 binding domain and a second anti-CD 70 binding domain, wherein the first anti-CD 70 binding domain and the second anti-CD 70 binding domain each comprise: a) A heavy chain variable region comprising the sequence of SEQ ID NO. 923 and a light chain variable region comprising the sequence of SEQ ID NO. 997; b) A heavy chain variable region comprising the sequence of SEQ ID NO. 949 and a light chain variable region comprising the sequence of SEQ ID NO. 1023; c) A heavy chain variable region comprising the sequence of SEQ ID NO. 950 and a light chain variable region comprising the sequence of SEQ ID NO. 1024; d) A heavy chain variable region comprising the sequence of SEQ ID NO. 952 and a light chain variable region comprising the sequence of SEQ ID NO. 1026; and/or e) a heavy chain variable region comprising the sequence of SEQ ID NO. 953 and a light chain variable region comprising the sequence of SEQ ID NO. 1027. In several embodiments, there is provided a cell comprising an anti-CD 70 binding domain and/or CAR as disclosed above. In several embodiments, another CAR is engineered into the cell. In several embodiments, the CAR does not target NKG2D ligand. In several embodiments, the CAR does not target CD19. In several embodiments, the cell is an immune cell. In several embodiments, the cell is an NK cell. In several embodiments, the cells are used in combination with another cell type (e.g., engineered T cells). In several embodiments, the immune cells are not T cells, γt cells, or δγt cells. In several embodiments, the cells are genetically edited to express reduced levels of CISH, adenosine receptor, A2A adenosine receptor, A2B adenosine receptor, A3 adenosine receptor, A1 adenosine receptor, A2AR, TGFBR, B2M, CIITA, NKG2A, CBLB, TRIM29, SOCS2, SMAD3, MAPKAPK3, CEACAM1, or DDIT4, or any combination thereof, as compared to non-engineered cells. In several embodiments, the cells are genetically edited with one or more guide RNAs having at least 90% or at least 95% sequence identity to SEQ ID NOS 1190-1201. In several embodiments, the NK cells are genetically edited to express reduced levels of SMAD3, MAPKAPK3, CEACAM1, or DDIT4, or any combination thereof, as compared to non-engineered NK cells. In several embodiments, the NK cells are genetically edited with one or more guide RNAs having at least 90% or at least 95% sequence identity with SEQ ID NOS 1190-1201. In several embodiments, the selected gene may not be disrupted in the engineered cell. For example, in one embodiment, the immune cells have not undergone disruption of the T cell receptor alpha constant region (TRAC) gene. In one embodiment, the immune cells do not undergo disruption of the B2M gene. In one embodiment, the immune cells do not undergo MHC class I disruption.

In several embodiments, methods of treating cancer in a subject are provided, the methods comprising administering to the subject one or more anti-CD 70 binding domains as described above (or elsewhere herein). In several embodiments, there is provided the use of an anti-CD 70 binding domain as described above (or elsewhere herein) for the treatment of cancer and/or in the manufacture of a medicament for the treatment of cancer.

In several embodiments, NK cells disclosed herein are engineered to express interleukin 15 (IL 15, IL-15). In some embodiments, the IL15 is membrane-bound IL15 (mbIL 15). In some embodiments, the mbIL15 comprises a native IL15 sequence and at least one transmembrane domain. In some embodiments, the native IL15 sequence is a human native IL15 sequence. In some embodiments, the native IL15 sequence is encoded by a sequence having at least 85%, at least 90%, at least 95% sequence identity with SEQ ID NO. 11. In some embodiments, the native IL15 sequence comprises a peptide sequence having at least 85%, at least 90%, at least 95% sequence identity with SEQ ID NO. 12. In several embodiments, the mbIL15 is encoded by a sequence having at least 85%, at least 90%, at least 95% sequence identity to SEQ ID No. 1188. In some embodiments, the mbIL15 comprises a peptide sequence having at least 85%, at least 90%, at least 95% sequence identity to SEQ ID No. 1189. In some embodiments, the mbIL15 is optionally bicistronic encoded on a polynucleotide encoding the CAR. In several embodiments, the CAR is encoded by a polynucleotide or portion thereof (e.g., a portion that does not comprise an mbIL15 sequence and/or a self-cleaving peptide sequence) having at least 85%, at least 90%, or at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 138-220, and/or comprises an amino acid sequence or portion thereof (e.g., a portion that does not comprise an mbIL15 sequence and/or a self-cleaving peptide sequence) having at least 85%, at least 90%, or at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 313-395.

In several embodiments, expression of CIS is significantly reduced compared to non-engineered NK cells. In several embodiments, the NK cells do not express detectable levels of CIS protein.

In a number of embodiments of the present invention, the NK cells are further genetically engineered to express reduced levels of Transforming Growth Factor Beta Receptor (TGFBR) as compared to non-engineered NK cells, to express reduced levels of beta-2 microglobulin (B2M) as compared to non-engineered NK cells, to express reduced levels of CIITA (class II major histocompatibility complex transactivator) as compared to non-engineered NK cells, to express reduced levels of natural killer 2 family member A (NKG 2A) receptor as compared to non-engineered NK cells, to express reduced levels of cbLB gene-encoded cbbl protooncogene B protein as compared to non-engineered NK cells, to express reduced levels of TRIM29 gene-encoded triple motif-containing protein as compared to TRIM29 protein, to express reduced levels of to express reduced levels of cytokine signaling inhibitor 2 protein encoded by the SOCS2 gene compared to non-engineered NK cells, to express reduced levels of maternal DPP homolog 3 (SMAD 3) protein encoded by the SMAD3 gene compared to non-engineered NK cells, to express reduced levels of MAP kinase activated protein kinase 3 (MAPKAPK 3) protein encoded by the MAPKAPK3 gene compared to non-engineered NK cells, to express reduced levels of carcinoembryonic antigen associated cell adhesion molecule 1 (CEACAM 1) protein encoded by the CEACAM1 gene compared to non-engineered NK cells, to express reduced levels of DNA damage induced transcript 4 (DDIT 4) protein encoded by the DDIT4 gene compared to non-engineered NK cells, to express CD47, and/or to express HLA-E or any combination thereof. In several embodiments, the NK cells are further genetically edited to disrupt the expression of at least one immune checkpoint protein achieved by the NK cells. In several embodiments, the at least one immune checkpoint protein is selected from the group consisting of CTLA4, PD-1, lymphocyte activating gene (LAG-3), NKG2A receptor, KIR2DL-1, KIR2DL-2, KIR2DL-3, KIR2DS-1 and/or KIR2DA-2, and combinations thereof.

According to several embodiments, gene editing for reduced expression or gene editing for induced expression is performed using a CRISPR-Cas system. In several embodiments, the CRISPR-Cas system comprises Cas selected from Cas9, csn2, cas4, cpf1, C2C3, cas13a, cas13b, cas13C, casX, casY, and combinations thereof. In several embodiments, the Cas is Cas9.

According to several embodiments, the CRISPR-Cas system comprises Cas selected from the group consisting of: cas3, cas8a, cas5, cas8b, cas8c, cas10d, cse1, cse2, csy1, csy2, csy3, GSU0054, cas10, csm2, cmr5, cas10, csx11, csx10, csf1, and combinations thereof. In several embodiments, the CD70 gene is edited using one or more guide RNAs having at least 95% sequence identity to SEQ ID NO:121, SEQ ID NO:122, or SEQ ID NO: 123. In several embodiments, the CISH gene is edited using one or more guide RNAs having at least 85%, 90%, or 95% sequence identity to SEQ ID NO. 130, SEQ ID NO. 131, SEQ ID NO. 132, SEQ ID NO. 133, or SEQ ID NO. 134. In several embodiments, the TGFBR2 gene is edited using one or more guide RNAs having at least 85%, 90% or 95% sequence identity with SEQ ID NO. 130, SEQ ID NO. 131, SEQ ID NO. 132, SEQ ID NO. 133 or SEQ ID NO. 134.

In several embodiments, zinc Finger Nucleases (ZFNs) are used for gene editing to reduce expression or for gene editing to induce expression. In several embodiments, gene editing for reduced expression or gene editing for induced expression is performed using a transcription activator-like effector nuclease (TALEN).

Depending on the method, the cancer to be treated is renal cell carcinoma or metastasis of renal cell carcinoma.

In several embodiments, the methods disclosed herein further comprise optionally administering a plurality of engineered T cells, wherein the T cells are engineered to express a CAR. In several embodiments, the CAR expressed by the T cell is directed to CD70.

In several embodiments, polynucleotides encoding anti-CD 70 chimeric antigen receptors are provided, wherein the CAR comprises an anti-CD 70 binding domain, wherein the anti-CD 70 binding domain is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of SEQ ID NOS: 38-120, 221-229, 1038-1111, 1112-1185, and/or comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOS: 230-312, 890-963, 964-1037. In several embodiments, the CAR comprises an OX40 subdomain encoded by a sequence having at least 85%, 90% or 95% sequence identity to SEQ ID No. 5. In several embodiments, the OX40 subdomain comprises an amino acid sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO. 6. In several embodiments, the CAR comprises a cd3ζ domain encoded by a sequence having at least 85%, 90%, or 95% sequence identity to SEQ ID No. 7. In several embodiments, the CD3ζ subdomain comprises an amino acid sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO. 8. In several embodiments, there is further provided a polynucleotide encoding mbIL15, wherein said mbIL15 is encoded by a sequence having at least 85%, 90% or 95% sequence identity to SEQ ID No. 1188. In several embodiments, the mbIL15 comprises an amino acid sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID No. 1189. In several embodiments, one or more of SEQ ID NOS 38-120, 221-229, 1038-1111, 1112-1185, the polynucleotide encoding OX40, the polynucleotide encoding CD3 ζ, and the polynucleotide encoding mbiL15 are arranged in a 5 'to 3' direction within the polynucleotide.

The invention also provides a method of enhancing persistence of a population of immune cells to be used in cancer immunotherapy, the method comprising identifying a target marker on a tumor to be treated, determining whether the population of immune cells to be engineered to express a CAR that binds to the target marker also endogenously expresses the target marker; editing the genome of the population of immune cells to disrupt the gene encoding the endogenous target marker, and engineering the population of immune cells to express the CAR, wherein disruption of endogenous expression of the target marker by the immune cells reduces the ability of the CAR to bind to the endogenous target marker on the immune cells, thereby enhancing persistence of the population of immune cells.

In several embodiments, the immune cells are NK cells, T cells, or a combination thereof. In several embodiments, the target marker is CD70. In several embodiments, the gene editing is performed using a CRISPR-Cas system, and the Cas is optionally directed to the endogenous gene by one or more of SEQ ID NOS 121-123. In several embodiments, the CRISPR-Cas system disrupts expression of a cytokine-induced SH 2-Containing (CIS) protein encoded by a CISH gene. In several embodiments, the Cas is directed to the endogenous gene by one or more of SEQ ID NOS 130-134. In several embodiments, adenosine receptors such as A2AR are edited. In several embodiments, the CRISPR-Cas system is used to edit genes encoding adenosine receptors. In several embodiments, the Cas is directed to the endogenous gene by one or more of SEQ ID NOS 396-398. In several embodiments, SMAD3 is edited. In several embodiments, the CRISPR-Cas system is used to edit a gene encoding SMAD3. In several embodiments, the Cas is directed to the endogenous gene by one or more of SEQ ID NOS 1190-1192. In several embodiments, MAPKAPK3 is edited. In several embodiments, the CRISPR-Cas system is used to edit a gene encoding MAPKAPK3. In several embodiments, the Cas is directed to the endogenous gene by one or more of SEQ ID NOS 1193-1195. In a number of embodiments, CEACAM1 is edited. In several embodiments, the CRISPR-Cas system is used to edit a gene encoding CEACAM1. In several embodiments, the Cas is directed to the endogenous gene by one or more of SEQ ID NOS 1196-1198. In several embodiments, DDIT4 is edited. In several embodiments, the CRISPR-Cas system is used to edit genes encoding DDIT4. In several embodiments, the Cas is directed to the endogenous gene by one or more of SEQ ID NOS 1199-1201. In several embodiments, a combination of one or more of the above genes is edited (optionally in combination with other genes to be edited as disclosed elsewhere herein).

In several embodiments, provided herein is an anti-CD 70 Chimeric Antigen Receptor (CAR), wherein the CAR comprises an anti-CD 70 binding domain, an OX40 domain, and a cd3ζ domain, wherein the anti-CD 70 CAR is encoded by a polynucleotide having at least 80%, 85%, 90%, or 95% sequence identity to one or more of SEQ ID NOs 138-220, wherein SEQ ID NOs 138-220 also bicistronically encode mbIL15.

In several embodiments, provided herein is an anti-CD 70 Chimeric Antigen Receptor (CAR), wherein the CAR comprises an anti-CD 70 binding domain, an OX40 domain, and a cd3ζ domain, wherein the anti-CD 70 CAR comprises an amino acid sequence or a portion thereof (e.g., a portion that does not comprise an mbIL15 sequence and/or a self-cleaving peptide sequence) that has at least 80%, 85%, 90%, or 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 313-395.

Some embodiments relate to a method comprising administering to a subject in need thereof an immune cell as described herein. In some embodiments, the subject has cancer. In some embodiments, the administering treats, inhibits, or prevents progression of the cancer.

Several embodiments provide for the use of the cell, anti-CD 70 scFv, anti-CD 70 CAR, and/or a polynucleotide or amino acid sequence disclosed herein in the treatment or prevention of cancer. Several embodiments provide for the use of the cell, anti-CD 70 scFv, anti-CD 70 CAR, and/or a polynucleotide or amino acid sequence disclosed herein in the manufacture of a medicament for the treatment or prevention of cancer.

Drawings

FIG. 1 depicts a non-limiting schematic of a tumor-directed chimeric antigen receptor.

FIG. 2 depicts an additional non-limiting schematic of a tumor-directed chimeric antigen receptor.

FIG. 3 depicts an additional non-limiting schematic of a tumor-directed chimeric antigen receptor.

FIG. 4 depicts an additional non-limiting schematic of a tumor-directed chimeric antigen receptor.

FIG. 5 depicts an additional non-limiting schematic of a tumor-directed chimeric antigen receptor.

FIG. 6 depicts a non-limiting schematic of a tumor-directed chimeric antigen receptor for a non-limiting example of a tumor marker.

FIG. 7 depicts a further non-limiting schematic of tumor-directed chimeric antigen receptors for a non-limiting example of a tumor marker.

Figures 8A-8C show flow cytometry data relating to the extent of CD70 expression by natural killer cells.

Fig. 9 depicts a non-limiting schematic process flow for producing engineered NK cells using a therapeutic method for cancer therapy according to several embodiments disclosed herein.

Fig. 10A-10B show schematic diagrams of non-limiting examples of protocols for CRISPR-based modification and culture of engineered NK cells according to several embodiments disclosed herein.

Fig. 11A-11D show flow cytometry data associated with CRISPR-mediated CD70 knockdown. Figure 11A shows data for CD70 expression on NK cells from a first donor after CRISPR-mediated knockdown using three different guide RNAs. Fig. 11B shows corresponding control data for the first donor. Figure 11C shows data for CD70 expression on NK cells from a second donor after CRISPR-mediated knockdown using three different guide RNAs. Fig. 11D shows corresponding control data for the first donor. These experiments were performed using the KD7 protocol.

Figures 12A-12E show flow cytometry data related to CRISPR-mediated knockdown of CD70 expression on NK cells from additional donors. FIG. 12A shows CD70 expression using guide RNA 1. FIG. 12B shows CD70 expression using guide RNA 2. FIG. 12C shows CD70 expression using guide RNA 3. FIG. 12D shows CD70 expression of non-electroporated NK cells. FIG. 12E shows undyed NK cells. These experiments were performed using the KD7 protocol.

Fig. 13A-13D show flow cytometry data relating to CRISPR-mediated knockdown of CD70 expression on NK cells from the same donor as in fig. 12 but using a combination of guide RNAs. FIG. 13A shows CD70 expression using guide RNA 1+2. FIG. 13B shows CD70 expression using guide RNA 1+3. FIG. 13C shows CD70 expression using guide RNA 2+3. Fig. 13D and 13E are the same controls as shown in fig. 12D and 12E. These experiments were performed using the KD7 protocol.

Figures 14A-14F show flow cytometry data relating to CD70 expression 14 days (21 days total) after CRISPR-mediated CD70 knockout. FIG. 14A shows CD70 expression using guide RNA 1. FIG. 14B shows CD70 expression using guide RNA 2. FIG. 14C shows CD70 expression using guide RNA 3. FIG. 14D shows CD70 expression of non-electroporated NK cells. Fig. 14E shows undyed NK cells. These experiments were performed using the KD7 protocol, in which cells were cultured in low IL-2 medium from day 11 to day 21. FIG. 14F shows an additional non-limiting gene editing process.

Figures 15A-15D show flow cytometry data relating to CD70 expression 14 days (21 days total) after CRISPR-mediated CD70 knockout, where NK cells were from the same donor as in figures 12-14 but using a combination of guide RNAs. FIG. 15A shows CD70 expression using guide RNA 1+2. FIG. 15B shows CD70 expression using guide RNA 1+3. FIG. 15C shows CD70 expression using guide RNA 2+3. Fig. 15D and 15E are the same controls as shown in fig. 14D and 14E. These experiments were performed using the KD7 protocol, in which cells were cultured in low IL-2 medium from day 11 to day 21.

Figures 16A-16C show flow cytometry data associated with knockdown of CD70 expression in two different donors. For these experiments, CRISPR-mediated CD70 knockout was performed prior to NK cell expansion using KD0 protocol, where data from day 5 post electroporation is shown. Figure 16A shows data from a first donor, where each of the three guide RNAs were used alone. Figure 16B shows CD70 expression using the same single guide RNA but using NK cells from different donors. Fig. 16C shows control data (donor 2).

Figures 17A-17C show flow cytometry data related to knockdown of CD70 expression in the same two donors as figure 16, where expression was assessed after 8 days (day 13 of KD0 protocol). Figure 17A shows data from a first donor, where each of the three guide RNAs were used alone. Figure 17B shows CD70 expression using the same single guide RNA but using NK cells from different donors. Fig. 17C shows control data (donor 2).

FIGS. 18A-18D show data relating to cytotoxicity against CD70 knock-out NK cells (CD 70-KO-NK) from two donors. FIG. 18A shows cytotoxicity of CD70-KO-NK cells (generated using guide RNA 1, 2 or 3 alone on NK cells from the first donor) against REH cells that did not express CD27 as a ligand for CD70 at the indicated effector: target ratio. FIG. 18B shows cytotoxicity of CD70-KO-NK cells from donor 1 against Jurkat cells expressing CD27. FIG. 18C shows cytotoxicity of CD70-KO-NK cells (NK cells from the second donor) on REH cells. FIG. 18D shows cytotoxicity of CD70-KO-NK cells from donor 2 on Jurkat cells. Cytotoxicity was assessed on day 14.

Fig. 19A-19B relate to a schematic timeline of a protocol for genetic engineering and expansion of NK cells and data related to NK cell expansion.

Fig. 20A-20C show flow cytometry data after CRISPR gene editing of NK cells. FIG. 20A shows CD70 expression of NK cells using three different guide RNAs. Figure 20B shows CD70 expression from NK cells from a second donor and edited using the same guide RNA. Fig. 20C shows the relevant control data.

Fig. 21A-21B show flow cytometry data after CRISPR gene editing of Jurkat cells. Figure 21A shows CD70 expression from Jurkat cells of the first donor after editing with three different guide RNA combinations. Fig. 21B shows control data.

Fig. 22A-22D show flow cytometry data after CRISPR gene editing of Jurkat cells. Fig. 22A shows a sample protocol. Figure 22B shows CD70 expression of Jurkat cells after CRISPR editing using three different guide RNA sets, where the cells remained in culture after gene editing. Fig. 22C shows CD70 expression of Jurkat cells after CRISPR editing using the same guide RNA set, but wherein the cells were frozen after gene editing and then thawed for flow analysis. Figure 23D shows control data.

Figure 23 shows a schematic diagram of a non-limiting embodiment of a gene editing construct for CRISPR modification (knock-in) of an endogenous CD70 locus in NK cells to insert a CD 70-directed CAR construct into the endogenous locus.

Fig. 24A-24F relate to data evaluating engineered expression of CD70 on Jurkat cells and on Jurkat cells subjected to CRISPR gene editing. The left panel of each panel is a negative control and the middle panel is a control using only secondary antibodies. Figure 24A shows data relating to CD70 and GFP expression on natural Jurkat cells. The right panel of fig. 24A indicates that native Jurkat cells express relatively low levels of CD70. Figure 24B shows the expression of CD70 in Jurkat cells engineered to express an elevated marker (e.g., for the purposes of tonic signaling and CD70 CAR screening). As shown in the right panel of fig. 24B, CD70 expression was significantly increased on these Jurkat cells (about 85% of cells were positive for human CD70 and GFP (used as markers for transduced cells). Fig. 24C shows that Jurkat native CD70 expression was reduced by using the first guide RNA and CRISPR gene editing fig. 24D shows that engineered constitutive expression of CD70 on Jurkat cells was maintained even in the face of CRISPR gene editing for CD70 reduction fig. 24E and fig. 24F show similar data regarding maintenance of CD70 expression on engineered Jurkat cells.

Fig. 25 shows a table summarizing CD70 expression data (MFI) for the various conditions shown in fig. 24A-24F. The data indicate that engineered CD70 expressing Jurkat cells exhibit nearly constitutive expression of CD70, even higher than the known high expressing cell line 786-O cells.

Fig. 26A-26C relate to the expression of an anti-CD 70CAR construct on Jurkat cells. As a non-limiting example of an anti-CD 70CAR, jurkat cells were transduced with NK71 or NK72 constructs (schematically depicted in fig. 6). The left panels in fig. 26A-26C are negative controls, the middle panel is a control for the secondary antibody, and the right panels show data relating to the signal detected with the anti-Flag antibody. Figure 26A shows control data related to the detection of Flag expression on Jurkat cells. In some embodiments, the Flag tag is used to detect expression of the CAR construct. In several embodiments, a Flag tag is not included. Fig. 26B shows the expression of NK71 anti-CD 70CAR construct of Jurkat cells, and fig. 26C shows the expression of NK72 anti-CD 70CAR construct of Jurkat cells.

Figures 27A-27F show data relating to the ability of Jurkat cells expressing an anti-CD 70CAR to bind to CD70 in humans. Figure 27A shows data from natural Jurkat cells. From left to right are negative controls, controls for antibodies to human Fc, binding when 2ug/ml of CD70-hFc complex was incubated with Jurkat cells and binding was detected with human Fc-APC antibodies, binding when 10ug/ml of CD70-hFc complex was incubated with Jurkat cells and binding was detected with human Fc-APC antibodies. Figure 27B shows data from natural Jurkat cells. From left to right are control of antibodies against murine Fc, binding when 2ug/ml of CD70 murine Fc complex is incubated with Jurkat cells and binding is detected with murine Fc-APC antibodies, binding when 10ug/ml of CD70 murine Fc complex is incubated with Jurkat cells and binding is detected with murine Fc-APC antibodies, and detection of Flag tag (present in NK71/72CAR construct but not in native Jurkat cells). Fig. 27C shows data from Jurkat cells expressing NK 71. From left to right are negative controls, controls for antibodies to human Fc, binding when 2ug/ml of CD70-hFc complex was incubated with Jurkat cells and binding was detected with human Fc-APC antibodies, binding when 10ug/ml of CD70-hFc complex was incubated with Jurkat cells and binding was detected with human Fc-APC antibodies. FIG. 27D shows data from Jurkat cells expressing NK 71. From left to right are control of antibodies against murine Fc, binding when 2ug/ml of CD70 murine Fc complex is incubated with Jurkat cells and binding is detected with murine Fc-APC antibodies, binding when 10ug/ml of CD70 murine Fc complex is incubated with Jurkat cells and binding is detected with murine Fc-APC antibodies, and detection of Flag tag (present in NK71/72CAR construct but not in native Jurkat cells). Fig. 27E shows data from Jurkat cells expressing NK 72. From left to right are negative controls, controls for antibodies to human Fc, binding when 2ug/ml of CD70-hFc complex was incubated with Jurkat cells and binding was detected with human Fc-APC antibodies, binding when 10ug/ml of CD70-hFc complex was incubated with Jurkat cells and binding was detected with human Fc-APC antibodies. FIG. 27F shows data from Jurkat cells expressing NK 72. From left to right are control of antibodies against murine Fc, binding when 2ug/ml of CD70 murine Fc complex is incubated with Jurkat cells and binding is detected with murine Fc-APC antibodies, binding when 10ug/ml of CD70 murine Fc complex is incubated with Jurkat cells and binding is detected with murine Fc-APC antibodies, and detection of Flag tag (present in NK71/72CAR construct but not in native Jurkat cells).

Fig. 28A-28E show data relating to CRISPR-mediated gene editing of two targets in NK cells. FIG. 28A shows a non-limiting example of an electroporation protocol. In these figures, the expression of NKG2A (along with CD 70) and TGFBR2 (along with CD 70) was evaluated. The knockdown of CD70 expression will be discussed in further detail below. Figure 28B shows expression of NKG2A following exposure of NK cells to CRISPR/guide RNAs targeting NKG 2A. Fig. 28C shows control data. Figure 28D shows expression of TGFBR2 after NK cell exposure to CRISPR/guide RNA targeting TGFBR 2. Fig. 28E shows control data.

Figures 29A-29J show data relating to CRISPR-mediated gene editing of two targets in NK cells and subsequent CAR construct expression 4 days after transduction with CAR encoding vector (11 days after electroporation). Figure 29A shows expression of a non-limiting embodiment of a CD 70-targeted CAR following NK cell exposure to CD70 gRNA. FIG. 29B shows targeted knockdown of CD70 expression on NK cells by editing of CD70 gRNA. FIG. 29C shows anti-CD 70 CAR expression on NK cells after NK cells were exposed to CD70 and CISH gRNA. FIG. 29D shows targeted knockdown of CD70 expression on NK cells by editing of CD70 gRNA and CISH gRNA. Figure 29E shows anti-CD 70 CAR expression on NK cells after NK cells were exposed to CD70 and NKG2A gRNA. FIG. 29F shows targeted knockdown of CD70 expression on NK cells by editing of CD70 gRNA and NKG2A gRNA. Figure 29G shows anti-CD 70 CAR expression on NK cells after NK cells were exposed to CD70 and TGFBR2 gRNA. FIG. 29H shows targeted knockdown of CD70 expression on NK cells by editing of CD70 gRNA and TGFBR2 gRNA. FIG. 29I shows simulated control data for anti-CD 70 expression on NK cells. Fig. 29J shows simulated control data for CD70 expression on NK cells.

Figures 30A-30J show data relating to CRISPR-mediated gene editing of two targets in NK cells and subsequent CAR construct expression 11 days after transduction with CAR encoding vector (18 days after electroporation). Figure 30A shows expression of a non-limiting embodiment of a CD 70-targeted CAR after NK cells are exposed to CD70 gRNA. FIG. 30B shows targeted knockdown of CD70 expression on NK cells by editing of CD70 gRNA. Figure 30C shows anti-CD 70 CAR expression on NK cells after exposure of NK cells to CD70 and CISH gRNA. FIG. 30D shows targeted knockdown of CD70 expression on NK cells by editing of CD70gRNA and CISH gRNA. Figure 30E shows anti-CD 70 CAR expression on NK cells after NK cells were exposed to CD70 and NKG2A gRNA. FIG. 30F shows targeted knockdown of CD70 expression on NK cells by editing of CD70gRNA and NKG2A gRNA. Figure 30G shows anti-CD 70 CAR expression on NK cells after NK cells were exposed to CD70 and TGFBR2 gRNA. FIG. 30H shows targeted knockdown of CD70 expression on NK cells by editing of CD70gRNA and TGFBR2 gRNA. FIG. 30I shows simulated control data for anti-CD 70 expression on NK cells. Figure 30J shows simulated control data for CD70 expression on NK cells.

Figures 31A-31C show summary expression data of a first non-limiting embodiment of an anti-CD 70 CAR on NK cells subjected to gene editing knockout of one or more targets, assessed 11 days post transduction. FIG. 31A shows the expression level of the first non-limiting anti-CD 70 CAR (NK 71) on NK cells treated with CD70 gRNA, CD70 and CISH gRNA, CD70 and NKG2A gRNA, CD70 and TGFBR2 gRNA or with GFP. The data are the percentage of FLAG tag positive NK cells in the NK71CAR construct (several embodiments do not use FLAG tags). Fig. 31B shows the actual raw Mean Fluorescence Intensity (MFI) data. FIG. 31C shows data relating to the extent of CD70 knockdown in NK cells using the indicated gRNA.

Figures 32A-32C show summary expression data of a second non-limiting embodiment of an anti-CD 70 CAR on NK cells subjected to gene editing knockout of one or more targets, assessed 11 days post transduction. FIG. 32A shows the expression level of the first non-limiting anti-CD 70 CAR (NK 72) on NK cells treated with CD70 gRNA, CD70 and CISH gRNA, CD70 and NKG2A gRNA, CD70 and TGFBR2 gRNA or with GFP. The data are the percentage of FLAG tag positive NK cells in the NK72CAR construct (several embodiments do not use FLAG tags). Fig. 32B shows the actual raw Mean Fluorescence Intensity (MFI) data. FIG. 32C shows data relating to the extent of CD70 knockdown in NK cells using the indicated gRNA.

Figures 33A-33B show data relating to changes in NK cell proliferation based on different targets in knocked out NK cells and engineering NK cells to express an anti-CD 70 CAR. Figure 33A shows data for knockdown of CD70 expression and engineered expression of anti-CD 70 CAR (this experiment uses a non-limiting NK71 construct) as well as knockdown of CISH expression resulting in enhanced NK cell proliferation (compared to CD70 knockdown alone). Similar data was shown when CD70 and TGFRB2 were knocked out. In contrast, the knockout of NKG2A resulted in reduced proliferation (compared to CD70 knockout alone). FIG. 33B shows corresponding data of proliferation when NK cells were subjected to the same gene editing program but transduced with constructs encoding the non-limiting example anti-CD 70 CAR (NK 72).

Figures 34A-34B show data relating to NK cell survival based on different targets in knocked out NK cells and engineering NK cells to express an anti-CD 70 CAR. Figure 34A shows the survival data of NK cells engineered to express non-limiting NK71 anti-CD 70 CAR for 35 days (post electroporation). As shown, double knockout of CD70 and TGFBR2 resulted in moderately increased survival (compared to CD70 knockout) over the course of the experimental time. Double CD70 and CISH knockouts resulted in a significant increase in survival, with an approximately 2-fold increase in survival (compared to CD70 alone). The knockout of NKG2A resulted in a decrease in survival, with a slow decline in NK populations from day 21 to day 35. The reduced survival rate of this group made the survival rate of double knockout of CD70-CISH approximately 3 times that of NKG2A group. Fig. 34B shows similar trends between groups of non-limiting NK72 anti-CD 70 CARs. These data also demonstrate that NK71 constructs result in increased survival compared to NK72 constructs, according to some embodiments.

Figures 35A-35D show data relating to cytotoxicity of NK cells expressing an anti-CD 70 CAR and undergoing knockdown of various NK cell modulating targets. FIG. 35A shows the cytotoxic effect of engineered NK cells expressing non-limiting NK71 anti-CD 70 CAR on 786-O cells expressing high levels of CD70 at an E:T ratio of 1:1. FIG. 35B shows the cytotoxic effect of engineered NK cells expressing non-limiting NK71 anti-CD 70 CAR on 786-O cells at an E:T ratio of 1:2. FIG. 35C shows the cytotoxic effect of engineered NK cells expressing non-limiting NK72 anti-CD 70 CAR on 786-O cells at an E:T ratio of 1:1. FIG. 35B shows the cytotoxic effect of engineered NK cells expressing non-limiting NK72 anti-CD 70 CAR on 786-O cells at an E:T ratio of 1:2. Data were collected 7 days after transduction.

Figures 36A-36D show data relating to cytotoxicity of NK cells expressing an anti-CD 70 CAR and undergoing knockdown of various NK cell modulating targets. FIG. 36A shows the cytotoxic effect of engineered NK cells expressing non-limiting NK71 anti-CD 70 CAR on ACHN cells expressing low levels of CD70 at an E:T ratio of 1:1. FIG. 36B shows the cytotoxic effect of engineered NK cells expressing non-limiting NK71 anti-CD 70 CAR on ACHN cells at an E:T ratio of 1:2. FIG. 36C shows the cytotoxic effect of engineered NK cells expressing non-limiting NK72 anti-CD 70 CAR on ACHN cells at an E:T ratio of 1:1. Figure 36D shows the cytotoxic effect of engineered NK cells expressing non-limiting NK72 anti-CD 70 CAR on ACHN cells at an E: T ratio of 1:2. Data were collected 7 days after transduction.

Figures 37A-37B show data relating to cytotoxicity of NK cells expressing an anti-CD 70 CAR and undergoing knockdown of various NK cell modulating targets. FIG. 37A shows the cytotoxic effect of engineered NK cells expressing non-limiting NK71 anti-CD 70 CAR on 786-O cells expressing high levels of CD70 at an E:T ratio of 1:2. FIG. 37B shows the cytotoxic effect of engineered NK cells expressing non-limiting NK71 anti-CD 70 CAR on 786-O cells at an E:T ratio of 1:4. Data were collected 14 days after transduction.

Figures 38A-38B show data relating to cytotoxicity of NK cells expressing an anti-CD 70 CAR and undergoing knockdown of various NK cell modulating targets. FIG. 38A shows the cytotoxic effect of engineered NK cells expressing non-limiting NK71 anti-CD 70 CAR on ACHN cells expressing low levels of CD70 at an E:T ratio of 1:1. FIG. 38B shows the cytotoxic effect of engineered NK cells expressing non-limiting NK71 anti-CD 70 CAR on ACHN cells at an E:T ratio of 1:2. Data were collected 14 days after transduction.

Figures 39A-39B show data relating to cytotoxicity of NK cells expressing an anti-CD 70 CAR and undergoing knockdown of various NK cell modulating targets. FIG. 39A shows the cytotoxic effect of engineered NK cells expressing non-limiting NK72 anti-CD 70 CAR on 786-O cells expressing high levels of CD70 at an E:T ratio of 1:2. FIG. 39B shows the cytotoxic effect of engineered NK cells expressing non-limiting NK72 anti-CD 70 CAR on 786-O cells at an E:T ratio of 1:4. Data were collected 14 days after transduction.

Figures 40A-40B show data relating to cytotoxicity of NK cells expressing an anti-CD 70 CAR and undergoing knockdown of various NK cell modulating targets. FIG. 40A shows the cytotoxic effect of engineered NK cells expressing non-limiting NK72 anti-CD 70 CAR on ACHN cells expressing low levels of CD70 at an E:T ratio of 1:1. FIG. 40B shows the cytotoxic effect of engineered NK cells expressing non-limiting NK71 anti-CD 70 CAR on ACHN cells at an E:T ratio of 1:2. Data were collected 14 days after transduction.

Figures 41A-41O relate to gene editing protocols and evaluation of expression of various editing targets and expression of anti-CD 70 CAR. FIG. 41A shows a non-limiting embodiment of the gene editing scheme employed. Fig. 41B shows an undyed control (no anti-CD 70 antibody) representing background signal. Figure 41B shows a control in which CD70 expression is measured on NK cells transduced with CARs that do not target CD70 and do not include the CD70 subunit. This represents baseline NK cell CD70 expression. FIG. 41D shows CD70 expression on NK cells subjected to gene editing to knock out CD70 expression. Figure 41E shows non-limiting NK71 anti-CD 70 CAR expression on NK cells knocked out of CD70 expression. FIG. 41F shows CD70 expression on NK cells subjected to gene editing to knock out CD70 expression. Figure 41G shows the expression of non-limiting NK72 anti-CD 70 CAR on NK cells knocked out of CD70 expression. FIG. 41H shows CD70 expression on NK cells subjected to gene editing to knock out CD70 and CISH expression. Figure 41F shows the expression of non-limiting NK71 anti-CD 70 CAR on NK cells knocked out of CD70 and CISH expression. FIG. 41J shows CD70 expression on NK cells subjected to gene editing to knock out CD70 and CISH expression. FIG. 41GK shows the expression of non-limiting NK72 anti-CD 70 CAR on NK cells knocked out of CD70 and CISH expression. Fig. 41L shows CD70 expression on NK cells subjected to electroporation alone as a control. Fig. 41M shows, as a control, the expression of non-limiting NK71 anti-CD 70 CAR on NK cells subjected to electroporation only. Fig. 41N shows CD70 expression on NK cells subjected to electroporation alone as a control. Fig. 41O shows, as a control, the expression of non-limiting NK72 anti-CD 70 CAR on NK cells subjected to electroporation only.

Fig. 42A-42C relate to cytotoxicity data of NK cells subjected to gene editing and engineering to express an anti-CD 70 CAR. FIG. 42A shows cytotoxicity of NK cells treated in the indicated manner against 786-O cells expressing high levels of CD70 at 7 days post transduction and at an E:T ratio of 1:2. FIG. 42B shows cytotoxicity of NK cells treated in the indicated manner on ACHN cells expressing low levels of CD70 was evaluated 7 days after transduction and at an E:T ratio of 1:2. FIG. 42C shows cytotoxicity of NK cells treated in the indicated manner on 786-O cells expressing high levels of CD70 at 7 days post transduction and at an E:T ratio of 1:2.

FIGS. 43A-43I relate to CD70 expression on NK cells using various guide RNAs (7 days post electroporation). FIG. 43A shows CD70 expression levels of NK cells gene edited using gRNA 1 to knock out CD70 expression. FIG. 43B shows CD70 expression levels of NK cells gene edited using gRNA 2 to knock out CD70 expression. FIG. 43C shows CD70 expression levels of NK cells gene edited using gRNA 3 to knock out CD70 expression. FIG. 43D shows CD70 expression levels of NK cells gene edited using gRNAs 1 and 3 to knock out CD70 expression. FIG. 43E shows CD70 expression levels of NK cells gene edited using gRNA 1 and 2 to knock out CD70 expression. FIG. 43F shows CD70 expression levels of NK cells gene edited using gRNA 2 and 3 to knock out CD70 expression. FIG. 43G shows CD70 expression levels of NK cells using gRNA 1 (for CD 70) gene editing to knock out CD70 expression and using guide RNA to knock out CISH. FIG. 43H shows the level of CD70 expression in NK cells using gRNA 1 (for CD 70) gene editing to knock out CD70 expression and using guide RNA to knock out adenosine receptor (A2 AR). FIG. 43I shows control data (without gene editing enzyme or guide RNA) from NK cells subjected to electroporation alone.

Figures 44A-44D relate to the evaluation of cytotoxicity of NK cells (NK 71, an anti-CD 70 CAR, used herein as a non-limiting embodiment) subjected to various gene editing protocols and engineered to express an anti-CD 70 CAR. FIG. 44A shows cytotoxicity of NK cells against Reh tumor cells indicated at 1:1 or 1:2 effector:target ratio. FIG. 44B shows a summary histogram of cytotoxicity at 1:1. FIG. 44C shows a summary histogram of cytotoxicity at 1:2. FIG. 44D shows cytotoxicity of the indicated constructs against Nalm-6 tumor cells.

Fig. 45A-45B relate to the evaluation of cytotoxicity of NK cells (NK 71, an anti-CD 70 CAR, used herein as a non-limiting embodiment) subjected to various gene editing protocols and engineered to express an anti-CD 70 CAR. FIG. 45A shows cytotoxicity of NK cells against Reh tumor cells indicated at a 1:1E:T ratio. FIG. 45B shows cytotoxicity of NK cells against Reh tumor cells indicated at a ratio of 1:2 E:T.

Figures 46A-46J show data relating to the expression of anti-CD 70 CAR in NK cells genetically edited to knock out native CD70 expression (and/or CISH or adenosine receptor expression) and the expression of native CD70 of NK cells. Figure 46A shows data for anti-CD 70 CAR expression and native CD70 expression levels of NK cells gene-edited using gRNA 1 (for CD 70). Figure 46B shows data for anti-CD 70 CAR expression and native CD70 expression levels of NK cells gene-edited using gRNA 2 (for CD 70). Figure 46C shows data for anti-CD 70 CAR expression and native CD70 expression levels of NK cells gene-edited using gRNA 3 (for CD 70). Figure 46D shows data for anti-CD 70 CAR expression and native CD70 expression levels of NK cells gene-edited using gRNAs 1 and 3 (both for CD 70). Figure 46E shows data for anti-CD 70 CAR expression and native CD70 expression levels of NK cells gene-edited using gRNAs 2 and 3 (both for CD 70). Figure 46F shows data for anti-CD 70 CAR expression and native CD70 expression levels of NK cells gene-edited using gRNAs 1 and 2 (both for CD 70). Figure 46G shows data for anti-CD 70 CAR expression and native CD70 expression levels of NK cells gene-edited using gRNA 1 (for CD 70) and additional gRNA for CISH knockdown. FIG. 46H shows data for anti-CD 70 CAR expression and native CD70 expression levels of NK cells gene edited using gRNA 1 (for CD 70) and additional gRNA for knockdown of adenosine receptor (A2 AR) expression. Figure 46I shows control data in which NK cells were electroporated only, without using gRNA or engineered CAR expression. FIG. 46J shows control data for untransduced NK cells.

Figures 47A-47F show cytotoxicity data relating to gene-edited NK cells expressing an anti-CD 70 CAR against tumor cells. FIG. 47A shows cytotoxicity data of NK cells versus 786-O cells indicated at a 1:2E:T ratio. FIG. 47B shows cytotoxicity data of NK cells versus 786-O cells indicated at a ratio of 1:4E:T. FIG. 47C shows cytotoxicity data of NK cells versus 786-O cells indicated at a ratio of 1:8 E:T. FIG. 47D shows cytotoxicity data of NK cells against ACHN cells indicated at a ratio of 1:2 E:T. FIG. 47E shows cytotoxicity data of NK cells against ACHN cells indicated at a ratio of 1:4E:T. FIG. 47F shows cytotoxicity data of NK cells against ACHN cells indicated at a ratio of 1:8 E:T.

FIGS. 48A-48D show cytotoxicity data from various genetically edited NK cells that were also engineered to express anti-CD 70 CAR against tumor cells. FIG. 48A shows cytotoxicity data against 786-O cells from indicated genetically edited NK cells expressing anti-CD 70 CAR at a 1:1 ratio, where the data was collected 72 hours after co-culture with tumor cells. Fig. 48B shows summary data for GFP detection (surrogate for viable tumor cell number) measured as a percentage of baseline GFP detection (time zero cut). FIG. 48C shows cytotoxicity data against 786-O cells from indicated genetically edited NK cells expressing anti-CD 70 CAR at a ratio of 1:2, with data collected 72 hours after co-culture with tumor cells. Fig. 48D shows summary data for GFP detection (surrogate for viable tumor cell number) measured as a percentage of baseline GFP detection (time zero cut).

Fig. 49A-49D show schematic and knockout data from various additional genetically edited NK cells that were also engineered to express anti-CD 70 CARs against tumor cells. Fig. 49A shows a schematic of a process in which NK cells are first genetically edited (e.g., with CRISPR) to knock out both CD70 and target genes, amplified, transduced with an NK71 anti-CD 70 CAR construct (which is a non-limiting example of a CAR according to the present disclosure), and then assayed for efficacy in killing tumors. FIG. 49B shows the percentage of CD70 expression consistent on day 7 after double knockout of CD70 and target gene for different target gene conditions. Figure 49C shows substantially undetectable CD70 expression and consistent expression of non-limiting NK71CAR at day 10 after double knockout of CD70 and target gene under different target gene conditions. FIG. 49D shows PCR amplification data and amplicon indel frequency for target gene loci of knocked out NK cell populations.

FIGS. 49E-49G show cytotoxicity data for NK cells genetically edited for SMAD3. FIG. 49E shows successful smaD3 knockout in NK cell populations. FIG. 49F shows cytotoxicity data against 786-O cells from NK cells expressing SMAD3 or CISH gene editing of NK71CAR at a 1:4 ratio with or without 20ng/mL TGFb treatment for a period of up to 6.5 days. FIG. 49G shows the percentage of 786-O cells remaining after 3 days of treatment with SMAD3 or CISH gene-edited NK cells expressing the non-limiting example of NK71 of CAR at a 1:1 ratio, with or without 20ng/mL TGFb, relative to the initial amount.

FIGS. 49H-49I show cytotoxicity data of NK cells gene edited for A2 AR. FIG. 49H shows cytotoxicity data against 786-O cells from NK cells expressing A2AR or CISH gene editing of NK71 CAR at a 1:4 ratio with or without 10 μM NECA treatment for a period of up to 6 days. FIG. 49I shows the percentage of 786-O cells remaining after 3 days post treatment with NK cells edited with the A2AR or CISH gene expressing NK71 CAR at a 1:1 ratio with or without 10 μM NECA relative to the initial amount.

FIGS. 49J-49K show cytotoxicity data of NK cells genetically edited for MAPKAPK 3. FIG. 49J shows cytotoxicity data against 786-O cells from NK cells expressing MAPKAPK3 (MK 3) of NK71 CAR or CISH gene editing at a 1:2 ratio for a period of up to 94 hours. FIG. 49K shows the percentage of 786-O cells remaining after 3 days post treatment with NK cells edited with MK3 or CISH genes expressing NK71 CAR at a 1:1 ratio relative to the initial amount.

FIGS. 49L-49P show cytotoxicity data of NK cells genetically edited for NKG 2A. FIG. 49L shows cytotoxicity data against 786-O cells from NK cells edited by NKG2A or CISH gene expressing NK71 CAR at a 1:1 ratio for a period of up to 72 hours. FIG. 49M shows cytotoxicity data against 786-O cells from NK cells expressing NK71 CAR at a ratio of 1:1 for a period of up to 94 hours for NKG2A, MK3 or CISH gene-edited NK cells. FIG. 49N shows cytotoxicity data against 786-O cells from NK cells expressing NKG2A, MK3 of NK71 CAR or CISH gene-edited at a ratio of 1:2 for a period of up to 94 hours. FIG. 49O shows cytotoxicity data against 786-O cells from NK cells edited with NKG2A or CISH gene expressing NK71 CAR at a 1:1 ratio with or without 20ng/mL TGFb treatment for a period of up to 72 hours. FIG. 49P shows cytotoxicity data against 786-O cells from NK cells edited with NKG2A or CISH gene expressing NK71 CAR at a 1:2 ratio with or without 10. Mu.M NECA treatment for a period of up to 54 hours.

FIGS. 49Q-49R show cytotoxicity data of NK cells for gene editing against DDIT 4. FIG. 49Q shows the results from the use or absence of 50 μM CoCl over a period of up to 94 hours ₂ Cytotoxicity data of NK cells expressing DDIT4 or CISH gene editing of NK71 CAR at a 1:1 ratio against 786-O cells with the treatment. FIG. 49R shows the use or absence of 50. Mu.M CoCl ₂ In the case of treatment, the percentage of 786-O cells remaining after 3 days after treatment with NK cells edited with DDIT4 or CISH gene expressing NK71 CAR at a 1:1 ratio relative to the initial amount.

FIGS. 49S-49T show cytotoxicity data of NK cells gene edited for CEACAM 1. FIG. 49S shows cytotoxicity data against 786-O cells from NK cells edited by CEACAM1 or CISH gene expressing NK71 CAR at a 1:2 ratio with or without treatment with 1 μg/mL CEACAM5 for a period of up to 72 hours. FIG. 49T shows the percentage of 786-O cells remaining after 3 days of treatment with CEACAM1 expressing NK71 CAR or CISH gene-edited NK cells at a 1:2 ratio with or without treatment with 1 μg/mL CEACAM5 relative to the initial amount.

Fig. 49U and 49V show the survival rate of NK cells expressing NK71 CAR over 49 days that had undergone gene editing for CD70 and various indicated gene targets.

FIG. 50A depicts exemplary heavy chain variable region (VH) and light chain variable region (VL) peptides and nucleic acid sequences of selected anti-CD 70scFv disclosed herein. The sequences disclosed herein may be used in any of the embodiments disclosed herein.

FIG. 50B depicts exemplary heavy and light chain variable region Complementarity Determining Regions (CDRs) of selected anti-CD 70scFv disclosed herein. In some embodiments, other combinations of CDRs may be used to prepare other anti-CD 70scFv or other binding domains. The CDRs disclosed herein can be used in any of the embodiments disclosed herein.

Fig. 50C depicts a schematic for selecting CARs comprising an anti-CD 70 binding domain based on tonic signaling and immune cell activation.

Fig. 50D shows data related to the detection of the degree of tonic signaling in the Jurkat line.

Figure 50E shows CAR activation associated with tonic signaling in Jurkat cells expressing the disclosed anti-CD 70 CAR further directed by overall CAR expression. Circled dots depict selected non-limiting embodiments of the anti-CD 70 CAR construct that resulted in significant on-target activation associated with tonic signaling.

Figure 50F shows a non-limiting list of 10 anti-CD 70 CAR constructs selected to have the desired activation and limited/minimal tonic signaling effects in Jurkat cells. These constructs were tested in additional assays disclosed herein.

FIGS. 51A-51B show the expression levels of anti-CD 70 CAR tested in donor NK cell population genes edited to knock out CD 70. Fig. 51A shows a flow cytometry plot of detection of CAR expression (by anti-FLAG antibody conjugated with Allophycocyanin (APC)) and loss of CD70 expression (by anti-CD 70 antibody conjugated with Phycoerythrin (PE)). FIG. 51B shows quantification of anti-CD 70 CAR and CD70 expression in the NK cell population of FIG. 51A. NK8 refers to the control structure expressing GFP instead of CAR/mbiL 15.

Fig. 52A-52D show the expression level of anti-CD 70 CAR tested in another donor NK cell population edited to knock out CD70, as well as the preliminary cytotoxicity assays. Figure 52A shows detection of CAR expression (by anti-FLAG antibody conjugated to APC) and loss of CD70 expression (onVia anti-CD 70 antibody conjugated to PE). Figure 52B shows quantification of anti-CD 70 CAR and CD70 expression in the NK cell population of figure 52A. Fig. 52C shows the raw Mean Fluorescence Intensity (MFI) used to quantify CAR expression. FIG. 52D shows cytotoxicity assays against 786-O tumor cells of an anti-CD 70 CAR NK cell population at different effector to target (E: T) ratios and ECs calculated from the assays ₅₀ 。

Figures 53A-53F show cytotoxicity data for anti-CD 70 CAR tested in CD70 knockout NK cells. FIG. 53A shows cytotoxicity data of NK cells tested against 786-O cells at a 1:2 ratio over up to 7 days. FIG. 53B shows the remaining 786-O cells 73.5 hours after NK cell 1:2 co-culture as measured by 786-O GFP fluorescence. Fig. 53C shows cytotoxicity data for the tested NK cells of fig. 53A, but extended to 10 days. On day 7, the cultures were re-stimulated with additional tumor cells. FIG. 53D shows cytotoxicity data of NK cells tested against 786-O cells at a 1:4 ratio for up to 7 days. FIG. 53E shows the remaining 786-O cells 73.5 hours after NK cell 1:4 co-culture as measured by 786-O GFP fluorescence. FIG. 53F shows cytotoxicity data of NK cells tested against 786-O cells at a ratio of 1:8 for up to 7 days.

Figures 54A-54D show cytotoxicity data of anti-CD 70 CARs tested in CD70 knockout NK cells against 786-O cells or ACHN cells. FIG. 54A shows cytotoxicity data of NK cells tested against 786-O cells at a 1:2 ratio over up to 5 days. 786-O cells expressed GFP. Fig. 54B shows cytotoxicity data of NK cells tested against ACHN cells at a 1:2 ratio over up to 5 days. ACHN cells were stained with NucRed. FIG. 54C shows cytotoxicity data of NK cells tested against 786-O cells at a 1:4 ratio for up to 5 days. Fig. 54D shows cytotoxicity data of NK cells tested against ACHN cells at a 1:4 ratio for up to 5 days.

Figures 55A-55M show cytotoxicity data for anti-CD 70CAR tested in CD70 knockdown NK cells from one donor. FIG. 55A shows detection of loss of expression of CAR (by APC anti-FLAG) and CD70 expressionFlow cytometry plots were omitted (by PE anti-CD 70). FIG. 55B shows preliminary cytotoxicity data of NK cells tested against 786-O cells at different E:T ratios for 4 hours of co-culture. FIG. 55C shows the measured expressed anti-CD 70CAR from FIG. 55B, loss of CD70 expression and calculated EC ₅₀ Is a quantitative measure of (3). FIG. 55D shows cytotoxicity data of NK cells tested against 786-O cells at a 1:2 ratio over a period of up to 64 hours. FIG. 55E shows cytotoxicity data of NK cells tested against 786-O cells at a 1:2 ratio over up to 6 days. FIG. 55F shows cytotoxicity data of NK cells tested against 786-O cells at a 1:2 ratio over up to 7 days. Fig. 55G shows cytotoxicity data for NK cells tested as seen in fig. 55F, but extended to 11 days and re-stimulated with additional tumor cells on day 7. FIG. 55H shows the remaining 786-O cells 51 hours after NK cell 1:2 co-culture as measured by 786-O GFP fluorescence. FIG. 55I shows the remaining 786-O cells 66 hours after NK cell 1:2 co-culture as measured by 786-O GFP fluorescence. FIG. 55J shows cytotoxicity data of NK cells tested against 786-O cells at a ratio of 1:4 for up to 64 hours. FIG. 55K shows cytotoxicity data of NK cells tested against 786-O cells at a 1:4 ratio over up to 6 days. FIG. 55L shows cytotoxicity data of NK cells tested against 786-O cells at a 1:4 ratio over up to 7 days. FIG. 55M shows cytotoxicity data of NK cells tested against 786-O cells at a ratio of 1:4 for up to 11 days. On day 7, the cultures were re-stimulated with additional tumor cells.

Figures 56A-56J show cytotoxicity data for anti-CD 70CAR tested in CD70 knockout NK cells from another donor. Figure 56A shows a flow cytometry plot of detection of CAR expression (by APC anti-FLAG) and loss of CD70 expression (by PE anti-CD 70). FIG. 56B shows preliminary cytotoxicity data of NK cells tested against 786-O cells at different E:T ratios for 4 hours of co-culture. FIG. 56C shows the measured expressed anti-CD 70CAR from FIG. 56B, loss of CD70 expression and calculated EC ₅₀ Is a quantitative measure of (3). FIG. 56D shows NK cells tested against 786-O fines at a 1:2 ratio for up to 5.75 daysCytotoxicity data of cells. Fig. 56E shows cytotoxicity data for NK cells tested as seen in fig. 56H, but extended to 10 days and re-stimulated with additional tumor cells on day 6. FIG. 56F shows cytotoxicity data of NK cells tested against 786-O cells at a ratio of 1:4 for up to 42 hours. FIG. 56G shows cytotoxicity data of NK cells tested against 786-O cells at a 1:4 ratio over up to 5 days. FIG. 56H shows cytotoxicity data of NK cells tested against 768-O cells at a ratio of 1:4 for up to 5.75 days. FIG. 56I shows cytotoxicity data of NK cells tested against 786-O cells at a ratio of 1:8 for up to 42 hours. FIG. 56J shows cytotoxicity data of NK cells tested against 786-O cells at a ratio of 1:8 for up to 5 days.

Figures 57A-57H show cytotoxicity data ACHN for ACHN cells tested against CD70CAR in CD70 knockdown NK cells from one donor. Fig. 57A shows cytotoxicity data of NK cells tested against ACHN cells at a 1:2 ratio over up to 5 days. At about day 3.75, the culture was re-stimulated with additional tumor cells. Fig. 57B shows the cytotoxicity data of fig. 57A, but with cell counts normalized to day 0. Fig. 57C shows cytotoxicity data of the tested NK cells of fig. 57B over a longer period of time after re-challenge. FIG. 57D shows residual ACHN cells 51 hours after NK cell 1:2 co-culture as measured by ACHN fluorescence. FIG. 57E shows residual ACHN cells 66 hours after NK cell 1:2 co-culture as measured by ACHN fluorescence. Fig. 57F shows cytotoxicity data of NK cells tested against ACHN cells at a 1:4 ratio for up to 5 days. At about day 3.75, the culture was re-stimulated with additional tumor cells. Fig. 57G shows the cytotoxicity data of fig. 57F, but with cell counts normalized to day 0. Fig. 57H shows cytotoxicity data of the tested NK cells of fig. 57G over a longer period of time after re-challenge.

Figures 58A-58H show cytotoxicity data ACHN for ACHN cells tested against CD70 CAR in CD70 knockdown NK cells from another donor. Fig. 58A shows cytotoxicity data of NK cells tested against ACHN cells at a 1:4 ratio for up to 5 days. At about day 3.75, the culture was re-stimulated with additional tumor cells. Fig. 58B shows the cytotoxicity data of fig. 58A, but with cell counts normalized to day 0. Fig. 58C shows cytotoxicity data of the tested NK cells of fig. 58B over a longer period of time after re-challenge. FIG. 58D shows the remaining ACHN cells 51 hours after NK cell 1:4 co-culture as measured by ACHN fluorescence. FIG. 58E shows residual ACHN cells 66 hours after NK cell 1:4 co-culture as measured by ACHN fluorescence. Fig. 58F shows cytotoxicity data of NK cells tested against ACHN cells at a 1:8 ratio over up to 5 days. At about day 3.75, the culture was re-stimulated with additional tumor cells. Fig. 58G shows the cytotoxicity data of fig. 58D, but with cell counts normalized to day 0. Fig. 58H shows cytotoxicity data of the tested NK cells of fig. 58G over a longer period of time after re-challenge.

FIGS. 59A-59D show the expression level and preliminary cytotoxicity data of additional anti-CD 70 CAR in NK cells genetically edited to knock out CD70 in one donor. Fig. 59A shows a flow cytometry plot detecting expression of CAR (by APC anti-FLAG) and loss of expression of CD70 (by PE anti-CD 70). Figure 59B shows quantification of anti-CD 70 CAR and CD70 expression in the NK cell population of figure 59A. Fig. 59C shows MFI for quantifying CAR expression. FIG. 59D shows cytotoxicity assays of anti-CD 70 CAR NK cell populations against 786-O tumor cells at different effector: target ratios and ECs calculated from the assays ₅₀ 。

Figures 60A-60O show cytotoxicity data of anti-CD 70 CAR tested in CD70 knockout NK cells from donor against 786-O or ACHN tumor cells. FIG. 60A shows cytotoxicity data of NK cells tested against 786-O cells at a 1:2 ratio over a period of up to 51 hours. Fig. 60B shows cytotoxicity data for the tested NK cells of fig. 60A with extension to 90 hours and re-priming with additional tumor cells at 70 hours. FIG. 60C shows the remaining 786-O cells 51 hours after NK cell 1:2 co-culture as measured by 786-O fluorescence. FIG. 60D shows the remaining 786-O cells 66 hours after NK cell 1:2 co-culture as measured by 786-O fluorescence. Figure 60E shows cytotoxicity data of NK cells tested against ACHN cells at a 1:2 ratio over up to 51 hours. Fig. 60F shows cytotoxicity data for the tested NK cells of fig. 60E with extension to 90 hours and re-priming with additional tumor cells at 70 hours. FIG. 60G shows the remaining ACHN cells 51 hours after NK cell 1:2 co-culture as measured by ACHN fluorescence. FIG. 60H shows the remaining ACHN cells 66 hours after NK cell 1:2 co-culture as measured by ACHN fluorescence. FIG. 60I shows cytotoxicity data of NK cells tested against 786-O cells at a ratio of 1:4 for up to 51 hours. FIG. 60J shows cytotoxicity data of the tested NK cell cultures of FIG. 60I, but prolonged to 90 hours and re-stimulated with additional tumor cells at 70 hours. FIG. 60K shows the remaining 786-O cells 51 hours after NK cell 1:4 co-culture as measured by 786-O fluorescence. FIG. 60L shows the remaining 786-O cells 66 hours after NK cell 1:4 co-culture as measured by 786-O fluorescence. Figure 60M shows cytotoxicity data of NK cells tested against ACHN cells at a 1:4 ratio over up to 51 hours. Figure 60N shows cytotoxicity data of the NK cell cultures tested of figure 60M, but extended to 90 hours and re-stimulated with additional tumor cells at 70 hours. FIG. 60O shows the remaining ACHN cells 51 hours after NK cell 1:4 co-culture as measured by ACHN fluorescence. FIG. 60P shows the remaining ACHN cells 66 hours after NK cell 1:4 co-culture as measured by ACHN fluorescence.

Fig. 61A-61N show expression levels and cytotoxicity data of additional anti-CD 70 CARs in NK cells genetically edited to knock out CD70 in another donor. Fig. 61A shows a flow cytometry plot showing the knockout of CD70 in a donor (denoted donor 512). Fig. 61B shows a flow cytometry plot to detect expression of CAR (by APC anti-FLAG) and loss of expression of CD70 (by PE anti-CD 70). Figure 61C shows quantification of anti-CD 70 CAR and CD70 expression in the NK cell population of figure 61B. Fig. 61D shows the original MFI used to quantify CAR expression of fig. 61B. Figure 61E shows the% abundance of anti-CD 70 CAR tested after 1 week of culture. Figure 61F shows the original MFI of the anti-CD 70 CAR tested after 1 week of culture. Figure 61G shows the% abundance of anti-CD 70 CAR tested after 2 weeks of culture. Figure 61H shows the original MFI of the anti-CD 70 CAR tested after 2 weeks of culture. Figure 61I shows the% abundance of anti-CD 70 CAR tested after 3 weeks of culture. Figure 61J shows the original MFI of the anti-CD 70 CAR tested after 3 weeks of culture. FIG. 61K shows cytotoxicity data of NK cells tested against 786-O cells at a 1:2E:T ratio at 3 days of total 14 days of culture. FIG. 61L shows cytotoxicity data of NK cells tested against 786-O cells at a 1:4E:T ratio at 3 days of total 14 days of culture. Figure 61M shows cytotoxicity data of NK cells tested against ACHN cells at a 1:2 ratio at 3 days of 14 day total culture. Figure 61N shows cytotoxicity data of NK cells tested against ACHN cells at a 1:4 ratio at 3 days of 14 day total culture.

Figures 62A-62B show NK cell viability over 5 weeks (weeks 0 to 5) following transduction with the tested anti-CD 70 CAR. Figure 62A shows the viability of NK cells from one donor (denoted donor 451). Fig. 62B shows the viability of NK cells from another donor (denoted donor 512).

Figures 63A-63B show cytotoxicity data for tested NK cell genes expressing an anti-CD 70 CAR and genetically edited to knock out CD70 and optionally CISH. FIG. 63A shows cytotoxicity data of NK cells tested against 786-O cells at a ratio of 1:8 over a period of up to 64 hours. Fig. 63B shows cytotoxicity data of NK cells tested against ACHN cells at a 1:8 ratio over up to 64 hours.

Figures 64A-64J show additional data relating to screening of various CD70 CAR constructs expressed by NK cells and characterization of CD70 gene knockout. Figure 64A shows data indicating the CD70 CAR construct and its ability to bind to the trimer of CD70 (native CD70 conformation) when expressed by NK cells, as measured at week 1 post CAR transduction (week 1 post phenotypic analysis of CD70 expression after gene editing shown in figures 61A-61B). Fig. 64B shows similar data from another donor. Figures 64C and 64D show summary data from flow cytometry binding data expressed as a percentage of NK cell populations binding to CD70 trimer or as the Mean Fluorescence Intensity (MFI) of the assays of two corresponding donors. Figures 64E and 64F show graphical summary data of the relative expression of each indicated CAR construct by NK cells, as measured by MFI. Fig. 64G and 64H show flow cytometry plots depicting knockdown of CD70 expression in NK cells from two donors, and fig. 64I and 64J show summary data of CD70 expressing NK cell percentages and MFI for two donors.

Figures 65A-65J show additional data relating to the screening of various CD70 CAR constructs expressed by NK cells and characterization of CD70 gene knockout, measured 2 weeks after NK cell transduction with CAR. Figure 65A shows data indicating the CD70 CAR construct and its ability to bind to native CD70 trimer when expressed by NK cells. Fig. 65B shows similar data from another donor. Fig. 65C and 65D show summary data from flow cytometry binding data expressed as a percentage of NK cell populations binding to CD70 trimer or as the Mean Fluorescence Intensity (MFI) of the assays of the two corresponding donors. Figures 65E and 65F show graphical summary data of the relative expression of each indicated CAR construct by NK cells, as measured by MFI. Figures 65G and 65H show flow cytometry plots depicting sustained CD70 expression knockdown in NK cells from each of the two donors. Figures 65I and 65J show summary data of percentage of NK cells expressing CD70 (expressed as%) and MFI for two donors.

Fig. 66A-66I show additional data relating to the screening of various CD70 CAR constructs expressed by NK cells and characterization of CD70 gene knockout, measured 3 weeks after NK cell transduction with CAR. Figure 66A shows data indicating the CD70 CAR construct and its ability to bind to natural CD70 trimers when expressed by NK cells. Fig. 66B shows similar data from another donor. Figure 66C shows summary data from flow cytometry binding data expressed as a percentage of NK cell populations binding to CD70 trimer or as the Mean Fluorescence Intensity (MFI) detected for two corresponding donors. Figures 66D and 66E show graphical summary data of the relative expression of each indicated CAR construct by NK cells, as measured by MFI. Figures 66F and 66G show flow cytometry plots depicting sustained CD70 expression knockdown in NK cells from each of the two donors. Figures 66H and 66I show summary data of percentage of NK cells expressing CD70 (expressed as%) and MFI and percent viability for both donors.

Fig. 67A-67J show additional data relating to the screening of various CD70 CAR constructs expressed by NK cells and characterization of CD70 gene knockout, measured 4 weeks after NK cell transduction with CAR. Figure 67A shows data indicating the CD70 CAR construct and its ability to bind to natural CD70 trimers when expressed by NK cells. Fig. 67B shows similar data from another donor. Fig. 67C and 67D show summary data from flow cytometry binding data expressed as a percentage of NK cell populations binding to CD70 trimer or as the Mean Fluorescence Intensity (MFI) of the assays of two corresponding donors. Fig. 67E and 67F show graphical summary data of the relative expression of each indicated CAR construct by NK cells, as measured by MFI. Fig. 67G and 67H show flow cytometry plots depicting sustained CD70 expression knockdown in NK cells from each of the two donors. Figures 67I and 67J show summary data of percentage of NK cells expressing CD70 (expressed as%) and MFI for two donors.

Fig. 68A-68I show additional data relating to the screening of various CD70 CAR constructs expressed by NK cells and characterization of CD70 gene knockout, measured 5 weeks after NK cell transduction with CAR. Figure 68A shows data indicating the CD70 CAR construct and its ability to bind to natural CD70 trimers when expressed by NK cells. Fig. 68B shows similar data from another donor. Fig. 68C and 65D show summary data from flow cytometry binding data expressed as a percentage of NK cell populations binding to CD70 trimer or as the Mean Fluorescence Intensity (MFI) of the assays of the two corresponding donors. Fig. 68E and 68F show graphical summary data of the relative expression of each indicated CAR construct by NK cells, as measured by MFI. FIGS. 68G and 68H show flow cytometry plots depicting CD70 expression knockdown maintained in NK cells from each of two donors. Figure 68I shows summary data of percentage of CD70 expressing NK cells (expressed as%) and MFI for the two donors.

Fig. 69A-69H show additional data relating to the screening of various CD70CAR constructs expressed by NK cells and characterization of CD70 gene knockout, measured 7 weeks after NK cell transduction with CAR. Figure 69A shows data indicating a CD70CAR construct and its ability to bind to a native CD70 trimer when expressed by NK cells, and figure 68B shows corresponding data from another donor. Figure 69C shows summary data from flow cytometry binding data expressed as a percentage of NK cell populations binding to CD70 trimer or as the Mean Fluorescence Intensity (MFI) detected for two corresponding donors. Fig. 69D and 69E show graphical summary data of relative expression of each indicated CAR construct by NK cells, as measured by MFI. Figures 69F and 69G show flow cytometry plots depicting sustained CD70 expression knockdown in NK cells from each of the two donors. Figure 69H shows summary data for percentage of CD70 expressing NK cells (expressed as%) and MFI for two donors.

Figures 70A-70B show data relating to the expression of selected non-limiting anti-CD 70 CARs of NK cells as a function of time. Figure 70A tracks the expression of three non-limiting CARs on NK cells from a first donor, and figure 70B tracks the expression of the same CAR on NK cells from a second donor.

Figures 71A-71T show data relating to cytokines released by NK cells from one of two donors expressing various CD70 CAR constructs (and edited to knock out CD 70) when co-cultured with ACHN or 786-O tumor cells at different effector: target ratios. Figures 71A and 71B show the level of interferon-gamma release when cells from a first donor were co-cultured with 786-O cells (figure 71A) or ACHN cells (figure 71B) at a 1:2e:t ratio, with data collected on day 14 and day 28 after the process for producing genetically edited and transduced cells began (e.g., D0 of the non-limiting exemplary process shown in figure 49A). Fig. 71C and 71D show corresponding data from a second donor. FIGS. 71E and 71F show the level of GMCSF release when cells from the first donor were co-cultured with 786-O cells (FIG. 71E) or ACHN cells (FIG. 71F) at a 1:2E:T ratio, with data collected on days 14 and 28 after initiation of the cell production process. Fig. 71G and 71H show corresponding data from a second donor. FIGS. 71I and 71J show the levels of TNF- α release when cells from the first donor were co-cultured with 786-O cells (FIG. 71I) or ACHN cells (FIG. 71J) at a 1:2E:T ratio, with data collected on days 14 and 28 after the start of the cell production process. Fig. 71K and 71L show the corresponding data from the second donor. Figures 71M and 71N show the level of perforin release when cells from the first donor were co-cultured with ACHN cells (figure 71M) or ACHN cells (figure 71N) at a 1:2e:t ratio, with data collected on days 14 and 28 after the start of the cell production process. Fig. 71O and 71P show corresponding data from a second donor. FIGS. 71Q and 71R show the levels of granzyme B release when cells from the first donor were co-cultured with 786-O cells (FIG. 71Q) or ACHN cells (FIG. 71R) at a 1:2E:T ratio, with data collected on days 14 and 28 after the start of the cell production process. Fig. 71S and 71T show the corresponding data from the second donor.

Figures 72A-72M show data relating to sustained persistence (both CAR expression and cell viability) and cytotoxicity of NK cells expressing CD70 CAR and edited to knock out one or both of CD70 and CISH. Figure 72A shows the expression data of the indicated CAR during 8 weeks post transduction, as measured by the percentage of the population expressing CAR. Fig. 72B shows similar data as measured by MFI. Fig. 72C shows data relating to the viability of NK cells during 8 weeks in vitro. FIG. 72D shows data relating to cytotoxicity of NK cells expressing the indicated CAR against 786-O cells at 1:8 E:T. Fig. 72E is a histogram depicting the final green target count/well (indicative of the remaining tumor cell population) for each construct from fig. 72D. Figures 72F and 72G are histograms showing tumor cell counts for ACHN cells (figure 72F) or 786-O cells (figure 72G) at a final time point of co-culture of indicated CAR and indicated edited donor NK cells at 1:4E: T. Fig. 72H and 72I show the corresponding data at a ratio of 1:8 e:t. Figures 72J and 72K show cytotoxicity curves in a re-priming experimental setup, in which NK cells expressing the indicated CAR were re-primed with ACHN (figure 72J) or 786-O (figure 72K) cells at an E: T ratio of 1:4 (edited for CD70 knockout and edited (or not edited) for CISH knockout). Fig. 72L and 72M show the corresponding data using a 1:8e:t ratio.

Figures 73A-73H show data relating to cytotoxicity of selected CAR-expressing NK cells against tumor cells in an in vitro assay (an assay starting 21 days after the start of the cell production process) before and after re-excitation. FIG. 73A shows data concerning the presence of 786-O tumor cells using a 1:4E:T ratio 72 hours prior to re-excitation. FIG. 73B shows data concerning the presence of 786-O tumor cells using a 1:8E:T ratio 72 hours prior to re-excitation. FIG. 73C shows data concerning the presence of 786-O tumor cells at 1:4E:T ratio 6 days after re-priming NK cells with additional 786-O cells. FIG. 73D shows data concerning the presence of 786-O tumor cells at a 1:8E:T ratio 6 days after re-priming NK cells with additional 786-O cells. Fig. 73E shows data concerning the presence of ACHN tumor cells using a 1:4e:t ratio 72 hours prior to re-excitation. Fig. 73F shows data concerning the presence of ACHN tumor cells using a 1:8e:t ratio 72 hours prior to re-excitation. Fig. 73G shows data concerning the presence of ACHN tumor cells at a 1:4e:t ratio 6 days after re-priming NK cells with additional ACHN cells. Fig. 73H shows data concerning the presence of ACHN tumor cells at a 1:8e:t ratio 6 days after re-priming NK cells with additional ACHN cells.

Figures 74A-74H show data relating to cytotoxicity of selected CAR-expressing NK cells against tumor cells in an in vitro assay (an assay starting 28 days after the start of the cell production process) before and after re-excitation. FIG. 74A shows data concerning the presence of 786-O tumor cells using a 1:4E:T ratio 72 hours prior to re-excitation. FIG. 74B shows data regarding the presence of 786-O tumor cells using a 1:8E:T ratio 72 hours prior to re-excitation. FIG. 74C shows data concerning the presence of 786-O tumor cells at a 1:4E:T ratio 6 days after re-priming NK cells with additional 786-O cells. FIG. 74D shows data concerning the presence of 786-O tumor cells at a 1:8E:T ratio 6 days after re-priming NK cells with additional 786-O cells. Figure 74E shows data concerning the presence of ACHN tumor cells using a 1:4e:t ratio 72 hours prior to re-excitation. Fig. 74F shows data concerning the presence of ACHN tumor cells using a 1:8e:t ratio 72 hours prior to re-excitation. Fig. 74G shows data concerning the presence of ACHN tumor cells at a 1:4e:t ratio 6 days after re-priming NK cells with additional ACHN cells. Fig. 74H shows data concerning the presence of ACHN tumor cells at a 1:8e:t ratio 6 days after re-priming NK cells with additional ACHN cells.

FIGS. 75A-75F show data relating to the evaluation of indel frequency and CISH KO. Fig. 75A shows the detection of indel frequency with respect to editing in CISH. FIG. 75B shows the detection of indel frequency for editing in CD 70. FIG. 75C shows a schematic of the CISH signaling pathway. Fig. 75D shows western blot data assessing expression of phosphorylated Stat 5 (signaling molecule downstream of CIS). Fig. 75E shows quantitative data normalized to electroporation control. Fig. 75F shows data normalized to electroporation control with a value of 1.

Detailed Description

Some embodiments of the methods and compositions provided herein relate to engineered immune cells and combinations thereof for immunotherapy. In several embodiments, the engineered cells are engineered in a variety of ways, for example, to express receptor complexes that induce cytotoxicity. As used herein, the term "cytotoxic receptor complex" shall be given its ordinary meaning and shall also refer (unless otherwise indicated) to a Chimeric Antigen Receptor (CAR), chimeric receptor (also referred to as activating chimeric receptor in the case of NKG2D chimeric receptor). In several embodiments, the cells are further engineered to effect modification of the reactivity of the cells against non-tumor tissue and/or other therapeutic cells. In several embodiments, natural Killer (NK) cells are also engineered to express cytotoxicity-inducing receptor complexes (e.g., chimeric antigen receptors or chimeric receptors), such as, for example, to target CD 70-expressing tumor cells. In several embodiments, the NK cells are genetically edited to reduce and/or eliminate certain markers/proteins that would otherwise inhibit or limit the therapeutic efficacy of CAR-expressing NK cells. In several embodiments, the expression of certain markers/proteins is up-regulated or otherwise induced by one or more processes used to engineer and/or expand NK cells. For example, in several embodiments, the process of expanding NK cells in culture results in a significantly increased expression of CD70 by NK cells. In those embodiments in which a CD70 CAR is engineered to be expressed by amplified NK cells, the CAR is actually targeted not only to the CD70 expressing tumor, but also to other engineered and amplified NK cells (based on increased CD70 expression resulting from the culture of the cells). Thus, for example, in several embodiments, therapeutic NK cells are engineered to express a CAR that targets CD70, and likewise are genetically edited to knock out CD70 expression by the NK cells themselves, which, if present, would result in CAR-expressing NK cells targeting tumors as well as therapeutic NK cells. Otherwise, this would have a self-limiting therapeutic effect, potentially allowing tumor expansion and progression of the cancer.

The term "anti-cancer effect" refers to a biological effect that may be exhibited by a variety of means, including, but not limited to, a reduction in tumor volume, a reduction in the number of cancer cells, a reduction in the number of metastases, an increase in life expectancy, a reduction in cancer cell proliferation, a reduction in cancer cell survival, and/or an improvement in various physiological symptoms associated with a cancerous condition.

Cell type

Some embodiments of the methods and compositions provided herein relate to cells, such as immune cells. For example, immune cells (e.g., NK cells or T cells) can be engineered to comprise a chimeric receptor (e.g., a CD 70-directed chimeric receptor) or engineered to comprise a nucleic acid encoding a chimeric receptor as described herein. Additional embodiments relate to engineering a second set of cells to express another cytotoxic receptor complex, a NKG2D chimeric receptor complex as disclosed herein. Additional embodiments relate to further genetic manipulation of cells (e.g., donor NK cells) to reduce, disrupt, minimize, and/or eliminate expression of one or more markers/proteins achieved by NK cells, resulting in an enhancement of efficacy and/or persistence of the engineered NK cells.

Traditional anti-cancer therapies rely on surgical methods, radiation therapy, chemotherapy, or a combination of these methods. As research has led to a greater understanding of some of the mechanisms of certain cancers, this knowledge was used to develop targeted cancer therapies. Targeted therapy is a method of cancer treatment that uses certain drugs that target specific genes or proteins found in cancer cells or cells that support cancer growth (e.g., vascular cells) to reduce or prevent the growth of cancer cells. Recently, genetic engineering has enabled the development of methods that exploit certain aspects of the immune system to combat cancer. In some cases, the patient's own immune cells are modified to specifically eradicate the patient's cancer type. Various types of immune cells, such as T cells, natural killer cells (NK cells), or combinations thereof, may be used, as described in more detail below.

In order to facilitate cancer immunotherapy, provided herein are polynucleotides, polypeptides, and vectors encoding Chimeric Antigen Receptors (CARs) comprising a target binding moiety (e.g., a ligand expressed by a cancer cell or an extracellular binding agent of a tumor marker-targeted chimeric receptor) and a cytotoxic signaling complex. For example, some embodiments include polynucleotides, polypeptides, or vectors encoding chimeric antigen receptors, e.g., against tumor markers (e.g., CD70, CD19, CD123, her2, mesothelin, claudin 6, BCMA, EGFR, etc.), to facilitate immune cell targeting to cancer and exerting a cytotoxic effect on cancer cells. Engineered immune cells (e.g., NK cells and/or T cells) expressing such CARs are also provided. In several embodiments, provided herein are also polynucleotides, polypeptides, and vectors encoding constructs comprising an extracellular domain comprising two or more subdomains (e.g., a first CD70 targeting subdomain comprising an anti-CD 70 binding domain as disclosed herein and a second subdomain comprising an additional binding moiety, e.g., a C-type lectin-like receptor) and a cytotoxic signaling complex or another anti-CD 70 binding domain. Engineered immune cells (e.g., NK cells and/or T cells) expressing such bispecific constructs are also provided. Also provided herein are methods of treating cancer and other uses of such cells for cancer immunotherapy.

In order to facilitate cancer immunotherapy, polynucleotides, polypeptides, and vectors encoding chimeric receptors comprising a target binding moiety (e.g., an extracellular binding agent for a ligand expressed by a cancer cell) and a cytotoxic signaling complex are also provided herein. For example, some embodiments include polynucleotides, polypeptides, or vectors encoding, for example, activating chimeric receptors comprising NKG2D extracellular domains directed against tumor markers (e.g., MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP 6) to promote immune cell targeting to cancer and cytotoxic effects on cancer cells. Engineered immune cells (e.g., NK cells and/or T cells) that express such chimeric receptors are also provided. Also provided herein, in several embodiments, are polynucleotides, polypeptides, and vectors encoding constructs comprising an extracellular domain comprising two or more subdomains (e.g., a first ligand-binding receptor and a second ligand-binding receptor) and a cytotoxic signaling complex. Engineered immune cells (e.g., NK cells and/or T cells) expressing such bispecific constructs (in some embodiments, the first ligand binding domain and the second ligand binding domain target the same ligand) are also provided. Also provided herein are methods of treating cancer and other uses of such cells for cancer immunotherapy.

Engineered cells for immunotherapy

In several embodiments, cells of the immune system are engineered to have enhanced cytotoxic effects on target cells (e.g., tumor cells). For example, cells of the immune system can be engineered to comprise a tumor-directed chimeric receptor and/or a tumor-directed CAR as described herein. In some embodiments, white blood cells or leukocytes are used because their natural function is to protect the body from abnormal cell growth and infectious diseases. There are various types of white blood cells that play a specific role in the human immune system and are therefore preferred starting points for the cell engineering disclosed herein. White blood cells include granulocytes and granulosa-free cells (presence or absence of particles in the cytoplasm, respectively). Granulocytes include basophils, eosinophils, neutrophils and mast cells. Granulocytes include lymphocytes and monocytes. Cells (e.g., as described below or otherwise herein) can be engineered to comprise a chimeric antigen receptor (e.g., a CD 70-directed CAR) or a nucleic acid encoding a CAR. In several embodiments, the cells are optionally engineered to co-express a membrane-bound interleukin 15 (mbIL 15) domain. As discussed in more detail below, in several embodiments, the therapeutic cells are further genetically modified to enhance cytotoxicity and/or persistence of the cells. In several embodiments, the genetic modification enhances the ability of the cell to resist signals emanating from the tumor microenvironment that would otherwise result in reduced efficacy or reduced longevity of the therapeutic cell.

Monocytes for immunotherapy

Monocytes are a subset of leukocytes. Monocytes can differentiate into macrophages and myeloid dendritic cells. Monocytes are associated with the adaptive immune system and play a major role in phagocytosis, antigen presentation and cytokine production. Phagocytosis is the process of taking up cellular material or whole cells, and then digesting and destroying the engulfed cellular material. In several embodiments, monocytes are used in combination with one or more additional engineered cells disclosed herein. Some embodiments of the methods and compositions described herein relate to monocytes comprising a tumor-directed CAR or a nucleic acid encoding a tumor-directed CAR. Several embodiments of the methods and compositions disclosed herein relate to monocytes engineered to express a CAR targeting a tumor marker (e.g., CD70, CD19, CD123, her2, mesothelin, claudin 6, BCMA, EGFR, etc.) and optionally comprising a membrane-bound interleukin 15 (mbIL 15) domain. Several embodiments of the methods and compositions disclosed herein relate to monocytes engineered to express an activating chimeric receptor and optionally a membrane bound interleukin 15 (mbIL 15) domain targeting ligands on tumor cells, such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (etc.).

Lymphocytes for immunotherapy

Lymphocytes (another major subtype of leukocytes) include T cells (cell-mediated cytotoxic adaptive immunity), natural killer cells (cell-mediated cytotoxic innate immunity), and B cells (humoral, antibody-driven adaptive immunity). While B cells are engineered according to several embodiments disclosed herein, several embodiments also relate to engineered T cells or engineered NK cells (in some embodiments, a mixture of T cells and NK cells from the same donor or different donors is used). Several embodiments of the methods and compositions disclosed herein relate to lymphocytes engineered to express a CAR targeting a tumor marker (e.g., CD70, CD19, CD123, her2, mesothelin, claudin 6, BCMA, EGFR, etc.) and optionally comprising a membrane-bound interleukin 15 (mbIL 15) domain. Several embodiments of the methods and compositions disclosed herein relate to lymphocytes engineered to express activating chimeric receptors and optionally a membrane-bound interleukin 15 (mbIL 15) domain that target ligands on tumor cells, such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (etc.).

T cells for immunotherapy

T cells can be distinguished from other lymphocyte subtypes (e.g., B cells or NK cells) based on the presence of T cell receptors on the cell surface. T cells can be divided into various subtypes including effector T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, mucosa-associated constant T cells, and γδ T cells. In some embodiments, specific subtypes of T cells are engineered. In some embodiments, a mixed pool of T cell subtypes is engineered. In some embodiments, there is no specific choice for the T cell type to be engineered to express the cytotoxic receptor complexes disclosed herein. In several embodiments, specific techniques (e.g., using cytokine stimulation) are used to enhance the expansion/collection of T cells with specific marker characteristics. For example, in several embodiments, activation of certain human T cells (e.g., cd4+ T cells, cd8+ T cells) is achieved by using CD3 and/or CD28 as a stimulatory molecule. In several embodiments, methods of treating or preventing cancer or an infectious disease are provided, the methods comprising administering a therapeutically effective amount of T cells expressing a cytotoxic receptor complex and/or homing moiety as described herein. In several embodiments, the engineered T cells are autologous cells, and in some embodiments, the T cells are allogeneic cells. Several embodiments of the methods and compositions disclosed herein relate to T cells engineered to express a CAR targeting a tumor marker (e.g., CD70, CD19, CD123, her2, mesothelin, claudin 6, BCMA, EGFR, etc.) and optionally comprising a membrane-bound interleukin 15 (mbIL 15) domain. Several embodiments of the methods and compositions disclosed herein relate to T cells engineered to express an activating chimeric receptor that targets ligands on tumor cells (e.g., MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (etc.)) and optionally a membrane-bound interleukin 15 (mbIL 15) co-stimulatory domain.

NK cells for immunotherapy

In several embodiments, methods of treating or preventing cancer or an infectious disease are provided, the methods comprising administering a therapeutically effective amount of Natural Killer (NK) cells expressing a cytotoxic receptor complex and/or homing moiety as described herein. In several embodiments, the engineered NK cells are autologous cells, while in some embodiments, the NK cells are allogeneic cells. In several embodiments, NK cells are preferred because of their relatively high natural cytotoxic potential. In several embodiments, it is unexpectedly beneficial that the engineered cells disclosed herein can further up-regulate the cytotoxic activity of NK cells, resulting in even more potent activity against target cells (e.g., tumor or other diseased cells). Some embodiments of the methods and compositions described herein relate to NK cells engineered to express a CAR targeting a tumor marker (e.g., CD70, CD19, CD123, her2, mesothelin, claudin 6, BCMA, EGFR, etc.) and optionally comprising a membrane-bound interleukin 15 (mbIL 15) domain. Several embodiments of the methods and compositions disclosed herein relate to NK cells engineered to express activating chimeric receptors that target ligands on tumor cells (e.g., MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (etc.)) and optionally a membrane-bound interleukin 15 (mbIL 15) domain. In several embodiments, immortalized NK cells are used and subjected to gene editing and/or engineering as disclosed herein. In some embodiments, the NK cells are derived from the cell line NK-92.NK-92 cells are derived from NK cells but lack the primary inhibitory receptor exhibited by normal NK cells while retaining the majority of the activating receptor. Some embodiments of the NK-92 cells described herein relate to NK-92 cells engineered to silence certain additional inhibitory receptors (e.g., SMAD 3) to allow up-regulation of interferon-gamma (IFNgamma), granzyme B, and/or perforin production. Additional information about NK-92 cell lines is disclosed in WO 1998/49268 and U.S. patent application publication No. 2002/0068044 and incorporated herein by reference in its entirety. In several embodiments, NK-92 cells are used in combination with one or more other cell types disclosed herein. For example, in one embodiment, NK-92 cells are used in combination with NK cells as disclosed herein. In further embodiments, NK-92 cells are used in combination with T cells as disclosed herein.

In several embodiments, gene manipulation using NK cells further enhances the efficacy and/or persistence of NK cells. For example, in several embodiments, expression of various markers/proteins is reduced, significantly reduced, or knocked out (eliminated) by gene editing techniques. Depending on the embodiment, this may include gene editing for reducing expression of one or more of the following: the cytokine-inducible SH 2-containing protein encoded by the CISH gene, the transforming growth factor β receptor (e.g., TGFBR 2), the natural killer group 2 member a (NKG 2A) receptor, the cbbl proto-oncogene B protein encoded by the CBLB gene, the triple-motif-containing protein 29 protein encoded by the TRIM29 gene, the cytokine signaling inhibitor 2 protein encoded by the SOCS2 gene, the maternal DPP homolog 3 (SMAD 3) protein encoded by the SMAD3 gene, the MAP kinase-activated protein kinase 3 (MAPKAPK 3) protein encoded by the MAPKAPK3 gene, the carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM 1) protein encoded by the CEACAM1 gene, and/or the DNA damage inducing transcript 4 (DDIT 4) protein encoded by the DDIT4 gene. In several embodiments, reduced expression is achieved by targeted introduction of DNA breaks and subsequent DNA repair mechanisms. In several embodiments, double-strand breaks in DNA are repaired by non-homologous end joining (NHEJ), wherein enzymes are used to directly join DNA ends to each other to repair the break. However, in several embodiments, the double strand breaks are repaired by Homology Directed Repair (HDR), which is advantageously more accurate, allowing sequence specific breaks and repair. HDR uses homologous sequences, e.g., vectors having desired genetic elements (e.g., insert elements for disrupting coding sequences (e.g., CD70 and/or CISH) of a target protein) within sequences homologous to flanking sequences of a double strand break, as templates for regenerating deleted DNA sequences at the breakpoint. This will result in the desired change (e.g., insertion) being inserted at the site of the DSB.

In several embodiments, gene editing is accomplished by one or more of a variety of engineered nucleases. In several embodiments, restriction enzymes are used, particularly when double strand breaks are desired in multiple regions. In several embodiments, a bioengineered nuclease is used. Depending on the embodiment, genes encoding one or more target proteins (such as CD70 and/or CISH) are specifically edited using one or more of Zinc Finger Nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, and/or regularly spaced clustered short palindromic repeats (CRISPR/Cas 9) systems.

Meganucleases are characterized by their ability to recognize and cleave large DNA sequences (14 to 40 base pairs). In several embodiments, meganucleases from the LAGLIDADG family are used and subjected to mutagenesis and screening to generate meganuclease variants that recognize one or more unique sequences (e.g., specific sites in a gene encoding a target protein of interest). In several embodiments, two or more meganucleases or functional fragments thereof are fused to produce a hybrid enzyme that recognizes a desired target sequence within a gene encoding a target protein of interest (e.g., CD70 and/or CISH).

In contrast to meganucleases, ZFNs and TALENs function based on a non-specific DNA cleavage catalytic domain linked to a specific DNA sequence that recognizes a peptide, such as a zinc finger or a transcription activator-like effector (TALE). Advantageously, ZFNs and TALENs thus allow sequence independent DNA cleavage and have a high degree of sequence specificity in target recognition. Zinc finger motifs naturally function in transcription factors to recognize specific DNA sequences for transcription. The C-terminal portion of each finger is responsible for specific recognition of the DNA sequence. Although the sequences recognized by ZFNs are relatively short (e.g., about 3 base pairs), in several embodiments, a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more zinc fingers whose recognition sites have been characterized is used, allowing targeting of specific sequences, such as a portion of a gene encoding a target protein typically expressed by NK cells (e.g., CD70 and/or CISH). The combined ZFNs are then fused to one or more catalytic domains of an endonuclease, such as fokl (optionally fokl heterodimer), to induce targeted DNA breaks. Additional information regarding the use of ZFNs for editing target genes of interest (such as CD70 or CISH) can be found in U.S. patent No. 9,597,357, which is incorporated herein by reference.

Transcription activator-like effector nucleases (TALENs) are specific DNA binding proteins characterized by an array of repeat sequences of 33 or 34 amino acids. Like ZFNs, TALENs are fusions of the DNA cleavage domain of a nuclease with a TALE domain that allow sequence-independent introduction of double-stranded DNA breaks using highly accurate target site recognition. TALENs can create double strand breaks at target sites, which can be repaired by error-prone non-homologous end joining (NHEJ), resulting in gene disruption by introducing small insertions or deletions. Advantageously, TALENs are used in several embodiments, due at least in part to their higher specificity in DNA binding, reduced off-target effects, and ease of construction of the DNA binding domain.

CRISPR (regularly spaced clustered short palindromic repeats) is a genetic element used by bacteria as a defense against viruses. The repeat sequence is a short sequence that originates in the viral genome and has been incorporated into the bacterial genome. Cas (CRISPR-associated protein) processes these sequences and cleaves the matched viral DNA sequences. By introducing a plasmid containing a Cas gene and a specifically constructed CRISPR into eukaryotic cells, the eukaryotic genome can be cleaved at any desired location. Additional information regarding CRISPR can be found in U.S. patent publication No. 2014/0068797, which is incorporated herein by reference. In several embodiments, CRISPR is used to manipulate genes encoding one or more TCRs of T cells and/or genes encoding one or more immune checkpoint inhibitors. In several embodiments, the immune checkpoint inhibitor is selected from one or more of CTLA4 and PD 1. In several embodiments, natural CD70 expression of NK cells is disrupted or substantially eliminated by targeting the CD70 encoding gene with a CRISPR/Cas system. In several embodiments, one or more additional target proteins normally expressed by NK cells are disrupted or substantially eliminated by targeting the corresponding coding gene with a CRISPR/Cas system. Depending on the embodiment, CRISPR/Cas systems are used to target one or more of the following: the cytokine-inducible SH 2-containing protein encoded by the CISH gene, the transforming growth factor beta receptor (e.g., TGFBR 2), the natural killer group 2 member A (NKG 2A) receptor, the cbbl proto-oncogene B protein encoded by the CBLB gene, the triple-motif-containing protein 29 protein encoded by the TRIM29 gene, the cytokine signaling inhibitor 2 protein encoded by the SOCS2 gene, the SMAD3 protein encoded by the SMAD3 gene, the MAPKAPK3 protein encoded by the MAPKAPK3 gene, the CEACAM1 protein encoded by the CEACAM1 gene, and/or the DDIT4 protein encoded by the DDIT4 gene. Depending on the embodiment, cas of class 1 or class 2 is used. In several embodiments, class 1 Cas is used, and the Cas type is selected from the following types: I. IA, IB, IC, ID, IE, IF, IU, III, IIIA, IIIB, IIIC, IIID, IV IVA, IVB, and combinations thereof. In several embodiments, the Cas is selected from Cas3, cas8a, cas5, cas8b, cas8c, cas10d, cse1, cse2, csy1, csy2, csy3, GSU0054, cas10, csm2, cmr5, cas10, csx11, csx10, csf1, and combinations thereof. In several embodiments, a class 2 Cas is used, and the Cas type is selected from the following types: II. IIA, IIB, IIC, V, VI, and combinations thereof. In several embodiments, the Cas is selected from Cas9, csn2, cas4, cpf1, C2C3, cas13a (previously referred to as C2), cas13b, cas13C, casX, casY, and combinations thereof. In some embodiments, class 2 CasX is used, wherein CasX is capable of forming a complex with a guide nucleic acid, and wherein the complex can bind to a target DNA, and wherein the target DNA comprises a non-target strand and a target strand. In some embodiments, class 2 CasY is used, wherein CasY is capable of binding and modifying a target nucleic acid and/or a polypeptide associated with a target nucleic acid.

Hematopoietic stem cells for cancer immunotherapy

In some embodiments, hematopoietic Stem Cells (HSCs) are used in the methods of immunotherapy disclosed herein. In several embodiments, the cells are engineered to express homing moieties and/or cytotoxic receptor complexes. In several embodiments, HSCs are used to transplant their ability to long-term blood cell production, which can lead to a sustained source of targeted anti-cancer effector cells, e.g., to combat cancer remission. In several embodiments, this ongoing production helps to counteract anergy or depletion of other cell types, for example, due to tumor microenvironment. In several embodiments, allogeneic HSCs are used, while in some embodiments, autologous HSCs are used. In several embodiments, HSCs are used in combination with one or more additional engineered cell types disclosed herein. Some embodiments of the methods and compositions described herein relate to stem cells, such as hematopoietic stem cells engineered to express a CAR targeting a tumor marker (e.g., CD70, CD19, CD123, CD70, her2, mesothelin, claudin 6, BCMA, EGFR, etc.) and optionally comprising a membrane-bound interleukin 15 (mbIL 15) domain. Several embodiments of the methods and compositions disclosed herein relate to hematopoietic stem cells engineered to express activating chimeric receptors targeting ligands on tumor cells (e.g., MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (etc.)) and optionally comprising a membrane-bound interleukin 15 (mbIL 15) domain.

Induction of pluripotent stem cells

In some embodiments, induced pluripotent stem cells (ipscs) are used in the methods of immunotherapy disclosed herein. In some embodiments, ipscs are used to exploit their ability to differentiate and derive into non-pluripotent cells, including but not limited to CD34 cells, hematopoietic endothelial cells, HSCs (hematopoietic stem and progenitor cells), hematopoietic pluripotent progenitor cells, T cell progenitor cells, NK cell progenitor cells, T cells, NKT cells, NK cells and B cells comprising one or several genetic modifications at selected sites by differentiating ipscs or less differentiated cells comprising the same genetic modification at the same selected sites. In several embodiments, ipscs are used to generate iPSC-derived NK or T cells. In several embodiments, the cells are engineered to express homing moieties and/or cytotoxic receptor complexes. In several embodiments, ipscs are used in combination with one or more additional engineered cell types disclosed herein. Some embodiments of the methods and compositions described herein relate to stem cells, such as induced pluripotent stem cells engineered to express a CAR targeting a tumor marker (e.g., CD19, CD123, CD70, her2, mesothelin, claudin 6, BCMA, EGFR, and any other tumor marker disclosed herein) and optionally a membrane-bound interleukin 15 (mbIL 15) co-stimulatory domain. Several embodiments of the methods and compositions disclosed herein relate to induced pluripotent stem cells engineered to express an activating chimeric receptor that targets a ligand (e.g., MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (etc)) on a tumor cell, and optionally a membrane-bound interleukin 15 (mbIL 15) co-stimulatory domain.

Genetic engineering of immune cells

As described above, a variety of cell types can be used for cellular immunotherapy. Furthermore, as set forth in more detail below and shown in the examples, these cells may be genetically modified to enhance one or more aspects of their efficacy (e.g., cytotoxicity) and/or persistence (e.g., active lifetime). As discussed herein, NK cells are used in several embodiments for immunotherapy. In several embodiments provided herein, gene editing of NK cells imparts various beneficial characteristics to the cells, such as, for example, enhanced proliferation, enhanced cytotoxicity, and/or enhanced persistence. In several embodiments provided herein, gene editing of NK cells can advantageously confer upon the edited NK cells the ability to resist and/or overcome various inhibitory signals generated in the tumor microenvironment. A variety of signaling molecules are known to be produced by tumors, which aim to reduce the anti-tumor effect of immune cells. As discussed in more detail below, in several embodiments, gene editing of NK cells limits such inhibition of NK cells, T cells, combinations of NK and T cells, or any edited/engineered immune cells provided herein, by the tumor microenvironment.

As described below, in several embodiments, gene editing is used to reduce or knock out the expression of a target protein, for example by disrupting a potential gene encoding the protein. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between those listed). In several embodiments, the gene is completely knocked out such that expression of the target protein is undetectable. In several embodiments, gene editing is used to "knock in" or otherwise enhance expression of a target protein. In several embodiments, expression of the target protein may be enhanced by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between those listed).

According to further embodiments, other modulators that modulate one or more aspects of NK cell (or T cell) function by gene editing. A variety of cytokines confer a negative signal (such as TGF-beta as described above) or a positive signal on immune cells. As non-limiting examples, IL15 is a positive regulator of NK cells, which, as disclosed herein, may enhance one or more of NK cell homing, NK cell migration, NK cell expansion/proliferation, NK cytotoxicity, and/or NK cell persistence. In order to keep NK cells under normal physiological conditions under control, cytokine-induced SH 2-containing proteins (CIS, encoded by CISH genes) act as key negative regulators of IL-15 signaling in NK cells. As discussed herein, because IL15 biology affects various aspects of NK cell function, including but not limited to proliferation/amplification, activation, cytotoxicity, persistence, homing, migration, and the like. Thus, according to several embodiments, editing CISH enhances the function of NK cells across multiple functions, resulting in a more effective and durable NK cell therapeutic. In several embodiments, inhibitors of CIS are used in combination with engineered NK cell administration. In several embodiments, CIS expression is knocked down or knocked out by gene editing of the CISH gene, e.g., by using CRISPR-Cas editing. In other embodiments small interfering RNA, antisense RNA, TALEN or zinc fingers are used. In some embodiments, CIS expression in T cells is reduced by gene editing.

In several embodiments, CISH gene editing confers an increased ability of NK cells to home to a target site. In several embodiments, CISH gene editing confers NK cells with enhanced migration capabilities, such as the ability to migrate within tissues or away from repellent agents in response to, for example, chemoattractants. In several embodiments, CISH gene editing confers enhanced activation ability to NK cells, thereby exerting, for example, anti-tumor effects. In several embodiments, CISH gene editing confers NK cell enhanced proliferative capacity, which in several embodiments allows for the generation of robust NK cell numbers from a donor blood sample. Furthermore, in such embodiments, NK cells edited for CISH and engineered to express CAR are more easily, more robustly, and more consistently expanded in culture. In several embodiments, CISH gene editing confers NK cell-enhanced cytotoxicity. In several embodiments, the editing of CISH synergistically enhances the cytotoxic effect of the CAR-expressing engineered NK cells and/or engineered T cells.

In several embodiments, CISH gene editing activates or inhibits a wide variety of pathways. CIS proteins are negative modulators of IL15 signaling, for example, by inhibiting the JAK-STAT signaling pathway. These pathways will typically lead to transcription of IL15 responsive genes, including CISH. In several embodiments, knock-down of CISH has a counterinhibitory effect on JAK-STAT (e.g., JAK1-STAT 5) signaling, and transcription of the IL15 responsive gene is enhanced. In several embodiments, knockout of CISH results in enhanced signaling through the mammalian target of rapamycin (mTOR), and a corresponding increase in expression of genes associated with cellular metabolism and respiration. In several embodiments, the knockout of CISH results in increased IL-2rα (CD 25) expression induced by IL15 (rather than increased IL-15rα or IL-2/15rβ expression), increased NK cell membrane binding of IL15 and/or IL2, increased phosphorylation of STAT-3 and/or STAT-5, and increased expression of anti-apoptotic proteins (such as Bcl-2). In several embodiments, knockout of CISH results in IL 15-induced upregulation of selected genes associated with mitochondrial function (e.g., electron transfer chain and cell respiration) and cell cycle. Thus, in several embodiments, the cytotoxicity and/or persistence of NK cells is enhanced at least in part by metabolic reprogramming by gene editing knockout CISH. In several embodiments, a negative regulator of cellular metabolism (e.g., TXNIP) is down-regulated in response to CISH knockout. In several embodiments, following CISH knockout, promoters of cell survival and proliferation including BIRC5 (survivin), TOP2A, CKS, and RACGAP1 are up-regulated, while anti-proliferative or pro-apoptotic proteins (such as TGFB1, ATM, and PTCH 1) are down-regulated. In several embodiments, the CISH knockout alters the signaling state (e.g., activation or inactivation) via or through CXCL-10, IL2, TNF, IFNg, IL13, IL4, jnk, PRF1, STAT5, PRKCQ, IL2 receptor β, SOCS2, MYD88, STAT3, STAT1, TBX21, LCK, JAK3, IL & receptor, ABL1, IL9, STAT5A, STAT5B, tcf7, PRDM1, and/or EOMES.

In several embodiments, genetic editing of immune cells may also provide unexpected enhancements in expansion, persistence, and/or cytotoxicity of the edited immune cells. Engineered cells (e.g., those expressing CARs) can also be edited as disclosed herein, the combination of which provides robust cells for immunotherapy. In several embodiments, the editing allows for unexpectedly improving NK cell expansion, persistence, and/or cytotoxicity. In several embodiments, knock-out of CISH expression in NK cells eliminates potent negative modulators of IL 15-mediated signaling in NK cells, has an anti-inhibitory effect on NK cells and allows for enhancement of one or more of NK cell homing, NK cell migration, activation, expansion, cytotoxicity, and/or persistence of NK cells. In addition, in several embodiments, the editing can enhance NK and/or T cell function in an otherwise inhibitory tumor microenvironment. In several embodiments, CISH gene editing results in enhanced NK cell expansion, persistence, and/or cytotoxicity without exogenously providing Notch ligands.

By way of non-limiting example, TGF- β is one such cytokine released by tumor cells that results in immunosuppression within the tumor microenvironment. This immunosuppression reduces the ability of immune cells, and in some cases even engineered CAR immune cells, to destroy tumor cells, allowing tumor progression. In several embodiments, immune checkpoint inhibitors are destroyed by gene editing, as discussed in detail below. In several embodiments, blockers of immunosuppressive cytokines in the tumor microenvironment are used, including blockers of their release or competitive inhibitors that reduce the ability of signaling molecules to bind and suppress immune cells. These signaling molecules include, but are not limited to, TGF-beta, IL10, arginase, inducible NOS, reactive NOS, arg1, indoleamine 2, 3-dioxygenase (IDO) and PGE ₂ . However, in additional embodiments, immune cells (e.g., NK cells) are provided in which NK cells (or other cells) are destroyed and/or eliminated for a given immunosuppressive signaling componentAbility of the son to react. For example, in several embodiments, NK cells or T cells are genetically edited to have reduced sensitivity to TGF- β. TGF-beta is an inhibitor of NK cell function at least at proliferation and cytotoxicity levels. See, e.g., fig. 8A, which schematically shows some of the inhibitory pathways of TGF- β to reduce NK cell activity and/or proliferation. Thus, according to some embodiments, the expression of the TGF- β receptor is knockdown or knocked out by gene editing, rendering the edited NK resistant to immunosuppressive effects of TGF- β in the tumor microenvironment. In several embodiments, the TGFB2 receptor is knocked down or knocked out by gene editing, e.g., by using CRISPR-Cas editing. In other embodiments small interfering RNA, antisense RNA, TALEN or zinc fingers are used. In some embodiments, other subtypes of TGF-beta receptor (e.g., TGF-beta 1 and/or TGF-beta 3) are edited. In some embodiments, the TGF- β receptor in T cells is knocked down by gene editing.

Extracellular domain (tumor binding agent)

Some embodiments of the compositions and methods described herein relate to chimeric antigen receptors comprising an extracellular domain comprising a tumor binding domain (also referred to as an antigen binding protein or antigen binding domain) as described herein. Depending on the embodiment, the tumor binding domain targets, for example, CD70, CD19, CD123, her2, mesothelin, claudin 6, BCMA, EGFR, etc. Several embodiments of the compositions and methods described herein relate to chimeric receptors (also referred to as activating chimeric receptors) comprising an extracellular domain containing a ligand binding domain that binds a ligand expressed by a tumor cell as described herein. Depending on the embodiment, the ligand binding domain targets, for example, MICA, MICB, ULBP, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (etc.).

In some embodiments, the antigen binding domain is derived from or comprises a wild-type or non-wild-type sequence of an antibody, an antibody fragment, scFv, fv, fab, (Fab') 2, a Single Domain Antibody (SDAB), vH or vL domain, a camelid VHH domain or a non-immunoglobulin scaffold (e.g., DARPIN, affibody, affilin, ideneclatin (adnectin), affitin, repebody, fynomer, alphabody, avimer, atrimer, centyrin, pronectin, anti-carrier (anticalin), kunitz domain, a johne repeat, an autoantigen, receptor or ligand). In some embodiments, the tumor binding domain contains more than one antigen binding domain.

Antigen binding proteins

In several embodiments, antigen binding proteins are provided. As used herein, the term "antigen binding protein" shall be given its ordinary meaning and shall also refer to a protein comprising an antigen binding fragment that binds an antigen and optionally a scaffold or framework portion that allows the antigen binding fragment to adopt a conformation that facilitates binding of the antigen binding protein to the antigen. In some embodiments, the antigen is a cancer antigen (e.g., CD 70) or fragment thereof. In some embodiments, the antigen binding fragment comprises at least one CDR from an antibody that binds to the antigen. In some embodiments, the antigen binding fragment comprises all three CDRs from a heavy chain of an antibody that binds to the antigen or from a light chain of an antibody that binds to the antigen. In still some embodiments, the antigen binding fragment comprises all six CDRs (three from the heavy chain and three from the light chain) from an antibody that binds to the antigen. In several embodiments, the antigen binding fragment comprises one, two, three, four, five, or six CDRs from an antibody that binds to the antigen, and in several embodiments, the CDRs can be any combination of heavy and/or light chain CDRs. In some embodiments, the antigen binding fragment is an antibody fragment.

Non-limiting examples of antigen binding proteins include antibodies, antibody fragments (e.g., antigen binding fragments of antibodies), antibody derivatives, and antibody analogs. Other specific examples include, but are not limited to, single chain variable fragments (scFv), nanobodies (e.g., VH domains of camelid heavy chain antibodies; VHH fragments), fab fragments, fab 'fragments, F (ab') 2 fragments, fv fragments, fd fragments, and Complementarity Determining Region (CDR) fragments. These molecules may be from any mammalian source, such as human, mouse, rat, rabbit or pig, dog or camelid. Antibody fragments can compete with intact (e.g., native) antibodies for binding to a target antigen, and the fragments can be produced by modification (e.g., enzymatic or chemical cleavage) of the intact antibody or de novo synthesis using recombinant DNA techniques or peptide synthesis. Antigen binding proteins may include, for example, surrogate protein scaffolds or artificial scaffolds with grafted CDRs or CDR derivatives. Such scaffolds include, but are not limited to, antibody-derived scaffolds comprising mutations introduced to, for example, stabilize the three-dimensional structure of an antigen binding protein; and fully synthetic scaffolds comprising, for example, biocompatible polymers. In addition, peptide antibody mimics ("PAMs") may be used, as well as scaffolds based on antibody mimics that utilize fibronectin components as scaffolds.

In some embodiments, the antigen binding protein comprises one or more antibody fragments introduced into a single polypeptide chain or multiple polypeptide chains. For example, antigen binding proteins may include, but are not limited to, diabodies; an intracellular antibody; domain antibodies (single VL or VH domains or two or more VH domains connected by peptide linkers); large antibodies (2 scFv fused to Fc region); a tri-antibody; a four-antibody; a microsome (scFv fused to CH3 domain); peptide antibodies (one or more peptides attached to the Fc region); linear antibodies (a pair of tandem Fd segments (VH-CH 1-VH-CH 1) that form a pair of antigen binding regions with complementary light chain polypeptides); small modular immunopharmaceuticals; immunoglobulin fusion proteins (e.g., igG-scFv, igG-Fab, 2scFv-IgG, 4scFv-IgG, VH-IgG, igG-VH, and Fab-scFv-Fc).

In some embodiments, the antigen binding protein has the structure of an immunoglobulin. As used herein, the term "immunoglobulin" shall be given its ordinary meaning and shall also refer to tetrameric molecules, wherein each tetramer comprises two identical pairs of polypeptide chains, each pair having one "light" chain (about 25 kDa) and one "heavy" chain (about 50-70 kDa). The amino-terminal portion of each chain comprises a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function.

Within the light and heavy chains, the variable (V) and constant (C) regions are linked by a "J" region of about 12 or more amino acids, wherein the heavy chain further comprises a "D" region of about 10 or more amino acids. The variable region of each light/heavy chain pair forms an antibody binding site such that the intact immunoglobulin has two binding sites.

Immunoglobulin chains exhibit the same overall structure of relatively conserved Framework Regions (FR) joined by three hypervariable regions (also known as complementarity determining regions or CDRs). From N-terminal to C-terminal, both the light and heavy chains comprise domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4.

Human light chains are classified as kappa and lambda light chains. An antibody "light chain" refers to the smaller of two types of polypeptide chains in an antibody molecule that exist in their naturally occurring conformation in the antibody molecule. The kappa (K) light chain and lambda (lambda) light chain refer to two major antibody light chain isotypes. The light chain may include a polypeptide comprising a single immunoglobulin light chain variable region (VL) and a single immunoglobulin light chain constant domain (CL) from amino terminus to carboxy terminus.

Heavy chains are classified as mu (μ), delta (Δ), gamma (γ), alpha (α) and epsilon (ε), and the isotypes of antibodies are defined as IgM, igD, igG, igA and IgE, respectively. An antibody "heavy chain" refers to the larger of two types of polypeptide chains in an antibody molecule that exist in their naturally occurring conformation, and generally determines the class to which the antibody belongs. The heavy chain may include a polypeptide comprising a single immunoglobulin heavy chain variable region (VH), immunoglobulin heavy chain constant domain 1 (CH 1), immunoglobulin hinge region, immunoglobulin heavy chain constant domain 2 (CH 2) polypeptide, immunoglobulin heavy chain constant domain 3 (CH 3), and optionally immunoglobulin heavy chain constant domain 4 (CH 4) from amino terminus to carboxy terminus.

The IgG classes are further divided into subclasses, namely IgG1, igG2, igG3 and IgG4.IgA classes are further divided into subclasses, igA1 and IgA2.IgM has multiple subclasses including, but not limited to, igM1 and IgM2. The heavy chains in IgG, igA and IgD antibodies have three domains (CH 1, CH2 and CH 3), while the heavy chains in IgM and IgE antibodies have four domains (CH 1, CH2, CH3 and CH 4). The immunoglobulin heavy chain constant domain may be from any immunoglobulin isotype, including subtypes. The antibody chains are linked together via inter-polypeptide disulfide bonds between the CL domain and the CH1 domain (e.g., between the light and heavy chains) and between the hinge regions of the antibody heavy chains.

In some embodiments, the antigen binding protein is an antibody. As used herein, the term "antibody" refers to a protein or polypeptide sequence derived from an immunoglobulin molecule that specifically binds to an antigen. Antibodies may be monoclonal or polyclonal, multi-chain or single-chain or intact immunoglobulins, and may be derived from natural sources or recombinant sources. The antibody may be a tetramer of immunoglobulin molecules. Antibodies may be "humanized", "chimeric" or non-human. Antibodies may include intact immunoglobulins of any isotype, and include, for example, chimeric antibodies, humanized antibodies, human antibodies, and bispecific antibodies. An intact antibody typically comprises at least two full length heavy chains and two full length light chains. The antibody sequences may be derived from only a single species, or may be "chimeric", that is, different portions of the antibody may be derived from two different species, as described further below. Unless otherwise indicated, the term "antibody" also includes antibodies comprising two substantially full length heavy chains and two substantially full length light chains, so long as the antibodies retain the same or similar binding and/or function as antibodies comprising two full length light chains and a heavy chain. For example, antibodies having 1, 2, 3, 4, or 5 amino acid residue substitutions, insertions, or deletions at the N-terminus and/or C-terminus of the heavy and/or light chain are included in the definition so long as the antibody retains the same or similar binding and/or function as an antibody comprising two full length heavy chains and two full length light chains. Examples of antibodies include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies, bispecific antibodies, and synthetic antibodies. In some embodiments, monoclonal antibodies and polyclonal antibodies are provided. As used herein, the term "polyclonal antibody" shall be given its ordinary meaning and shall also refer to a population of antibodies that generally vary widely in composition and binding specificity. As used herein, the term "monoclonal antibody" ("mAb") shall be given its ordinary meaning and shall also refer to one or more of a population of antibodies having the same sequence. Monoclonal antibodies bind to an antigen at a specific epitope on the antigen.

In some embodiments, the antigen binding protein is a fragment of an antibody or an antigen binding fragment. The term "antibody fragment" refers to at least a portion of an antibody that retains the ability to specifically interact (e.g., by binding, steric hindrance, stabilization/destabilization, spatial distribution) with an epitope of an antigen. Examples of antibody fragments include, but are not limited to, fab ', F (ab') 2, fv fragments, scFv antibody fragments, disulfide-linked Fv (sdFv), fd fragments consisting of VH and CHI domains, linear antibodies, single domain antibodies such as sdAb (vL or VH), camelid vHH domains, multispecific antibodies formed from antibody fragments such as bivalent fragments comprising two Fab fragments linked at the hinge region by a disulfide bond, and isolated CDRs or other epitope-binding fragments of antibodies. Antigen binding fragments can also be incorporated into single domain antibodies, large antibodies, minibodies, nanobodies, intracellular antibodies, diabodies, triabodies, tetrabodies, v-NARs, and bis-scFvs (see, e.g., hollinger and Hudson, nature Biotechnology 23:1126-1136,2005). Antigen binding fragments can also be grafted into a polypeptide-based scaffold such as fibronectin type III (Fn 3) (see us patent No. 6,703,199, which describes a fibronectin polypeptide miniantibody). Antibody fragments may include Fab, fab ', F (ab') 2, and/or Fv fragments which contain at least one CDR sufficient to confer immunoglobulin binding to a specific antigen of a cancer antigen (e.g., CD 19). Antibody fragments may be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies.

In some embodiments, fab fragments are provided. Fab fragments are monovalent fragments having VL, VH, CL and CH1 domains; f (ab') 2 fragments are bivalent fragments having two Fab fragments linked by a disulfide bridge at the hinge region; the Fd fragment has VH and CH1 domains; fv fragments have VL and VH domains of the antibody single arm; and the dAb fragment has a VH domain, a VL domain, or an antigen-binding fragment of a VH or VL domain. In some embodiments, these antibody fragments may be introduced into single domain antibodies, single chain antibodies, large antibodies, minibodies, intracellular antibodies, diabodies, triabodies, tetrabodies, v-NAR, and bis-scFv. In some embodiments, the antibody comprises at least one CDR as described herein.

In several embodiments, single-stranded variable fragments are also provided herein. As used herein, the term "single chain variable fragment" ("scFv") shall be given its ordinary meaning and shall also refer to fusion proteins (e.g., synthetic sequences of amino acid residues) in which the VL and VH regions are joined by a linker to form a continuous protein chain, wherein the linker is long enough to allow the protein chain to fold upon itself and form a monovalent antigen binding site). For clarity, unless otherwise indicated, "single-chain variable fragment" is not an antibody or antibody fragment as defined herein. Diabodies are bivalent antibodies comprising two polypeptide chains, wherein each polypeptide chain comprises VH and VL domains connected by a linker configured to reduce or not allow pairing between two domains on the same chain, thereby allowing pairing of each domain with a complementary domain on the other polypeptide chain. Depending on the number of embodiments, if the two polypeptide chains of a diabody are identical, the diabody resulting from their pairing will have two identical antigen binding sites. Polypeptide chains having different sequences can be used to make diabodies having two different antigen binding sites. Similarly, a tri-antibody and a tetra-antibody are antibodies comprising three and four polypeptide chains, respectively, and forming three and four antigen binding sites, respectively, which may be the same or different.

In several embodiments, the antigen binding protein comprises one or more CDRs. As used herein, the term "CDR" shall be given its ordinary meaning and shall also refer to complementarity determining regions (also referred to as "minimal recognition units" or "hypervariable regions") within an antibody variable sequence. CDRs allow the antigen binding protein to specifically bind to a particular antigen of interest. There are three heavy chain variable region CDRs (CDR-H1, CDR-H2 and CDR-H3) and three light chain variable region CDRs (CDR-L1, CDR-L2 and CDR-L3). The CDRs in each of the two chains are typically aligned by a framework region to form a target eggStructure to which a particular epitope or domain on the white top specifically binds. From N-terminal to C-terminal, the naturally occurring light and heavy chain variable regions generally correspond to the following sequence of these elements: FW1, CDR1, FW2, CDR2, FW3, CDR3, FW4. For the heavy chain variable region, the order is typically from N-terminus to C-terminus: FW-H1, CDR-H1, FW-H2, CDR-H2, FW-H3, CDR-H3 and FW-H4. For the heavy chain variable region, the order is typically from N-terminus to C-terminus: FW-L1, CDR-L1, FW-L2, CDR-L2, FW-L3, CDR-L3, FW-L4. Numbering systems have been designed for assigning numbers to amino acids occupying positions in each of these domains. The numbering system is described in Kabat Sequences of Proteins of Immunological Interest (1987 and 1991, NIH, bethesda, MD) or Chothia and Lesk,1987, J.Mol. Biol.196:901-917; chothia et al, 1989, nature 342:878-883. The Complementarity Determining Regions (CDRs) and Framework Regions (FRs) of a given antibody can be identified using this system. Other numbering systems for amino acids in immunoglobulin chains include (International immunogenetics information System; lefranc et al, dev. Comp. Immunol.29:185-203; 2005) and AHo (Honyger and Pluckaphun, J. Mol. Biol.309 (3): 657-670; 2001). The binding domains disclosed herein may utilize CDRs defined according to any of these systems. For any given embodiment comprising more than one CDR, the CDR may be defined according to any one of Kabat, chothia, extended, IMGT, paratome, abM and/or conformational definition or a combination of any of the foregoing. Either CDR may be interpreted by one of ordinary skill in the art according to any of these numbering systems, either alone or in the context of variable domains. One or more CDRs may be incorporated covalently or non-covalently into the molecule to make it an antigen binding protein.

In some embodiments, the antigen binding proteins provided herein comprise one or more CDRs as part of a larger polypeptide chain. In some embodiments, the antigen binding protein covalently links the one or more CDRs to another polypeptide chain. In some embodiments, the antigen binding protein is non-covalently incorporated into the one or more CDRs. In some embodiments, the antigen binding protein may comprise at least one of the CDRs described herein incorporated into a biocompatible framework structure. In some embodiments, the biocompatible framework structure comprises a polypeptide or portion thereof sufficient to form a conformationally stable structural support or framework or scaffold capable of displaying one or more amino acid sequences (e.g., CDRs, variable regions, etc.) that bind to an antigen in a localized surface region. Such structures may be naturally occurring polypeptides or polypeptide "folds" (structural motifs), or may have one or more modifications, such as amino acid additions, deletions and/or substitutions, relative to the naturally occurring polypeptide or fold. Depending on the embodiment, the scaffold may be derived from polypeptides of a variety of different species (or more than one species), such as humans, non-human primates or other mammals, other vertebrates, invertebrates, plants, bacteria or viruses.

The term "consensus sequence" as used herein with respect to sequences refers to a broad sequence that represents all the different combinations of allowed amino acids at each position of a set of sequences. Consensus sequences can provide insight into conserved regions of related sequences, where units (e.g., amino acids or nucleotides) are identical in most or all sequences, as well as regions that exhibit differences between sequences. In the case of antibodies, the consensus sequence of the CDRs may indicate amino acids important or not necessary for antigen binding. It is contemplated that the consensus sequence may be prepared with any of the sequences provided herein, and that the resulting various sequences derived from the consensus sequence are verified to have similar effects as the template sequence.

In some embodiments, the antibody or binding fragment thereof comprises a combination of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3, wherein one or more of these CDRs are defined by a consensus sequence. The consensus sequences provided herein are derived from an alignment of CDRs provided herein. However, it is contemplated that alternative alignments may be performed (e.g., using global or local alignments, or using different algorithms, such as a hidden Markov model, a seed guide tree, a Needleman-Wunsch algorithm, or a Smith-Waterman algorithm), and thus alternative consensus sequences may be derived.

In some embodiments, the CDR-H1 is represented by formula X ₁ TFX ₄ X ₅ X ₆ X ₇ X ₈ X ₉ (SEQ ID NO: 1202) definition wherein X ₁ Is G or Y; x is X ₄ Is R or T; x is X ₅ D, E, N or S; x is X ₆ Is N or Y; x is X ₇ A, D, E, G or Y; x is X ₈ I, L or M; x is X ₉ H, N or S. In some embodiments, the CDR-H1 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-H1 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4, 5, or 6 substitutions.

In some embodiments, the CDR-H2 is represented by formula GX ₂ X ₃ X ₄ X ₅ X ₆ X ₇ GX ₉ X ₁₀ X ₁₁ YA (SEQ ID NO: 1203) wherein X ₂ G, I, V or W; x is X ₃ Is I or M; x is X ₄ I, N or S; x is X ₅ Is A or P; x is X ₆ I, N, S or Y; x is X ₇ F, G, N or S; x is X ₉ A, D, G, H, N, S or T; x is X ₁₀ Is A or T; x is X ₁₁ G, I, N or S. In some embodiments, the CDR-H2 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-H2 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4, 5, or 6 substitutions.

In some embodiments, the CDR-H3 is represented by formula CAX ₃ X ₄ X ₅ X ₆ X ₇ X ₈ X ₉ X ₁₀ X ₁₁ X ₁₂ X ₁₃ X ₁₄ X ₁₅ X ₁₆ X ₁₇ X ₁₈ X ₁ ₉ X ₂₀ W (SEQ ID NO: 1204) is defined, wherein X ₁ Is C; x is X ₂ Is A; x is X ₃ G, K or R; x is X ₄ D, E, G, S or Y; x is X ₅ F, H, I, M, P, R, S, W or Y; x is X ₆ G, S or V; x is X ₇ Non-amino acids, A, D, G or V; x is X ₈ Non-amino acid, A, G, N, W or Y; x is X ₉ Non-amino acids, A, P, T or Y; x is X ₁₀ Non-amino acid, A, E, G, H, R or Y; x is X ₁₁ Non-amino acid, A, D, G, H or S; x is X ₁₂ Non-amino acid, D, F, G or W; x is X ₁₃ Non-amino acid, A, D, E, G, V or Y; x is X ₁₄ Non-amino acid, F, M or Y; x is X ₁₅ Non-amino acids or Y; x is X ₁₆ Non-amino acids or Y; x is X ₁₇ Non-amino acids or G; x is X ₁₈ Non-amino acids or M; x is X ₁₉ Is D or G; x is X ₂₀ I, L, V or Y. In some embodiments, the CDR-H3 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-H3 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4, 5, or 6 substitutions.

In some embodiments, the CDR-L1 is represented by formula X ₁ ASQX ₅ X ₆ X ₇ X ₈ X ₉ LX ₁₁ (SEQ ID NO: 1205) definition, wherein X ₁ Is Q or R; x is X ₅ D, G, S or T; x is X ₆ Is I or V; x is X ₇ G, R or S; x is X ₈ N, R or S; x is X ₉ F, W or Y; x is X ₁₁ Is A or N. In some embodiments, the CDR-L1 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-L1 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4,5 or 6 substituted sequences.

In some embodiments, the CDR-L2 is represented by formula X ₁ X ₂ SX ₄ X ₅ X ₆ X ₇ (SEQ ID NO: 1206), wherein X ₁ A, D or G; x is X ₂ Is A or T; x is X ₄ D, N, S or T; x is X ₅ Is L or R; x is X ₆ A, E or Q; x is X ₇ A, N, S or T. In some embodiments, the CDR-L2 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-L2 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4, 5, or 6 substitutions.

In some embodiments, the CDR-L3 is represented by the formula CQQX ₄ X ₅ X ₆ X ₇ X ₈ X ₉ X ₁₀ X ₁₁ (SEQ ID NO: 1207) definition, wherein X ₄ A, S or Y; x is X ₅ D, H, I or Y; x is X ₆ N, S or T; x is X ₇ A, F, P, S or T; x is X ₈ Is L or P; x is X ₉ L, S, T, V, W or Y; x is X ₁₀ Non-amino acids, F or T; and X is ₁₁ Non-amino acids or F. In some embodiments, the CDR-L3 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-L3 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4, 5, or 6 substitutions.

In some embodiments, the CDR-H1 is represented by formula X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ X ₈ X ₉ X ₁₀ X ₁₁ X ₁₂ (SEQ ID NO: 1208) definition wherein X ₁ F, G, N or Y; x is X ₂ I, R, S, T or V; x is X ₃ Is F or L; x is X ₄ A, D, I, N, R, S or T;X ₅ a, D, E, G, N, R, S or T; x is X ₆ Non-amino acid H, S or Y; x is X ₇ Non-amino acids, A, D, G, T or V; x is X ₈ Non-amino acid, D, F, I or M; x is X ₉ H, N, Q, S or Y; x is X ₁₀ Non-amino acid, A, E, F, G, H, L, S or Y; x is X ₁₁ Non-amino acids, I, L, M, T or V; x is X ₁₂ Non-amino acids, H or Y. In some embodiments, the CDR-H1 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-H1 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4, 5, or 6 substitutions.

In some embodiments, the CDR-H2 is represented by formula X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ X ₈ X ₉ X ₁₀ X ₁₁ X ₁₂ X ₁₃ X ₁₄ (SEQ ID NO: 1209) definition, wherein X ₁ A, G or S; x is X ₂ A, G, I, M, R, S, T, V or W; x is X ₃ Amino acid-free, F, I, M or V; x is X ₄ D, I, N, S or T; x is X ₅ A, K, P, S or T; x is X ₆ D, G, H, I, M, N, R, S, T or Y; x is X ₇ A, D, F, G, N, S or T; x is X ₈ Is A or G; x is X ₉ A, D, G, H, I, K, N, R, S, T, V or Y; x is X ₁₀ A, E, N, P, S or T; x is X ₁₁ A, D, G, H, I, K, L, N, Q, S, T or Y; x is X ₁₂ F, N or Y; x is X ₁₃ Is A or Y; x is X ₁₄ Non-amino acids, a or V. In some embodiments, the CDR-H2 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-H2 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4, 5, or 6 substitutions.

In some embodiments, the CDR-H3 is represented by formula X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ X ₈ X ₉ X ₁₀ X ₁₁ X ₁₂ X ₁₃ X ₁₄ X ₁₅ X ₁₆ X ₁₇ X ₁₈ X ₁ ₉ X ₂₀ X ₂₁ X ₂₂ X ₂₃ X ₂₄ X ₂₅ X ₂₆ X ₂₇ W (SEQ ID NO: 1210), wherein X ₁ Non-amino acids or C; x is X ₂ Non-amino acids, a or C; x is X ₃ Non-amino acids, A, C, K or V; x is X ₄ Non-amino acid, A, D, G, K, M, R, S or W; x is X ₅ Non-amino acids, A, D, E, G, H, T or V; x is X ₆ Non-amino acid, C, D, E, F, G, H, L, M, N, P, Q, R, S, T, V or Y; x is X ₇ Non-amino acid, A, D, E, G, I, L, M, N, Q, R, S, V or Y; x is X ₈ Non-amino acid, A, F, I, L, P, R, T, V, W or Y; x is X ₉ Non-amino acid, D, E or Y; x is X ₁₀ Non-amino acid, G, S, V or Y; x is X ₁₁ Non-amino acid, E, G, I or S; x is X ₁₂ Non-amino acids or G; x is X ₁₃ Non-amino acid, L or T; x is X ₁₄ Non-amino acid, D, L or T; x is X ₁₅ Non-amino acid, A, C, D, G, H or P; x is X ₁₆ Non-amino acid, A, C, F, G, L, M or Y; x is X ₁₇ Non-amino acids, A, C, D, E, G, K, N, R, S, T or V; x is X ₁₈ Non-amino acid, A, C, D, E, G, I, L, N, P, R, S, T, V, W or Y; x is X ₁₉ Non-amino acid, A, D, E, F, G, H, K, L, N, Q, R, S, T, W or Y; x is X ₂₀ Non-amino acid, A, C, D, E, G, I, M, P, Q, S, T, V, W or Y; x is X ₂₁ Non-amino acid, A, D, E, F, G, H, L, Q, S, V, W or Y; x is X ₂₂ Non-amino acid, A, D, E, F, G, H, I, L, M, N, P, Q, S, T, W or Y; x is X ₂₃ Non-amino acid, A, D, E, G, H, L, P, S, T, V, W or Y; x is X ₂₄ Non-amino acid, A, D, E, F, G, I, L, Q, S, T, V, W or Y; x is X ₂₅ Is a non-formAmino acid, A, F, I, L, M, S, V or Y; x is X ₂₆ Non-amino acids, D, G, L or V; and X is ₂₇ I, L, N, P, V or Y. In some embodiments, the CDR-H3 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-H3 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4, 5, or 6 substitutions.

In some embodiments, the CDR-L1 is represented by formula X ₁ X ₂ SX ₄ X ₅ X ₆ X ₇ X ₈ X ₉ X ₁₀ X ₁₁ X ₁₂ X ₁₃ X ₁₄ X ₁₅ X ₁₆ X ₁₇ (SEQ ID NO: 1211), wherein X ₁ K, Q or R; x is X ₂ A, S or T; x is X ₄ E, H, Q, S or T; x is X ₅ Non-amino acids or S; x is X ₆ Non-amino acids, L or V; x is X ₇ Non-amino acids or L; x is X ₈ Non-amino acid, H or Y; x is X ₉ Non-amino acids or S; x is X ₁₀ Non-amino acids or S; x is X ₁₁ D, E, G, N, R, S or T; x is X ₁₂ G, I, N or V; x is X ₁₃ D, G, K, N, R, S, T or Y; x is X ₁₄ D, G, H, I, K, N, R, S or T; x is X ₁₅ D, F, G, N, S, W or Y; x is X ₁₆ Is L or V; x is X ₁₇ A, D, G, H or N. In some embodiments, the CDR-L1 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-L1 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4, 5, or 6 substitutions.

In some embodiments, the CDR-L2 is represented by formula X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ (SEQ ID NO: 1212), wherein X ₁ A, D, E, G, H, L, Q, S, W or Y; x is X ₂ A, G, T or V; x is X ₃ Is S or T; x is X ₄ D, N, S, T or Y; x is X ₅ Is L or R; x is X ₆ A, D, E, H or Q; x is X ₇ A, G, I, N, R, S or T. In some embodiments, the CDR-L2 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-L2 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4, 5, or 6 substitutions.

In some embodiments, the CDR-L3 is represented by formula X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ X ₈ X ₉ X ₁₀ X ₁₁ (SEQ ID NO: 1213), wherein X ₁ Is C or L; x is X ₂ L, M, Q or S; x is X ₃ Is K, Q, or T; x is X ₄ A, D, G, N, S, T or Y; x is X ₅ A, D, F, H, I, L, N, R, T or Y; x is X ₆ A, D, E, G, H, I, N, Q, R, S or T; x is X ₇ A, F, G, I, P, S, T, W or Y; x is X ₈ L, P or T; x is X ₉ A, F, I, L, M, P, S, T, V, W or Y; x is X ₁₀ Non-amino acid, A, F, H, R, S or T; and X is ₁₁ Non-amino acids or F. In some embodiments, the CDR-L3 comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the consensus sequence. In some embodiments, the CDR-L3 comprises a sequence from the consensus sequence having 0, 1, 2, 3, 4, 5, or 6 substitutions.

Depending on the embodiment, the biocompatible framework structure is based on a protein scaffold or scaffold other than an immunoglobulin domain. In some such embodiments, those framework structures are based on fibronectin, ankyrin, lipocalin, neocarcinostatin, cytochrome b, CP1 zinc finger, PST1, coiled coil, LACI-D1, Z domain, and/or an amylase inhibitor (tendamistat) domain.

In some embodiments, antigen binding proteins having more than one binding site are also provided. In several embodiments, the binding sites are identical to each other, while in some embodiments, the binding sites are different from each other. For example, antibodies typically have two identical binding sites, while "bispecific" or "bifunctional" antibodies have two different binding sites. The two binding sites of the bispecific antigen binding protein or antibody will bind to two different epitopes, which may be located on the same or different protein targets. In several embodiments, this is particularly advantageous because bispecific chimeric antigen receptors can confer the ability to target engineered cells with a variety of tumor markers. For example, CD70 and additional tumor markers (e.g., CD123, CD19, her2, mesothelin, claudin 6, BCMA, EGFR, MICA, MICB, ULBP, ULBP2, ULBP3, ULBP4, ULBP5, ULBP6, etc.) or any other marker disclosed herein or understood in the art as a tumor-specific antigen or tumor-associated antigen may be bound by a bispecific antibody.

As used herein, the term "chimeric antibody" shall be given its ordinary meaning and shall also refer to an antibody that contains one or more regions from one antibody as well as one or more regions from one or more other antibodies. In some embodiments, one or more CDRs are derived from an anti-cancer antigen (e.g., CD70, CD19, CD123, her2, mesothelin, PD-L1, claudin 6, BCMA, EGFR, etc.) antibody. In several embodiments, all CDRs are derived from an anti-cancer antigen antibody (e.g., an anti-CD 70 antibody). In some embodiments, CDRs from more than one anti-cancer antigen antibody are mixed and matched in a chimeric antibody. For example, a chimeric antibody may comprise CDR1 from the light chain of a first anti-cancer antigen antibody, CDR2 and CDR3 from the light chain of a second anti-cancer antigen antibody, and CDR from the heavy chain of a third anti-cancer antigen antibody. Furthermore, the framework regions of the antigen binding proteins disclosed herein can be derived from one and the same anti-cancer antigen (e.g., CD70, CD123, CD19, her2, mesothelin, claudin 6, BCMA, EGFR, etc.) antibody, from one or more different antibodies (e.g., human antibodies), or from a humanized antibody. In one example of a chimeric antibody, a portion of the heavy and/or light chain is identical to, homologous to, or derived from an antibody from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical to, homologous to, or derived from one or more antibodies from another species or belonging to another antibody class or subclass. Also provided herein are fragments of such antibodies that exhibit the desired biological activity. In some embodiments, a CAR disclosed herein comprises an anti-CD 70 binding domain. In some embodiments, the anti-CD 70 binding domain is an scFv. In several embodiments, the CARs disclosed herein comprise scFv as a binding agent to a tumor antigen. In several embodiments, the scFv is encoded by a polynucleotide comprising a sequence having at least about 85%, about 90%, about 95% or more sequence identity to one or more of SEQ ID NOs 36-120, 221-229, 1038-1111, 1112-1185. In several embodiments, the scFv comprises an amino acid sequence having at least about 85%, about 90%, about 95% or more sequence identity to one or more of SEQ ID NOS 230-312, 890-963 and/or 964-1037.

Natural killer domain binding to tumor ligand

In several embodiments, the ability of engineered immune cells (e.g., NK cells) to recognize and destroy tumor cells is exploited. For example, an engineered NK cell can comprise a CD 70-directed chimeric antigen receptor or a nucleic acid encoding the chimeric antigen receptor (or a CAR against one or more of, e.g., CD123, CD19, her2, mesothelin, claudin 6, BCMA, EGFR, etc.). NK cells express both inhibitory and activating receptors on the cell surface. Inhibiting the receptor from binding to self-molecules expressed on the surface of healthy cells (thereby preventing an immune response against "self" cells), while activating the receptor to bind to ligands expressed on abnormal cells (e.g., tumor cells). NK cell activation occurs and lyses target (e.g. tumor) cells when the balance between inhibition of receptor and activation of the activation receptor favors activation of the receptor.

Natural killer group 2 member D (NKG 2D) is an NK cell activating receptor that recognizes a variety of ligands expressed on cells. In healthy cells, the surface expression of the various NKG2D ligands is usually low, but up-regulated at e.g. malignant transformation. Non-limiting examples of ligands recognized by NKG2D include, but are not limited to MICA, MICB, ULBP, ULBP2, ULBP3, ULBP4, ULBP5 and ULBP6, and other molecules expressed on target cells that control the cytolytic or cytotoxic function of NK cells. In several embodiments, T cells are engineered to express an extracellular domain to bind one or more tumor ligands and activate T cells. For example, in several embodiments, T cells are engineered to express NKG2D receptors as binding/activating moieties. In several embodiments, an engineered cell as disclosed herein is engineered to express another member of the NKG2 family, e.g., NKG2A, NKG2C and/or NKG2E. Combinations of such receptors are engineered in some embodiments. In addition, in several embodiments, other receptors are expressed, such as killer cell immunoglobulin-like receptors (KIRs).

In several embodiments, the cells are engineered to express a cytotoxic receptor complex comprising full length NKG2D as an extracellular component, thereby recognizing ligands on the surface of tumor cells (e.g., hepatocytes). In one embodiment, full-length NKG2D has the nucleic acid sequence of SEQ ID NO: 27. In several embodiments, the full-length NKG2D or functional fragment thereof is human NKG2D. Additional information regarding chimeric receptors for use in the methods and compositions of the present disclosure can be found in PCT patent publication No. WO/2018/183385, which is incorporated herein by reference in its entirety.

In several embodiments, the cells are engineered to express a cytotoxic receptor complex comprising a functional fragment of NKG2D as an extracellular component, thereby recognizing ligands on the surface of tumor cells or other diseased cells. In one embodiment, the functional fragment of NKG2D has the nucleic acid sequence of SEQ ID NO. 25. In several embodiments, the fragment of NKG2D has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to full-length wild-type NKG2D. In several embodiments, the fragment may have one or more additional mutations compared to SEQ ID NO. 25, but retain ligand binding function or in some embodiments have enhanced ligand binding function. In several embodiments, the functional fragment of NKG2D comprises the amino acid sequence of SEQ ID NO. 26. In several embodiments, the NKG2D fragments are provided in the form of dimers, trimers, or other concatemers, such embodiments providing enhanced ligand binding activity. In several embodiments, the sequence encoding the NKG2D fragment is optionally fully or partially codon optimized. In one embodiment, the sequence encoding the codon optimized NKG 2D-fragment comprises the sequence of SEQ ID NO. 28. Advantageously, according to several embodiments, the functional fragment lacks its native transmembrane domain or intracellular domain, but retains its ability to bind to the ligand of NKG2D and transduce an activation signal upon ligand binding. Another advantage of such fragments is that DAP10 expression is not required to localize NKG2D to the cell membrane. Thus, in several embodiments, the cytotoxic receptor complex encoded by the polypeptides disclosed herein does not comprise DAP10. In several embodiments, immune cells, such as NK or T cells (e.g., non-alloreactive T cells engineered according to embodiments disclosed herein), are engineered to express one or more chimeric receptors that target, for example, CD70, CD19, CD123, her2, mesothelin, claudin 6, BCMA, EGFR, and NKG2D ligands, such as MICA, MICB, ULBP, ULBP2, ULBP3, ULBP4, ULBP5, and/or ULBP6. In several embodiments, such cells also co-express mbIL15.

In several embodiments, the cytotoxic receptor complex is configured to dimerize. Dimerization may comprise homodimers or heterodimers, depending on the embodiment. In several embodiments, dimerization results in improved ligand recognition of the cytotoxic receptor complex (and thus NK cells expressing the receptor), resulting in a reduction (or lack) of adverse toxic effects. In several embodiments, the cytotoxic receptor complex employs internal dimers or repeats of one or more of the constituent subunits. For example, in several embodiments, the cytotoxic receptor complex may optionally comprise a first NKG2D extracellular domain coupled to a second NKG2D extracellular domain and a transmembrane/signaling region (or a separate transmembrane region and a separate signaling region).

In several embodiments, the various domains/subdomains are separated by a linker, for example using a GS3 linker (SEQ ID NOs: 15 and 16, nucleotides and proteins, respectively) (or a GSn linker). Other linkers used in accordance with various embodiments disclosed herein include, but are not limited to, those encoded by SEQ ID NOs 17, 19, 21 or 23. In several embodiments, the other linker comprises a peptide sequence of one of SEQ ID NOs 18, 20, 22, 24. This provides the potential to separate the individual component parts of the receptor complex along the polynucleotide, which may enhance expression, stability and/or function of the receptor complex.

Cytotoxic signaling complexes

Some embodiments of the compositions and methods described herein relate to chimeric receptors, such as chimeric antigen receptors (e.g., CARs against CD 70) or chimeric receptors against NKG2D ligands (e.g., MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and/or ULBP 6), that include a cytotoxic signaling complex. As disclosed herein, according to several embodiments, provided cytotoxic receptor complexes comprise one or more transmembrane domains and/or intracellular domains that trigger a cytotoxic signaling cascade upon binding of one or more extracellular domains to a ligand on the surface of a target cell.

In several embodiments, the cytotoxic signaling complex comprises at least one transmembrane domain, at least one costimulatory domain, and/or at least one signaling domain. In some embodiments, more than one component part constitutes a given domain-for example, a co-stimulatory domain may comprise two subdomains. Furthermore, in some embodiments, the domain may serve multiple functions, e.g., the transmembrane domain may also serve to provide signaling functions.

Transmembrane domain

Some embodiments of the compositions and methods described herein relate to chimeric receptors (e.g., tumor antigen directed CARs and/or ligand directed chimeric receptors) comprising a transmembrane domain. Some embodiments include a transmembrane domain from NKG2D or another transmembrane protein. In several embodiments in which a transmembrane domain is used, the portion of the transmembrane protein used retains at least a portion of its normal transmembrane domain.

However, in several embodiments, the transmembrane domain comprises at least a portion of CD8, which CD8 is a transmembrane glycoprotein that is typically expressed on both T cells and NK cells. In several embodiments, the transmembrane domain comprises CD8 a. In several embodiments, the transmembrane domain is referred to as a "hinge". In several embodiments, the "hinge" of CD 8. Alpha. Has the nucleic acid sequence of SEQ ID NO. 1. In several embodiments, the CD8 a hinge is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to CD8 a having the sequence of SEQ ID No. 1. In several embodiments, the "hinge" of CD 8. Alpha. Comprises the amino acid sequence of SEQ ID NO. 2. In several embodiments, CD8 alpha may be truncated or modified such that it has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity with the sequence of SEQ ID NO. 2.

In several embodiments, the transmembrane domain comprises a CD8 a transmembrane region. In several embodiments, the CD 8. Alpha. Transmembrane domain has the nucleic acid sequence of SEQ ID NO. 3. In several embodiments, the CD8 a hinge is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to CD8 a having the sequence of SEQ ID No. 3. In several embodiments, the CD 8. Alpha. Transmembrane domain comprises the amino acid sequence of SEQ ID NO. 4. In several embodiments, the CD8 a hinge is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to CD8 a having the sequence of SEQ ID No. 4.

In summary, in several embodiments, the CD8 hinge/transmembrane complex is encoded by the nucleic acid sequence of SEQ ID NO. 13. In several embodiments, the CD8 hinge/transmembrane complex is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to a CD8 hinge/transmembrane complex having the sequence of SEQ ID No. 13. In several embodiments, the CD8 hinge/transmembrane complex comprises the amino acid sequence of SEQ ID NO. 14. In several embodiments, the CD8 hinge/transmembrane complex hinge is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to a CD8 hinge/transmembrane complex having the sequence of SEQ ID No. 14.

In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain or fragment thereof. In several embodiments, the CD28 transmembrane domain comprises the amino acid sequence of SEQ ID NO. 30. In several embodiments, the CD28 transmembrane domain complex hinge is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to a CD28 transmembrane domain having the sequence of SEQ ID No. 30.

Co-stimulatory domains

Some embodiments of the compositions and methods described herein relate to chimeric receptors (e.g., tumor antigen-directed CARs and/or tumor ligand-directed chimeric receptors) comprising a co-stimulatory domain. In addition, in several embodiments, various transmembrane and signaling domains (and combinations of transmembrane/signaling domains), additional coactivating molecules may be provided. These may be, for example, certain molecules that further enhance the activity of immune cells. Cytokines may be used in some embodiments. For example, certain interleukins, such as IL-2 and/or IL-15, are used as non-limiting examples. In some embodiments, immune cells for use in therapy are engineered to express such molecules in secreted form. In further embodiments, such co-stimulatory domains are engineered to be film-bound, acting as autocrine stimulatory molecules (or even as paracrine stimulators of neighboring cells).

In several embodiments, NK cells disclosed herein are engineered to express interleukin 15 (IL 15, IL-15). In some embodiments, the IL15 is expressed by a separate cassette on a construct comprising any of the CARs disclosed herein. In some embodiments, the IL15 is expressed in the same cassette as any CAR disclosed herein, optionally separated by a cleavage site (e.g., a proteolytic cleavage site or a T2A, P2A, E a or F2A self cleaving peptide cleavage site). In some embodiments, the IL15 is membrane-bound IL15 (mbIL 15). In some embodiments, the mbIL15 comprises a native IL15 sequence (e.g., a human native IL15 sequence) and at least one transmembrane domain. In some embodiments, the native IL15 sequence is encoded by a sequence having at least 85%, at least 90%, at least 95% sequence identity with SEQ ID NO. 11. In some embodiments, the native IL15 sequence comprises a peptide sequence having at least 85%, at least 90%, at least 95% sequence identity with SEQ ID NO. 12. In some embodiments, the at least one transmembrane domain comprises a CD8 transmembrane domain. In some embodiments, the mbIL15 may comprise additional components, such as a leader sequence and/or a hinge sequence. In some embodiments, the leader sequence is a CD8 leader sequence. In some embodiments, the hinge sequence is a CD8 hinge sequence.

In some embodiments, the tumor antigen directed CAR and/or tumor ligand directed chimeric receptor is encoded by a polynucleotide encoding one or more cytoplasmic protease cleavage sites. Such sites are recognized and cleaved by cytoplasmic proteases, which can result in the separation (and separate expression) of the individual component parts of the receptor encoded by the polynucleotide. In some embodiments, the tumor antigen directed CAR and/or tumor ligand directed chimeric receptor is encoded by a polynucleotide encoding one or more self-cleaving peptides (e.g., a T2A cleavage site, a P2A cleavage site, an E2A cleavage site, and/or an F2A cleavage site). As a result, depending on the embodiment, the individual component parts of the engineered cytotoxic receptor complex may be delivered to NK cells or T cells in a single vector or through multiple vectors. Thus, as schematically shown in the figures, the construct may be encoded by a single polynucleotide, but also include a cleavage site such that downstream elements of the construct are expressed by the cell as separate proteins (as is the case with IL-15 in some embodiments). In several embodiments, a T2A cleavage site is used. In several embodiments, the T2A cleavage site has the nucleic acid sequence of SEQ ID NO. 9. In several embodiments, the T2A cleavage site may be truncated or modified such that it has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to the sequence of SEQ ID NO. 9. In several embodiments, the T2A cleavage site comprises the amino acid sequence of SEQ ID NO. 10. In several embodiments, the T2A cleavage site is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to the T2A cleavage site having the sequence of SEQ ID NO. 10.

In several embodiments, NK cells are engineered to express membrane-bound interleukin 15 (mbIL 15). In such embodiments, mbIL15 expression on NK enhances the cytotoxic effects of the engineered NK cells by enhancing proliferation and/or longevity of the NK cells. In several embodiments, the mbIL15 is encoded by the same polynucleotide as the CAR. In some embodiments, mbIL15 is encoded by a polynucleotide comprising the sequence of SEQ ID No. 11 and a sequence encoding a transmembrane domain. In some embodiments, mbIL15 comprises the amino acid sequence of SEQ ID NO. 12 functionally coupled to the amino acid sequence of a transmembrane domain. In several embodiments, mbIL15 has the nucleic acid sequence of SEQ ID No. 1188. In several embodiments, mbIL15 may be truncated or modified such that it has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to the sequence of SEQ ID No. 1188. In several embodiments, mbIL15 comprises the amino acid sequence of SEQ ID No. 1189. In several embodiments, mbIL15 is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to mbIL15 having the sequence of SEQ ID No. 1189. Membrane-bound IL15 sequences are explored in PCT publications WO 2018/183385 and WO 2020/056045, each of which is expressly incorporated herein by reference in its entirety and belongs to the membrane-bound IL15 sequences.

Signaling domains

Some embodiments of the compositions and methods described herein relate to chimeric receptors (e.g., tumor antigen-directed CARs and/or tumor ligand-directed chimeric receptors) comprising a signaling domain. For example, an immune cell engineered according to several embodiments disclosed herein may comprise at least one subunit of a CD 3T cell receptor complex (or fragment thereof). In several embodiments, the signaling domain comprises a cd3ζ subunit. In several embodiments, the CD3 ζ is encoded by the nucleic acid sequence of SEQ ID NO. 7. In several embodiments, the cd3ζ may be truncated or modified such that it has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to cd3ζ having the sequence of SEQ ID No. 7. In several embodiments, the CD3 zeta domain comprises the amino acid sequence of SEQ ID NO. 8. In several embodiments, the cd3ζ domain is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to a cd3ζ domain having a sequence of SEQ ID No. 8.

In several embodiments, unexpectedly enhanced signaling is achieved by using multiple signaling domains whose activities act synergistically. For example, in several embodiments, the signaling domain further comprises an OX40 domain. In several embodiments, the OX40 domain is an intracellular signaling domain. In several embodiments, the OX40 intracellular signaling domain has a nucleic acid sequence of SEQ ID NO. 5. In several embodiments, the OX40 intracellular signaling domain may be truncated or modified such that it has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to OX40 having the sequence of SEQ ID No. 5. In several embodiments, the OX40 intracellular signaling domain comprises the amino acid sequence of SEQ ID NO. 6. In several embodiments, the OX40 intracellular signaling domain is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to an OX40 intracellular signaling domain having the sequence of SEQ ID No. 6. In several embodiments, OX40 is used as the sole transmembrane/signaling domain in the construct, however, in several embodiments OX40 may be used with one or more other domains. For example, a combination of OX40 and cd3ζ is used in some embodiments. As further examples, combinations of CD28, OX40, 4-1BB, and/or CD3 ζ are used in some embodiments.

In several embodiments, the signaling domain comprises a 4-1BB domain. In several embodiments, the 4-1BB domain is an intracellular signaling domain. In several embodiments, the 4-1BB intracellular signaling domain comprises the amino acid sequence of SEQ ID NO. 29. In several embodiments, the 4-1BB intracellular signaling domain is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to the 4-1BB intracellular signaling domain having the sequence of SEQ ID NO. 29. In several embodiments, 4-1BB is used as the sole transmembrane/signaling domain in the construct, however, in several embodiments, 4-1BB may be used with one or more other domains. For example, a combination of 4-1BB and CD3 ζ is used in some embodiments. As further examples, combinations of CD28, OX40, 4-1BB, and/or CD3 ζ are used in some embodiments.

In several embodiments, the signaling domain comprises a CD28 domain. In several embodiments, the CD28 domain is an intracellular signaling domain. In several embodiments, the CD28 intracellular signaling domain comprises the amino acid sequence of SEQ ID NO. 31. In several embodiments, the CD28 intracellular signaling domain is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to a CD28 intracellular signaling domain having the sequence of SEQ ID No. 31. In several embodiments, CD28 is used as the sole transmembrane/signaling domain in the construct, however, in several embodiments CD28 may be used with one or more other domains. For example, in some embodiments a combination of CD28 and CD3 ζ is used. As further examples, combinations of CD28, OX40, 4-1BB, and/or CD3 ζ are used in some embodiments.

Cytotoxic receptor complex constructs

Some embodiments of the compositions and methods described herein relate to chimeric antigen receptors (e.g., CD 19-directed chimeric receptors) and chimeric receptors (e.g., activated Chimeric Receptors (ACRs) that target ligands of NKG 2D). Expression of these cytotoxic receptor complexes in immune cells (e.g., genetically modified non-alloreactive T cells and/or NK cells) allows for targeting and destruction of specific target cells (e.g., cancer cells). Non-limiting examples of such cytotoxic receptor complexes are discussed in more detail below.

Chimeric antigen receptor cytotoxic receptor complex constructs

In several embodiments, provided herein are various cytotoxic receptor complexes (also referred to as cytotoxic receptors) having the general structure of chimeric antigen receptors. Figures 1-7 depict non-limiting schematic diagrams of constructs comprising a tumor binding moiety that binds to a tumor antigen or tumor-associated antigen expressed on the surface of a cancer cell and activates an engineered cell expressing a chimeric antigen receptor. FIG. 7 shows a schematic representation of a chimeric receptor complex in which NKG2D activates a chimeric receptor as a non-limiting example (see NKG2D ACRa and ACRb). Figure 6 shows a schematic of a CD70 directed CAR and a bispecific CD70 CAR/chimeric receptor complex and two CD70 targeting non-limiting constructs NK71 and NK 72.

As shown, several embodiments of the CAR comprise an anti-tumor binding agent, a CD8a hinge domain, an Ig4SH domain (or hinge), a CD8a transmembrane domain, a CD28 transmembrane domain, an OX40 domain, a 4-1BB domain, a CD28 domain, a CD3 zeta ITAM domain or subdomain, a CD3 zeta domain, a NKp80 domain, a CD16 IC domain, a 2A cleavage site, and/or a membrane bound IL-15 domain (although soluble IL-15 is used in several embodiments as described above). In several embodiments, the binding and activation functions are engineered to be performed by separate domains. Several embodiments relate to complexes having more than one tumor-binding moiety or other binding/activating moiety. In some embodiments, the binding agent/activating moiety targets other markers than CD70, such as a cancer target as described herein, e.g., CD19, CD123, CLDN6, BCMA, HER2, mesothelin, PD-L1, or EGFR. In several embodiments, constructs are provided that target NKG2D ligands on tumor cells, which can be used in combination with the CARs disclosed herein. In several embodiments, the general structure of the chimeric antigen receptor construct comprises a hinge and/or a transmembrane domain. In some embodiments, these can be realized by a single domain, or in several embodiments multiple subdomains can be used. The receptor complex further comprises a signaling domain that transduces a signal upon binding of the homing moiety to the target cell, ultimately resulting in a cytotoxic effect on the target cell. In several embodiments, the complex further comprises a co-stimulatory domain, in several embodiments, that co-operates to enhance the function of the signaling domain. Expression of these complexes in immune cells (e.g., NK cells and/or T cells) allows targeting and destruction of specific target cells, such as cancer cells expressing a given tumor marker. Some such receptor complexes comprise an extracellular domain containing an anti-CD 70 moiety or CD70 binding moiety that binds to CD70 on the surface of a target cell and activates an engineered cell. The cd3ζitam subdomains may collectively act as signaling domains. IL-15 domains (e.g., mbiL-15 domains) can act as co-stimulatory domains. IL-15 domains (e.g., mbiL-15 domains) can make immune cells (e.g., NK or T cells) expressing them particularly effective against target tumor cells. It should be understood that according to several embodiments, the IL-15 domain (e.g., mbiL-15 domain) may be encoded on a separate construct. In addition, each component may be encoded in one or more separate constructs.

Disclosed herein in some embodiments are anti-CD 70 binding domains. In some embodiments, the anti-CD 70 binding domain is an scFv. These anti-CD 70 binding domains are specific for CD70 and/or preferentially bind CD70. The anti-CD 70 binding domains disclosed herein can be incorporated into any of the chimeric antigen receptor constructs disclosed herein. The anti-CD 70 binding domains disclosed herein can also be expressed by cells alone or within an anti-CD 70 CAR.

In some embodiments, the anti-CD 70 binding domain comprises a polynucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the sequence of SEQ ID NO:36 and/or SEQ ID NO:37, or is identical within a range defined by any two of the foregoing percentages.

In some embodiments, the anti-CD 70 binding domain comprises a heavy chain variable region and a light chain variable region. In some embodiments, the heavy chain variable region comprises CDR-H1, CDR-H2 and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2 and CDR-L3. In some embodiments, the CDR-H1 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS 428-501; the CDR-H2 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOs 502-575; the CDR-H3 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOs 576-649; the CDR-L1 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 668-741; the CDR-L2 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOs 742-815; and the CDR-L3 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOS 816-889.

In some embodiments of the anti-CD 70 binding domain, the heavy chain variable region comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOS 890-963. In some embodiments, the light chain variable region comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOs 964-1037.

In some embodiments of the anti-CD 70 binding domain: 1) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 890 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 964; 2) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 891 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 965; 3) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 892 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 966; 4) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 893 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 967; 5) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 894 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 968; 6) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 895 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 969; 7) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 896 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 970; 8) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 897 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 971; 9) The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 898 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 972; 10 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 899 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 973; 11 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 900 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 974; 12 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 901 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 975; 13 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 902 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 976; 14 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 903 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 977; 15 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 904 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 978; 16 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 905 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 979; 17 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 906 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 980; 18 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 907 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 981; 19 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 908 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 982; 20 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:909 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 983; 21 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 910 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 984; 22 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 911 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 985; 23 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 912 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 986; 24 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 913 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 987; 25 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 914 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 988; 26 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 915 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 989; 27 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 916 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 990; 28 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 917 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 991; 29 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:918 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 992; 30 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 919 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 993; 31 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:920 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 994; 32 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 921 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 995; 33 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 922 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 996; 34 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 923 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 997; 35 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 924 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 998; 36 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 925 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 999; 37 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 926 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1000; 38 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 927 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1001; 39 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 928 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1002; 40 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 929 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1003; 41 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 930 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1004; 42 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 931 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1005; 43 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 932 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1006; 44 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 933 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1007; 45 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 934 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1008; 46 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 935 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1009; 47 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 936 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1010; 48 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 937 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1011; 49 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 938 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1012; 50 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 939 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1013; 51 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 940 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1014; 52 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 941 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1015; 53 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 942 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1016; 54 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 943 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1017; 55 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 944 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1018; 56 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 945 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1019; 57 The heavy chain variable region comprises 2, CDR-H3 CDR-H1, CDR-H within SEQ ID NO:946 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 1020; 58 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 947 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1021; 59 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 948 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1022; 60 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 949 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 1023; 61 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 950 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1024; 62 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 951 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 1025; 63 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 952 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1026; 64 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 953 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1027; 65 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 954 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1028; 66 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 955 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 1029; 67 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:956 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 1030; 68 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:957 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 1031; 69 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:958 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 1032; 70 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO:959 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 1033; 71 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 960 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1034; 72 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO 961 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO 1035; 73 The heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 962 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1036; or 74) the heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO. 963 and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO. 1037.

In some embodiments of the anti-CD 70 binding domain: 1) The heavy chain variable region comprises SEQ ID NO 890 and the light chain variable region comprises SEQ ID NO 964; 2) The heavy chain variable region comprises SEQ ID NO 891 and the light chain variable region comprises SEQ ID NO 965; 3) The heavy chain variable region comprises SEQ ID NO 892 and the light chain variable region comprises SEQ ID NO 966; 4) The heavy chain variable region comprises SEQ ID NO 893 and the light chain variable region comprises SEQ ID NO 967; 5) The heavy chain variable region comprises SEQ ID NO 894 and the light chain variable region comprises SEQ ID NO 968; 6) The heavy chain variable region comprises SEQ ID NO 895 and the light chain variable region comprises SEQ ID NO 969; 7) The heavy chain variable region comprises SEQ ID NO 896 and the light chain variable region comprises SEQ ID NO 970; 8) The heavy chain variable region comprises SEQ ID NO 897 and the light chain variable region comprises SEQ ID NO 971; 9) The heavy chain variable region comprises SEQ ID NO 898 and the light chain variable region comprises SEQ ID NO 972;10 899 and the light chain variable region comprises SEQ ID NO 973;11 900 and the light chain variable region comprises 974;12 901 and the light chain variable region comprises SEQ ID No. 975;13 A) the heavy chain variable region comprises SEQ ID No. 902 and the light chain variable region comprises SEQ ID No. 976;14 903 and the light chain variable region comprises SEQ ID NO 977;15 904 and the light chain variable region comprises SEQ ID No. 978;16 The heavy chain variable region comprises SEQ ID NO. 905 and the light chain variable region comprises SEQ ID NO. 979;17 906 and the light chain variable region comprises SEQ ID No. 980;18 907 and the light chain variable region comprises SEQ ID No. 981;19 908 and the light chain variable region comprises SEQ ID NO. 982;20 -said heavy chain variable region comprises SEQ ID No. 909 and said light chain variable region comprises SEQ ID No. 983;21 The heavy chain variable region comprises SEQ ID NO. 910 and the light chain variable region comprises SEQ ID NO. 984;22 911 and 985;23 912 and the light chain variable region comprises SEQ ID NO. 986;24 A) the heavy chain variable region comprises SEQ ID NO. 913 and the light chain variable region comprises SEQ ID NO. 987;25 914 and the light chain variable region comprises SEQ ID NO. 988;26 915 and the light chain variable region comprises SEQ ID NO. 989;27 916 of said heavy chain variable region and said light chain variable region comprises SEQ ID No. 990;28 The heavy chain variable region comprises SEQ ID NO. 917 and the light chain variable region comprises SEQ ID NO. 991;29 918 and the light chain variable region comprises SEQ ID NO. 992;30 The heavy chain variable region comprises SEQ ID NO. 919 and the light chain variable region comprises SEQ ID NO. 993;31 920 and the light chain variable region comprises SEQ ID NO 994;32 921 and the light chain variable region comprises SEQ ID NO 995;33 922 and the light chain variable region comprises SEQ ID NO 996;34 923 and the light chain variable region comprises SEQ ID NO 997;35 924 and the light chain variable region comprises SEQ ID NO 998;36 The heavy chain variable region comprises SEQ ID NO. 925 and the light chain variable region comprises SEQ ID NO. 999;37 The heavy chain variable region comprises SEQ ID NO. 926 and the light chain variable region comprises SEQ ID NO. 1000;38 927 and the light chain variable region comprises SEQ ID NO 1001;39 928 and the light chain variable region comprises SEQ ID NO 1002;40 929 and the light chain variable region comprises SEQ ID NO 1003;41 The heavy chain variable region comprises SEQ ID NO. 930 and the light chain variable region comprises SEQ ID NO. 1004;42 931 and the light chain variable region comprises SEQ ID NO 1005;43 -said heavy chain variable region comprises SEQ ID No. 932 and said light chain variable region comprises SEQ ID No. 1006;44 The heavy chain variable region comprises SEQ ID NO. 933 and the light chain variable region comprises SEQ ID NO. 1007;45 934 and the light chain variable region comprises SEQ ID NO. 1008;46 A) the heavy chain variable region comprises SEQ ID NO. 935 and the light chain variable region comprises SEQ ID NO. 1009;47 936 and 1010;48 The heavy chain variable region comprises SEQ ID NO. 937 and the light chain variable region comprises SEQ ID NO. 1011;49 938 and the light chain variable region comprises SEQ ID NO 1012;50 The heavy chain variable region comprises SEQ ID NO. 939 and the light chain variable region comprises SEQ ID NO. 1013;51 940 and 1014;52 A) the heavy chain variable region comprises SEQ ID NO. 941 and the light chain variable region comprises SEQ ID NO. 1015;53 942 and the light chain variable region comprises SEQ ID No. 1016;54 943 and the light chain variable region comprises SEQ ID NO 1017;55 944 and 1018;56 945 and the light chain variable region comprises SEQ ID NO 1019;57 946 and the light chain variable region comprises SEQ ID No. 1020;58 947 and the light chain variable region comprises SEQ ID No. 1021;59 948 and the light chain variable region comprises SEQ ID NO 1022;60 949 and the light chain variable region comprises SEQ ID NO 1023;61 The heavy chain variable region comprises SEQ ID No. 950 and the light chain variable region comprises SEQ ID No. 1024;62 951 and the light chain variable region comprises SEQ ID NO 1025;63 The heavy chain variable region comprises SEQ ID NO. 952 and the light chain variable region comprises SEQ ID NO. 1026;64 953 and 1027;65 954 and the light chain variable region comprises SEQ ID NO 1028;66 The heavy chain variable region comprises SEQ ID NO:955 and the light chain variable region comprises SEQ ID NO:1029;67 956 and the light chain variable region comprises SEQ ID NO 1030;68 957 and the light chain variable region comprises SEQ ID NO 1031;69 958 and the light chain variable region comprises SEQ ID No. 1032;70 959 and 1033;71 960 and the light chain variable region comprises SEQ ID No. 1034;72 961 and the light chain variable region comprises SEQ ID NO 1035;73 962 and the light chain variable region comprises SEQ ID NO 1036; or 74) the heavy chain variable region comprises SEQ ID NO. 963 and the light chain variable region comprises SEQ ID NO. 1037.

In some embodiments of the anti-CD 70 binding domain, the heavy chain variable region and/or the light chain variable region comprises a framework. In some embodiments, the heavy chain variable region comprises FW-H1, FW-H2, FW-H3, and FW-H4. In some embodiments, the heavy chain variable region comprises FW-H1, CDR-H1, FW-H2, CDR-H2, FW-H3, CDR-H3 and FW-H4 in order from N-terminus to C-terminus. In some embodiments, the light chain variable region comprises FW-L1, FW-L2, FW-L3, and FW-L4. In some embodiments, the light chain variable region comprises FW-L1, CDR-L1, FW-L2, CDR-L2, FW-L3, CDR-L3, FW-L4 in order from N-terminus to C-terminus. In some embodiments, the FW-H1 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS 399-402; the FW-H2 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 403-406; the FW-H3 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 407-422; the FW-H4 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS 423-427; the FW-L1 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS: 650-653; the FW-L2 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOs 654-657; the FW-L3 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 658-661; the FW-L4 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOS 662-667.

In some embodiments of the anti-CD 70 binding domain, the heavy chain variable domain is encoded by a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOS 1038-1111.

In some embodiments of the anti-CD 70 binding domain, the light chain variable domain is encoded by a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOS 1112-1185.

In some embodiments, the anti-CD 70 binding domain is an antibody, fab 'fragment, F (ab') ₂ Fragments or scfvs.

In several embodiments, the anti-CD 70 binding domain is encoded by a polynucleotide sequence comprising a sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the sequence of one or more of SEQ ID NOs 38-120, 221-229, 1038-1111 and/or 1112-1185, or within a range defined by any two of the foregoing percentages. In several embodiments, the anti-CD 70 binding domain comprises an amino acid sequence having at least about 85%, about 90%, about 95% or more sequence identity to one or more of SEQ ID NOs 230-312, 890-963, 964-1037.

CARs are also disclosed herein. In some embodiments, the CAR is an anti-CD 70 CAR. In some embodiments, the CAR comprises any one or more of the anti-CD 70 binding domains disclosed herein.

In some embodiments, the CAR further comprises an OX40 subdomain and a cd3ζ subdomain. In several embodiments, the OX40 subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID NO. 5. In several embodiments, the OX40 subdomain comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 99%, or at least 100% sequence identity with SEQ ID NO. 6. In several embodiments, the CD3ζ subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID NO. 7. In several embodiments, the CD3ζ subdomain comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 99%, or at least 100% sequence identity with SEQ ID NO. 8. In several embodiments, the mbIL15 is encoded by a sequence having at least 95% sequence identity to SEQ ID No. 1188. In several embodiments, one or more of SEQ ID NOS 36-120, 221-229, 1038-1111 and/or 1112-1185, a polynucleotide encoding an OX40 subdomain, a polynucleotide encoding a CD3 zeta subdomain, a polynucleotide encoding mbiL15 are arranged in a 5 'to 3' direction within the polynucleotide.

In several embodiments, an anti-CD 70 CAR is provided and encoded by a polynucleotide that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the sequence of one or more of SEQ ID NOs 138-220, or a portion thereof (e.g., a portion that does not comprise an mbiL15 sequence and/or a self-cleaving peptide sequence), or within a range defined by any two of the foregoing percentages. In several embodiments, the CAR comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the sequence of one or more of SEQ ID NOs 313-395, or a portion thereof (e.g., a portion that does not comprise an mbIL15 sequence and/or a self-cleaving peptide sequence), or is identical within a range defined by any two of the foregoing percentages.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge-CD 8TM/4-1BB/CD3 zeta chimeric antigen receptor complexes are provided (see fig. 1, cart 1 a). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD8a transmembrane domain, a 4-1BB domain, and a cd3ζ domain, as described herein. In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge-CD 8TM/4-1BB/CD3ζ/2A/mIL-15 chimeric antigen receptor complexes are provided (see FIG. 1, CAR 1 b). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD8a transmembrane domain, a 4-1BB domain, a cd3ζ domain, a 2A cleavage site, and a mll-15 domain as described herein. In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In one embodiment, polynucleotides encoding tumor binding agent/CD 8 hinge-CD 8TM/OX40/CD3 ζ chimeric antigen receptor complexes are provided (see fig. 1, cr 1 c). The polynucleotides comprise or consist of a tumor binding agent, CD8a hinge, CD8a transmembrane domain, OX40 domain, and cd3ζ domain as described herein. In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge-CD 8TM/OX40/CD3 ζ/2A/ml-15 chimeric antigen receptor complexes are provided (see fig. 1, car 1 d). The polynucleotides comprise or consist of a tumor binding agent, CD8a hinge, CD8a transmembrane domain, OX40 domain, cd3ζ domain, 2A cleavage site, and a mll-15 domain as described herein. In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning. In several embodiments, the anti-CD 70 binding domain comprises a polynucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the sequence of SEQ ID NO:36 and/or SEQ ID NO:37, or is identical within a range defined by any two of the foregoing percentages. In several embodiments, the anti-CD 70 binding domain comprises a polynucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the sequence of any one of SEQ ID NOs 38-120, 221-229, 1038-1111 and/or 1112-1185, or is identical within a range defined by any two of the foregoing percentages. In several embodiments, an anti-CD 70 CAR is provided and encoded by a polynucleotide that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the sequence of one or more of SEQ ID NOs 138-220, or a portion thereof (e.g., a portion that does not comprise an mbiL15 sequence and/or a self-cleaving peptide sequence), or within a range defined by any two of the foregoing percentages. In several embodiments, the CAR comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the sequence of one or more of SEQ ID NOs 313-395, or a portion thereof (e.g., a portion that does not comprise an mbIL15 sequence and/or a self-cleaving peptide sequence), or is identical within a range defined by any two of the foregoing percentages.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge-CD 28TM/CD28/CD3 zeta chimeric antigen receptor complexes are provided (see fig. 1, cr 1 e). Polynucleotides as described herein comprise or consist of a tumor binding agent, a CD8a hinge, a CD28 transmembrane domain, a CD28 domain, and a cd3ζ domain. In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge-CD 28TM/CD28/CD3 zeta/2A/mIL-15 chimeric antigen receptor complexes are provided (see FIG. 1, CAR1 f). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD28 transmembrane domain, a CD28 domain, a CD3 zeta domain, a 2A cleavage site, and a mll-15 domain as described herein. In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge/CD 8aTM/ICOS/cd3ζ chimeric antigen receptor complexes are provided (see fig. 1, cr 1 g). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD8a transmembrane domain, an inducible co-stimulatory (ICOS) signaling domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 1, cr 1 h). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding the tumor binding agent/CD 8 hinge/CD 8aTM/CD28/4-1BB/CD3 zeta chimeric antigen receptor complex are provided (see fig. 1, cart 1 i). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD8a transmembrane domain, a CD28 signaling domain, a 4-1BB signaling domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 1, cr 1 j). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge/NKG 2DTM/OX40/CD3 zeta chimeric antigen receptor complexes are provided (see fig. 2, cart a). The polynucleotide comprises or consists of a tumor binding agent (e.g., a light chain variable region of an scFv), a CD8a hinge, a NKG2D transmembrane domain, an OX40 signaling domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 2, cart 2 b). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding the tumor binding agent/CD 8 hinge/CD 8aTM/OX40/CD3 ζ/2A/EGFRt chimeric antigen receptor complex are provided (see fig. 2, cr 2 e). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD8a transmembrane domain, an OX40 signaling domain, a CD3 zeta domain, a 2A cleavage site and a truncated form of an epidermal growth factor receptor (EGFRt). In several embodiments, the chimeric antigen receptor further comprises mbIL15 (see fig. 2, ca r2 f). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding the tumor binding agent/CD 8 hinge/NKG 2DTM/OX40/CD3 zeta chimeric antigen receptor complex are provided (see fig. 2, ca r2 g). The polynucleotide comprises or consists of a tumor binding agent (e.g., a heavy chain variable region of an scFv), a CD8a hinge, a NKG2D transmembrane domain, an OX40 signaling domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 2, ca 2 h). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/Ig 4SH-CD28TM/CD28/CD3 ζ chimeric antigen receptor complexes are provided (see fig. 2, cr 2 i). Polynucleotides as described herein comprise or consist of a tumor binding agent, an Ig4SH domain, a CD28 transmembrane domain, a CD28 domain, and a cd3ζ domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 2, ca 2 j). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge/CD 8aTM/CD27/CD3 zeta chimeric antigen receptor complexes are provided (see fig. 3, cart a). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD8a transmembrane domain, a CD27 signaling domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 3, ca r3 b). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge/CD 8aTM/CD70/CD3 zeta chimeric antigen receptor complexes are provided (see fig. 3, cr 3 c). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD8a transmembrane domain, a CD70 signaling domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 3, ca r3 d). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge/CD 8aTM/CD161/CD3 zeta chimeric antigen receptor complexes are provided (see fig. 3, cr 3 e). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD8a transmembrane domain, a CD161 signaling domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 3, ca r3 f). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge/CD 8aTM/CD40L/CD3 ζ chimeric antigen receptor complexes are provided (see fig. 3, ca r3 g). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD8a transmembrane domain, a CD40L signaling domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 3, cr 3 h). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge/CD 8aTM/CD44/CD3 ζ chimeric antigen receptor complexes are provided (see fig. 3, cr 3 i). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD8a transmembrane domain, a CD44 signaling domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 3, ca r3 j). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/Ig 4SH-CD8TM/4-1BB/CD3 zeta chimeric antigen receptor complexes are provided (see FIG. 4, CAR4 a). The polynucleotides comprise or consist of a tumor binding agent, an Ig4SH domain, a CD8a transmembrane domain, a 4-1BB domain, and a CD3 zeta domain as described herein. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 4, cr 4 b). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/Ig 4SH-CD8TM/OX40/CD3 ζ chimeric antigen receptor complexes are provided (see fig. 4, cr 4 c). The polynucleotide comprises or consists of a tumor binding agent, an Ig4SH domain, a CD8a transmembrane domain, an OX40 domain, and a cd3ζ domain as described herein. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 4, cart 4 d). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge-CD 3 alpha TM/CD28/CD3 zeta chimeric antigen receptor complexes are provided (see fig. 4, cr 4 e). Polynucleotides as described herein comprise or consist of a tumor binding agent, a CD8a hinge, a CD3 a transmembrane domain, a CD28 domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 4, cart 4 f). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8 hinge-CD 28TM/CD28/4-1BB/CD3 zeta chimeric antigen receptor complexes are provided (see fig. 4, car4 g). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD28 transmembrane domain, a CD28 domain, a 4-1BB domain, and a cd3ζ domain as described herein. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 4, cr 4 h). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8a hinge/CD 8a TM/4-1BB/CD3 ζ chimeric antigen receptor complexes are provided (see fig. 5, ca 5 a). Polynucleotides as described herein comprise or consist of a tumor binding agent, a CD8a hinge, a CD8a transmembrane domain, a 4-1BB domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 5, cart 5 b). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding tumor binding agent/CD 8a hinge/CD 3TM/4-1BB/CD3 ζ chimeric antigen receptor complexes are provided (see fig. 5, ca r5 c). Polynucleotides as described herein comprise or consist of a tumor binding agent, a CD8a hinge, a CD3 transmembrane domain, a 4-1BB domain, and a CD3 ζ domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 5, cart 5 d). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding the tumor binding agent/CD 8a hinge/CD 3TM/4-1BB/NKp80 chimeric antigen receptor complex are provided (see fig. 5, cart). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD3 transmembrane domain, a 4-1BB domain, and a NKp80 domain as described herein. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 5, cart 5 f). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding the tumor binding agent/CD 8 alpha hinge/CD 3 TM/CD16 intracellular domain/4-1 BB chimeric antigen receptor complex are provided (see FIG. 5, CAR5 g). The polynucleotides comprise or consist of a tumor binding agent, a CD8a hinge, a CD3 transmembrane domain, a CD16 intracellular domain, and a 4-1BB domain as described herein. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 5, cart 5 h). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding the tumor binding agent/NKG 2D extracellular domain/CD 8 hinge-CD 8TM/OX40/CD3 zeta chimeric antigen receptor complex are provided (see fig. 5, bispecific CAR/ACRa). As described herein, the polynucleotide comprises or consists of a tumor binding agent, a NKG2D extracellular domain (full length or fragment), a CD8a hinge, a CD8a transmembrane domain, an OX40 domain, and a CD3 zeta domain. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 5, bispecific CAR/ACRb). In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising a sequence obtained from a combination of the sequences disclosed herein, or the receptor complex comprises an amino acid sequence obtained from a combination of the sequences disclosed herein. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises sequences according to one or more SEQ ID NOs as described herein, such as those included herein as examples of components. In several embodiments, the coding nucleic acid sequence or the amino acid sequence comprises a sequence sharing at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to a sequence resulting from the combination of one or more SEQ ID NOs as described herein. It will be appreciated that when sequences are combined (e.g., for creating restriction sites), certain sequence variability, extension and/or truncation of the disclosed sequences may result due to, for example, convenience or efficiency of cloning.

In several embodiments, polynucleotides encoding anti-CD 70 binding domain/CD 8a hinge/CD 8a transmembrane domain/OX 40/cd3ζ chimeric antigen receptor complexes are provided (see fig. 6, CD70 CARa). The polynucleotides comprise or consist of an anti-CD 70 binding domain, a CD8a hinge, a CD8a transmembrane domain, an OX40 domain, and a cd3ζ domain as described herein. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 6, cd70 arb). In several embodiments, the anti-CD 70 binding domain comprises an scFv. In several embodiments, the anti-CD 70 scFv is encoded by a nucleic acid molecule having a sequence according to any one of SEQ ID NOS: 38-111. In several embodiments, the anti-CD 70 scFv is encoded by a nucleic acid sequence sharing at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and/or functional equivalence with any of SEQ ID NOs 38-111. In several embodiments, the scFv comprises an amino acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and/or functional equivalence to any of SEQ ID NOS.230-303. In several embodiments, an anti-CD 70CAR is encoded by a nucleic acid sequence sharing at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and/or functional equivalence to any one of SEQ ID NOs 138-211 or a portion thereof (e.g., a portion that does not comprise an mbiL15 sequence and/or a self-cleaving peptide sequence). In several embodiments, the anti-CD 70CAR comprises an amino acid sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and/or functional equivalence to any one of SEQ ID NOs 313-395 or a portion thereof (e.g., a portion that does not comprise an mbIL15 sequence and/or a self-cleaving peptide sequence).

In some embodiments of the CARs disclosed herein, the CAR comprises at least two anti-CD 70 binding domains, and the CAR is a multivalent CAR. In some embodiments, the multivalent CAR comprises two anti-CD 70 binding domains, and the CAR is a bivalent CAR.

In some embodiments, the bivalent CAR comprises a first anti-CD 70 binding domain and a second anti-CD 70 binding domain. In some embodiments, the first anti-CD 70 binding domain and the second anti-CD 70 binding domain are any of the anti-CD 70 binding domains disclosed herein. In some embodiments, the first anti-CD 70 binding domain and the second anti-CD 70 binding domain each comprise a heavy chain variable region and a light chain variable region as disclosed herein. In some embodiments, the first anti-CD 70 binding domain and the second anti-CD 70 binding domain each comprise: a) A heavy chain variable region comprising the sequence of SEQ ID NO. 923 and a light chain variable region comprising the sequence of SEQ ID NO. 997; b) A heavy chain variable region comprising the sequence of SEQ ID NO. 949 and a light chain variable region comprising the sequence of SEQ ID NO. 1023; c) A heavy chain variable region comprising the sequence of SEQ ID NO. 950 and a light chain variable region comprising the sequence of SEQ ID NO. 1024; d) A heavy chain variable region comprising the sequence of SEQ ID NO. 952 and a light chain variable region comprising the sequence of SEQ ID NO. 1026; or e) a heavy chain variable region comprising the sequence of SEQ ID NO. 953 and a light chain variable region comprising the sequence of SEQ ID NO. 1027.

In several embodiments, polynucleotides encoding dual-specific anti-CD 70 binding domain/CD 8a hinge/CD 8a transmembrane domain/OX 40/CD3 zeta chimeric antigen receptor complexes are provided (see fig. 6, bivalent CD70 CARa). The polynucleotide comprises or consists of a first and a second anti-CD 70 binding domain, a CD8a hinge, a CD8a transmembrane domain, an OX40 domain, and a cd3ζ domain as described herein. In several embodiments, the polynucleotide further encodes mbIL15 (see fig. 6, bivalent CD70 arb). In several embodiments, the first anti-CD 70 binding domain and/or the second anti-CD 70 binding domain comprises an scFv. In several embodiments, the first anti-CD 70 scFv and the second anti-CD 70 scFv are the same, while in some embodiments, the first anti-CD 70 scFv and the second anti-CD 70 scFv are different sequences. In several embodiments, the bispecific anti-CD 70 scFv is encoded by a nucleic acid molecule having a sequence according to any one of SEQ ID NOS 112-120 and/or 221-229. In several embodiments, the anti-CD 70 scFv is encoded by a nucleic acid sequence sharing at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and/or functional equivalence with any of SEQ ID NOS 112-120 and/or 221-229. In several embodiments, the bispecific scFv comprises an amino acid having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity, homology and/or functional equivalence to any of SEQ ID NOs 304-312,890-963 and/or 964-1037. In several embodiments, the bispecific anti-CD 70CAR is encoded by a nucleic acid sequence sharing at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and/or functional equivalence with any of SEQ ID NOS: 212-220 or codon optimized SEQ ID NOS: 212-229. In several embodiments, the bispecific CAR comprises an amino acid sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and/or functional equivalence to any one of SEQ ID NOs 387-395, or a portion thereof (e.g., a portion that does not comprise an mbIL15 sequence and/or a self-cleaving peptide sequence).

In several embodiments, polynucleotides encoding anti-CD 70 scFv/CD8a hinge/CD 8a transmembrane domain/OX 40/CD3 zeta chimeric antigen receptor complexes are provided (see fig. 6, nk71). The polynucleotide comprises or consists of an anti-CD 70 scFv, a CD8a hinge, a CD8a transmembrane domain, an OX40 domain, and a cd3ζ domain encoded by a nucleic acid sequence sharing at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and/or functional equivalence to SEQ ID No. 36 as described herein. In several embodiments, the polynucleotide further encodes mbIL15. In several embodiments, polynucleotides encoding anti-CD 70 scFv/CD8a hinge/CD 8a transmembrane domain/OX 40/CD3 zeta chimeric antigen receptor complexes are provided (see fig. 6, nk72). The polynucleotide comprises or consists of an anti-CD 70 scFv, a CD8a hinge, a CD8a transmembrane domain, an OX40 domain, and a cd3ζ domain encoded by a nucleic acid sequence sharing at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and/or functional equivalence with SEQ ID No. 37 as described herein. In several embodiments, the polynucleotide further encodes mbIL15. However, in several embodiments, the anti-CD 70 CARs disclosed herein do not comprise scFv of SEQ ID NO:36 or 37.

In several embodiments, polynucleotides encoding CD19/CD8a hinge/CD 8a transmembrane domain/OX 40/CD3 zeta-activated chimeric receptor complexes are provided (see fig. 7, CD19 CARa). The polynucleotides comprise or consist of an anti-CD 19 scFv, a CD8a hinge, a CD8a transmembrane domain, an OX40 domain, and a cd3ζ domain as described herein. In addition, in several embodiments, the polynucleotide encoding the CAR construct may optionally further encode mbIL15 (fig. 7, cd19 arb). In several embodiments, the receptor complex (including mbIL 15) is encoded by a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID No. 34. In another embodiment, the chimeric receptor is encoded by the amino acid sequence of SEQ ID NO. 35. In some embodiments, the sequence of the chimeric receptor may be different from SEQ ID NO 34 or 35, but, depending on the embodiment, remains at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to SEQ ID NO 34 or 35. In several embodiments, the chimeric receptor retains NK cell activation and/or cytotoxicity functions or in some embodiments has enhanced NK cell activation and/or cytotoxicity functions, although the chimeric receptor may be different from SEQ ID NO:34 or 35. Additional information regarding chimeric receptors for use in the disclosed methods and compositions can be found in PCT patent application PCT/US2020/020824, filed 3/2020, which is incorporated herein by reference in its entirety.

In several embodiments, polynucleotides encoding NKG2D/CD8a hinge/CD 8a transmembrane domain/OX 40/CD3 zeta-activated chimeric receptor complexes are provided (see fig. 7, NKG2D ACRa). The polynucleotide comprises, consists of, a fragment of a NKG2D receptor capable of binding to a ligand of the NKG2D receptor, a CD8a hinge, a CD8a transmembrane domain, an OX40 domain and a CD3 zeta domain as described herein. In several embodiments, the receptor complex is encoded by a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO. 32. In another embodiment, the chimeric receptor is encoded by the amino acid sequence of SEQ ID NO. 33. In some embodiments, the chimeric receptor may have a sequence that is different from SEQ ID NO. 32 or 33, but, depending on the embodiment, remains at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to SEQ ID NO. 32 or 33. In several embodiments, the chimeric receptor retains NK cell activation and/or cytotoxicity functions or in some embodiments has enhanced NK cell activation and/or cytotoxicity functions, although the chimeric receptor may be different from SEQ ID NO. 32 or 33. In addition, in several embodiments, the construct may optionally be co-expressed with mbIL15 (e.g., mbIL15 encoded by SEQ ID NO: 1188) (fig. 7, nkg2d ACRb). Additional information regarding chimeric receptors for use in the methods and compositions of the present disclosure can be found in PCT patent publication No. WO 2018/183385, filed on day 27, 3, 2018, which is incorporated herein by reference in its entirety.

In several embodiments, genetically engineered natural killer cell populations for cancer immunotherapy are provided. In some embodiments, the population comprises a plurality of NK cells that have been expanded in culture. In some embodiments, at least a portion of the plurality of NK cells is engineered to express a chimeric antigen receptor comprising a tumor binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the tumor binding domain targets CD70 and is encoded by a polynucleotide comprising a sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO. 36 or 37. In some embodiments, the tumor binding domain targets CD70 and comprises an amino acid sequence having at least 85%, at least 90%, or at least 95% or more sequence identity to SEQ ID NO 1186 or 1187. In some embodiments, the NK cells are genetically edited to express reduced levels of CD70 as compared to unedited NK cells that have been expanded in culture. In some embodiments, the reduced CD70 expression is engineered by editing an endogenous CD70 gene. In some embodiments, the NK cells are further genetically edited to express reduced levels of CIS proteins encoded by CISH genes as compared to non-engineered NK cells. In some embodiments, the reduced CIS expression is engineered by editing of the CISH gene. In some embodiments, the genetically engineered NK cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target cells, and enhanced persistence compared to NK cells expressing native levels of CIS. In some embodiments, the NK cells are further genetically edited to express reduced levels of adenosine receptors. In some embodiments, the reduced expression of the adenosine receptor is achieved by editing a gene encoding the adenosine receptor. In some embodiments, the genetically engineered NK cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target cells, and enhanced persistence as compared to NK cells expressing native levels of adenosine receptors.

Also disclosed herein are cells comprising any one of the anti-CD 70 binding domains disclosed herein and/or any one of the CARs disclosed herein. In some embodiments, the cell is an immune cell. In some embodiments, the cell is an NK cell or a T cell. In some embodiments, the cells are genetically edited to express reduced levels of CISH, adenosine receptor, A2A adenosine receptor, A2B adenosine receptor, A3 adenosine receptor, A1 adenosine receptor, A2AR, TGFBR, B2M, CIITA, NKG2A, CBLB, TRIM29, SOCS2, SMAD3, MAPKAPK3, CEACAM1, or DDIT4, or any combination thereof, as compared to non-engineered cells. In some embodiments, the cells are genetically edited with one or more guide RNAs having at least 95% sequence identity to SEQ ID NOS 1190-1201. Unless otherwise indicated to the contrary, the use of deoxyribonucleotide recitations to provide a sequence for guiding an RNA refers to a target DNA and should also be considered as referring to those teachings used in practice (e.g., use of ribonucleotides, wherein the ribonucleotide uracil is used instead of the deoxyribonucleotide thymine, and vice versa, wherein thymine is used instead of uracil, wherein both are complementary base pairs of adenine when listing RNA or DNA sequences). For example, a gRNA having the sequence TCACCAAGCCCGCGACCAATGGG (SEQ ID NO: 121) shall also refer to the following sequence: UCACCAAGCCCGCGACCAAUGGG (SEQ ID NO: 1214), or a gRNA sequence having the sequence UCACCAAGCCCGCGACCAAUGGG (SEQ ID NO: 1214) shall also refer to the following sequences: TCACCAAGCCCGCGACCAATGGG (SEQ ID NO: 121).

Therapeutic method

Some embodiments relate to methods of treating, ameliorating, inhibiting, or preventing cancer with cells or immune cells comprising and/or activating a chimeric antigen receptor as disclosed herein. In some embodiments, the method comprises treating or preventing cancer. In some embodiments, the method comprises administering a therapeutically effective amount of immune cells expressing a tumor-directed chimeric antigen receptor and/or a tumor-directed chimeric receptor as described herein. Examples of the types of cancers that can be so treated are described herein.

Methods of treating cancer in a subject are disclosed. In some embodiments, the method comprises administering to the subject any one of the anti-CD 70 binding domains disclosed herein, any one of the CARs disclosed herein, or any one of the cells disclosed herein, or any combination thereof.

In certain embodiments, treating a subject with one or more genetically engineered cells described herein achieves one, two, three, four or more of the following effects, including, for example: (i) Reducing or ameliorating the severity of a disease or condition associated therewith; (ii) decreasing the duration of symptoms associated with the disease; (iii) preventing progression of the disease or symptoms associated therewith; (iv) regression of the disease or symptoms associated therewith; (v) preventing the development or onset of symptoms associated with the disease; (vi) preventing recurrence of symptoms associated with the disease; (vii) reducing hospitalization of the subject; (viii) reducing the length of hospitalization time; (ix) increasing survival of a subject suffering from a disease; (x) reducing the number of symptoms associated with the disease; (xi) Enhancing, ameliorating, supplementing or potentiating the prophylactic or therapeutic effect of another therapy. Advantageously, the non-alloreactive engineered T cells disclosed herein further enhance one or more of the above. Administration may be by a variety of routes including, but not limited to, intravenous, intra-arterial, subcutaneous, intramuscular, intrahepatic, intraperitoneal, and/or topical delivery to the affected tissue.

Also disclosed herein is the use of any one of the anti-CD 70 binding domains disclosed herein, any one of the CARs disclosed herein, any one of the cells disclosed herein, or any combination thereof for treating cancer.

Also disclosed herein is the use of any one of the anti-CD 70 binding domains disclosed herein, any one of the CARs disclosed herein, any one of the cells disclosed herein, or any combination thereof, in the manufacture of a medicament for treating cancer.

Administration and administration

Also provided herein are methods of treating a subject having cancer comprising administering to the subject a composition comprising immune cells (e.g., NK and/or T cells) engineered to express a cytotoxic receptor complex as disclosed herein. For example, some embodiments of the compositions and methods described herein relate to the use of tumor-directed chimeric antigen receptors and/or tumor-directed chimeric receptors for treating a cancer patient, or the use of cells expressing tumor-directed chimeric antigen receptors and/or tumor-directed chimeric receptors for treating a cancer patient. Also provided is the use of such engineered immune cells for the treatment of cancer.

In certain embodiments, treating a subject with one or more genetically engineered cells described herein achieves one, two, three, four or more of the following effects, including, for example: (i) Reducing or ameliorating the severity of a disease or condition associated therewith; (ii) decreasing the duration of symptoms associated with the disease; (iii) preventing progression of the disease or symptoms associated therewith; (iv) regression of the disease or symptoms associated therewith; (v) preventing the development or onset of symptoms associated with the disease; (vi) preventing recurrence of symptoms associated with the disease; (vii) reducing hospitalization of the subject; (viii) reducing the length of hospitalization time; (ix) increasing survival of a subject suffering from a disease; (x) reducing the number of symptoms associated with the disease; (xi) Enhancing, ameliorating, supplementing or potentiating the prophylactic or therapeutic effect of another therapy. Each of these comparisons is relative to, for example, a different therapy for a disease, including cell-based immunotherapy for a disease using cells that do not express the constructs disclosed herein. Advantageously, the non-alloreactive engineered T cells disclosed herein further enhance one or more of the above.

Administration may be by a variety of routes including, but not limited to, intravenous, intra-arterial, subcutaneous, intramuscular, intrahepatic, intraperitoneal, and/or topical delivery to the affected tissue. For a given subject, the dosage of immune cells (e.g., NK and/or T cells) can be readily determined based on their body weight, disease type and status, and the desired therapeutic aggressiveness, but depending on the embodiment, ranges from about 10 ⁵ Individual cells/kg to about 10 ¹² Individual cells/kg (e.g., 10 ⁵ -10 ⁷ 、10 ⁷ -10 ¹⁰ 、10 ¹⁰ -10 ¹² Individual cells/kg and overlapping ranges therein). In one embodiment, a dose escalation regimen is used. In several embodiments, a range of immune cells (e.g., NK and/or T cells) are administered, e.g., about 1X10 ⁶ Individual cells/kg to about 1x10 ⁸ Individual cells/kg. Depending on the embodiment, various types of cancers may be treated. In several embodiments, hepatocellular carcinoma is treated. Other embodiments provided herein include the treatment or prevention of the following non-limiting examples of cancers, including but not limited to Acute Lymphoblastic Leukemia (ALL), acute Myelogenous Leukemia (AML), adrenocortical carcinoma, kaposi's sarcoma, lymphoma, gastrointestinal cancer, appendicular cancer, central nervous system cancer, basal cell carcinoma, cholangiocarcinoma, bladder cancer, bone cancer, brain tumor (including but not limited to astrocytoma, spinal cord tumor, brain stem glioma, glioblastoma, craniopharyngeoma, ependymoma, medulloblastoma), breast cancer, bronchogenic tumor, burkitt's lymphoma, cervical cancer, colon cancer, chronic Lymphocytic Leukemia (CLL), chronic Myelogenous Leukemia (CML), chronic myeloproliferative disorders, ductal carcinoma, endometrial cancer, esophageal cancer, gastric cancer, hodgkin's lymphoma, non-hodgkin's lymphoma, hairy cell leukemia, renal cell carcinoma, leukemia, oral cancer, nasopharyngeal carcinoma, liver cancer, lung cancer (including but not limited to non-small cell lung cancer (NSCLC) and small cell lung cancer), pancreatic cancer, intestinal cancer, lymphoma, melanoma, ocular cancer, chronic lymphomas, chronic lymphocytic leukemia, ovarian cancer, uterine cancer, and prostate cancer.

In some embodiments, provided herein are also nucleic acid and amino acid sequences that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% (and ranges therein) sequence identity and/or homology as compared to the corresponding nucleic acid or amino acid sequences of SEQ ID nos. 1-398 (or combinations of two or more of SEQ ID nos. 1-398), and that exhibit one or more functions as compared to the corresponding SEQ ID nos. 1-398 (or combinations of two or more of SEQ ID nos. 1-398), including but not limited to (i) enhanced proliferation, (ii) enhanced activation, (iii) enhanced cytotoxic activity against cells that exhibit ligands bound by NK cells containing the receptor encoded by the nucleic acid and amino acid sequences, (iv) enhanced homing to tumors or infection sites, (v) reduced off-target cytotoxicity, (vi) enhanced immune stimulatory cytokines and chemokines (including but not limited to IFNg, TNFa, IL-22, CCL3, CCL4 and CCL 5), enhanced secretory and further immune responses, and combinations thereof.

In addition, in several embodiments, amino acid sequences corresponding to any of the nucleic acids disclosed herein are provided, while accounting for the degeneracy of the nucleic acid code. Moreover, it is contemplated that sequences (whether nucleic acids or amino acids) other than those explicitly disclosed herein, but which have functional similarity or equivalence, are also within the scope of the present disclosure. The foregoing includes mutants, truncations, substitutions, or other types of modifications.

In several embodiments, the polynucleotide encoding the disclosed cytotoxic receptor complex is an mRNA. In some embodiments, the polynucleotide is DNA. In some embodiments, the polynucleotide is operably linked to at least one regulatory element for expressing the cytotoxic receptor complex.

According to several embodiments, there is additionally provided a vector comprising a polynucleotide encoding any of the polynucleotides provided herein, wherein the polynucleotide is optionally operably linked to at least one regulatory element for expressing a cytotoxic receptor complex. In several embodiments, the vector is a retrovirus.

Further provided herein are engineered immune cells (e.g., NK and/or T cells) comprising a polynucleotide, vector, or cytotoxic receptor complex as disclosed herein. Further provided herein are compositions comprising a mixture of engineered immune cells (e.g., NK cells and/or engineered T cells), each population comprising a polynucleotide, vector, or cytotoxic receptor complex as disclosed herein. In addition, provided herein are compositions comprising a mixture of engineered immune cells (e.g., NK cells and/or engineered T cells), each population comprising a polynucleotide, vector, or cytotoxic receptor complex as disclosed herein, and T cell populations have been genetically modified to reduce/eliminate gvHD and/or HvD. In some embodiments, the NK cells and the T cells are from the same donor. In some embodiments, the NK cells and the T cells are from different donors. In several embodiments, one or more genes are edited (e.g., knocked out or knockin) to impart one or more enhanced functions or features to the edited cells. For example, in several embodiments, CIS proteins are significantly reduced by editing CISH, which results in enhanced NK cell proliferation, cytotoxicity, and/or persistence.

For a given subject, the dosage of immune cells (e.g., NK cells or T cells) can be readily determined based on their weight, disease type and status, and the desired therapeutic aggressiveness, but depending on the embodiment, ranges from about 10 ⁵ Individual cells/kg to about 10 ¹² Individual cells/kg (e.g., 10 ⁵ -10 ⁷ 、10 ⁷ -10 ¹⁰ 、10 ¹⁰ -10 ¹² Individual cells/kg and overlapping ranges therein). In one embodiment, a dose escalation regimen is used. In several embodiments, a range of NK cells, e.g. about 1x10, are administered ⁶ Individual cells/kg to about 1x10 ⁸ Individual cells/kg. Depending on the embodiment, various types of cancers or infectious diseases may be treated.

Type of cancer

Some embodiments of the compositions and methods described herein relate to administering immune cells comprising a tumor-directed chimeric antigen receptor and/or a tumor-directed chimeric receptor to a subject having cancer. Various embodiments provided herein include the following non-limiting examples of cancers. Examples of cancers include, but are not limited to, acute Lymphoblastic Leukemia (ALL), acute Myelogenous Leukemia (AML), adrenocortical carcinoma, kaposi's sarcoma, lymphoma, gastrointestinal cancer, appendicular cancer, central nervous system cancer, basal cell carcinoma, cholangiocarcinoma, bladder cancer, bone cancer, brain tumor (including but not limited to astrocytoma, spinal cord tumor, brain stem glioma, craniopharyngeoma, ependymoblastoma, medulloblastoma), breast cancer, bronchogenic tumor, burkitt's lymphoma, cervical cancer, colon cancer, chronic Lymphocytic Leukemia (CLL), chronic Myelogenous Leukemia (CML), chronic myeloproliferative disorders, ductal carcinoma, endometrial carcinoma, esophageal carcinoma, gastric carcinoma, hodgkin's lymphoma, non-hodgkin's lymphoma, hairy cell leukemia, renal cell carcinoma, leukemia, oral cancer, nasopharyngeal carcinoma, liver cancer (including but not limited to non-small cell lung carcinoma (NSCLC) and small cell lung carcinoma), pancreatic cancer, intestinal cancer, lymphoma, melanoma, ocular carcinoma, chronic lymphocytic leukemia, ovarian cancer, and uterine cancer.

Cancer targets

Some embodiments of the compositions and methods described herein relate to immune cells comprising chimeric receptors that target cancer antigens. Non-limiting examples of target antigens include: CD70, CD5, CD19; CD123; CD22; CD30; CD171; CS1 (also known as CD2 subset 1, CRACC, SLAMF7, CD319, and 19a 24); TNF receptor family member B Cell Maturation Antigen (BCMA); CD38; DLL3; g protein coupled receptor class C group 5 member D (GPRC 5D); epidermal Growth Factor Receptor (EGFR) CD138; prostate Specific Membrane Antigen (PSMA); fms-like tyrosine kinase 3 (FLT 3); KREMEN2 (Kringle-containing transmembrane protein 2), ALPPL2, claudin 4, claudin 6, C-type lectin-like molecule 1 (CLL-1 or CLECL 1); CD33; epidermal growth factor receptor variant III (EGFRviii); ganglioside G2 (GD 2); ganglioside GD3 (aNeu 5Ac (2-8) aNeu5Ac (2-3) bDGalp (l-4) bDGlcp (l-l) Cer); ) The method comprises the steps of carrying out a first treatment on the surface of the Tn antigen ((Tn Ag) or (GalNAca-Ser/Thr)); prostate Specific Membrane Antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR 1); fms-like tyrosine kinase 3 (FLT 3); tumor-associated glycoprotein 72 (TAG 72); CD38; CD44v6; glycosylated CD43 epitope expressed on acute leukemia or lymphoma but not on hematopoietic progenitor cells, glycosylated CD43 epitope expressed on non-hematopoietic cancers, carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD 276); KIT (CD 117); interleukin-13 receptor subunit α -2 (IL-13 Ra2 or CD213A 2); mesothelin; interleukin 11 receptor alpha (IL-llRa); prostate Stem Cell Antigen (PSCA); protease serine 21 (testosterone) or PRSS 21); vascular endothelial growth factor receptor 2 (VEGFR 2); lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR-beta); stage specific embryonic antigen 4 (SSEA-4); CD20; folate receptor alpha (FRa or FR 1); folate receptor beta (FRb); receptor tyrosine protein kinase ERBB2 (Her 2/neu); mucin 1, cell surface associated protein (MUC 1); epidermal Growth Factor Receptor (EGFR); neural Cell Adhesion Molecules (NCAM); a prosase; prostatectomy phosphatase (PAP); mutated elongation factor 2 (ELF 2M); liver accessory protein B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic Anhydrase IX (CAIX); proteasome (precursor, megalin factor) subunit beta type 9 (LMP 2); glycoprotein 100 (gp 100); an oncogene fusion protein (BCR-Abl) consisting of a Breakpoint Cluster Region (BCR) and an Abelson murine leukemia virus oncogene homolog 1 (Abl); tyrosinase; ephrin-type a receptor 2 (EphA 2); sialic acid lewis adhesion molecules (sLe); ganglioside GM3 (aNeu 5Ac (2-3) bDClalp (l-4) bDGlcp (l-l) Cer); transglutaminase 5 (TGS 5); high Molecular Weight Melanoma Associated Antigen (HMWMAA); o-acetyl-GD 2 ganglioside (OAcGD 2); tumor endothelial marker 1 (TEM 1/CD 248); tumor endothelial marker 7-associated protein (TEM 7R); claudin 6 (CLDN 6); thyroid Stimulating Hormone Receptor (TSHR); g protein coupled receptor class C group 5 member D (GPRC 5D); chromosome X open reading frame 61 (CXORF 61); CD97; CD179a; anaplastic Lymphoma Kinase (ALK); polysialic acid; placenta-specific protein 1 (PLAC 1); a hexose moiety (GloboH) of globoH glycoceramide; breast differentiation antigen (NY-BR-1); urolysin 2 (UPK 2); hepatitis a virus cell receptor 1 (HAVCR 1); adrenoreceptor beta 3 (ADRB 3); ubiquitin 3 (PANX 3); g protein-coupled receptor 20 (GPR 20); lymphocyte antigen 6 complex, locus K9 (LY 6K); olfactory receptor 51E2 (OR 51E 2); tcrγ alternate reading frame protein (TARP); a wilms tumor protein (WT 1); cancer/testis antigen 1 (NY-ES 0-1); cancer/testis antigen 2 (age-la); melanomA-Associated antigen 1 (MAGE-A1); ETS translocation variation gene 6 (ETV 6-AML) located on chromosome 12 p; sperm protein 17 (SPA 17); x antigen family member 1A (XAGE 1); angiogenin binds to cell surface receptor 2 (Tie 2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); fos-associated antigen 1; tumor protein p53 (p 53); a p53 mutant; prostein; survivin; telomerase; prostate cancer tumor antigen-1 (PCT a-l or galectin 8), melanoma antigen 1 recognized by T cells (MelanA or MARTI); rat sarcoma (Ras) mutant; human telomerase; reverse transcriptase (hTERT); sarcoma translocation breakpoint; inhibitors of melanoma apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS 2) ETS fusion gene); n-acetylglucosamine-transferase V (NA 17); pairing box protein Pax-3 (Pax 3); androgen receptor; cyclin Bl; v-myc avian myeloproliferative virus oncogene neuroblastoma derived homolog (MYCN); ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 IB 1 (CYPIB 1); CCCTC binding factor (zinc finger protein) like (BORIS or Brother of the Regulator of lmprinted Sites), squamous cell carcinoma antigen 3 (SART 3) recognized by T cells; pairing box protein Pax-5 (Pax 5); the top voxel binding protein sp32 (OY-TES 1); lymphocyte-specific protein tyrosine kinase (LCK); kinase ankyrin 4 (AKAP-4); synovial sarcoma, X breakpoint 2 (SSX 2); receptor for advanced glycation end products (RAGE-1); renin 1 (RU 1); renin 2 (RU 2); legumain; human papillomavirus E6 (HPV E6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; mutant heat shock protein 70-2 (mut hsp 70-2); CD79a; CD79b; CD72; leukocyte associated immunoglobulin-like receptor 1 (LAIR 1); an Fc fragment of IgA receptor (FCAR or CD 89); white blood cell immunoglobulin-like receptor subfamily a member 2 (LILRA 2); CD300 molecular-like family member f (CD 300 LF); c lectin domain family 12 member a (CLEC 12A); bone marrow stromal cell antigen 2 (BST 2); mucin-like hormone receptor-like protein 2 (EMR 2) containing EGF-like modules; lymphocyte antigen 75 (LY 75); phosphatidylinositol glycan-3 (GPC 3); fc receptor-like protein 5 (FCRL 5); immunoglobulin lambda-like polypeptide 1 (IGLLl), MPL, biotin, c-MYC epitope tag, CD34, LAMP1 TROP2, gfrα4, CDH17, CDH6, NYBR1, CDH19, CD200R, slea (CA 19.9; sialyl lewis antigen); fucosyl-GMl, PTK7, gpNMB, CDH1-CD324, DLL3, CD276/B7H3, ILl lRa, IL13Ra2, CD179B-IGLl, TCRgamma-delta, NKG2D, CD (FCGR 2A), tnag, timl-/HVCR1, CSF2RA (GM-CSFR-alpha), TGFbeta R2, lews Ag, TCR-beta 1 chain, TCR-beta 2 chain, TCR-gamma chain, TCR-delta chain, FITC, luteinizing Hormone Receptor (LHR), follicle Stimulating Hormone Receptor (FSHR), gonadotropin receptor (CGHR or GR), CCR4, GD3, SLAMF6, SLAMF4, HIV1 envelope glycoprotein, HTLVl-Tax, CMV pp65, EBV-EBNA3C, HV 8.1, KSHV-gH influenza A Hemagglutinin (HA), GAD, PDL1, guanylate Cyclase C (GCC), anti-desmin autoantibody 3 (Dsg 3), anti-desmin autoantibody 1 (Dsgl), HLA, HLa-A2, HLA-B, HLA-C, HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, HLA-DR, HLA-G, igE, CD99, RAs G12V, tissue factor 1 (TF 1), AFP, GPRC5D, claudin l 8.2 (CLD 18A2 or CLDN18A.2)), P-glycoprotein, STEAP1, livl, connexin-4, cripto, gpA33, BST1/CD157, low conductance chloride channels, antigens recognized by TNT antibodies.

Examples

The following is a non-limiting description of experimental methods and materials used in the examples disclosed below.

Example 1-CD 70 Gene editing for reducing expression of NK cells

As discussed in more detail herein, certain cancer types express selected markers in an elevated manner. In several embodiments, the CAR constructs are generated according to the sequences disclosed herein to specifically target a given cancer. One such non-limiting embodiment of a cancer marker targeted by the constructs disclosed herein is CD70. While various types of cancers can be treated using the cells and methods disclosed herein, in several embodiments, renal Cell Carcinoma (RCC) is treated. RCC accounts for 90% -95% of tumors in the kidney and is one of the most common renal cancers in adults. Although 5-year survival is 75%, this is largely dependent on the type of cancer, the cell type, and the stage of the cancer at the time of first diagnosis. RCC was only in the kidneys for about 2/3 of the patients (these patients had a 5 year survival rate of 93%). However, if the renal cancer has spread to surrounding tissues or organs and/or regional lymph nodes, 5-year survival drops to 69%. In addition, if cancer has spread to distant sites of the body, 5-year survival rates suddenly drop to only 12%. There is a need for therapeutic agents for the treatment of RCC and other CD70 expressing tumors. Thus, as discussed in detail above, in several embodiments, an anti-CD 70 CAR construct is provided. In several embodiments, polynucleotides encoding those constructs are engineered to bicistronically express mbIL15. However, in several embodiments, to enhance expansion, cytotoxicity, and/or persistence of engineered immune cells (e.g., NK cells), the cells are genetically edited to enhance or disrupt expression of certain genes. In several embodiments, one such gene that is disrupted, in several embodiments knocked out, is CD70. In several embodiments, CD70 expression is disrupted (e.g., knocked out) in NK cells, as NK cells naturally express relatively high levels of CD70, and if expression is maintained at natural levels, NK cells expressing an anti-CD 70 CAR will target not only tumor cells expressing CD70, but also other NK cells (whether natural NK cells or those expressing a CD70 CAR). Thus, in several embodiments, CD70 expression of NK cells is knocked out using gene editing such that engineered NK cells expressing an anti-CD 70 CAR do not target therapeutic NK cells as well as target CD70 expressing tumors.

To assess the expression of CD70 on native NK cells, FACS analysis was performed on donor NK cells 9 days after expansion in culture. These data are shown in fig. 8A-8C. Fig. 8A shows that almost 98% of NK cells from this donor were CD70 positive. Figures 8B and 8C show isotype control stained and unstained NK cells. These data indicate that CD70 expression on expanded NK cells will result in NK cell killing of the NK cell population by NK cells expressing the anti-CD 70 CAR, essentially due to NK cell suicide resulting from lack of differentiation between NK cells expressing CD70 and tumor cells expressing CD 70. FIG. 9 shows a non-limiting schematic of various embodiments for editing and engineering NK cells to effectively target CD70 expressing tumors and exhibit enhanced NK cell persistence. In several embodiments, gene editing is used to reduce, significantly reduce or eliminate CD70 expression by NK cells. NK cells are then engineered to express an anti-CD 70 CAR, such as those utilizing one or more anti-CD 70 binding domains or scFv disclosed herein. This process produces CD 70-targeted NK cells that do not express CD 70. Although this process schematically depicts the editing and engineering of NK cells, in several embodiments, T cells are subjected to a corresponding process.

FIGS. 10A and 10B depict a schematic process flow diagram for gene editing of NK cells (or T cells). These non-limiting embodiments of the gene editing process reflect the use of the CRISPR-Cas system, however other editing approaches are used in several embodiments. FIG. 10A shows a timeline of electroporation of NK cells at day 0 followed by 5 days of culture in high IL-2 medium. On day 5, CD70 expression was assessed by FACS followed by NK cells expansion in culture with feeder cells and low IL-2 medium for an additional 8 days. CD70 expression was again assessed on day 13. FIG. 10B shows another non-limiting method in which NK cells are first expanded by co-culture with feeder cells and using low IL-2 medium, followed by electroporation to introduce guide RNA on day 7, followed by culture in high IL-2 medium for another 5 days. CD70 expression was assessed on days 7 and 11. Non-limiting examples of CD70 guide RNAs are shown in Table 1 below.

Table 1: CD70 guide RNA

SEQ ID NO:	Name of the name	Sequence(s)
			121	CD70-1	TCACCAAGCCCGCGACCAATGGG
122	CD70-2	GCTTTGGTCCCATTGGTCGCGGG
			123	CD70-3	ACCCTCCTCCGGCATCGCCGCGG

Fig. 11A-11B show FACS analysis of CD70 expression from the first experiment (using KD7 method) and fig. 11C-11D show data from the second experiment (also using KD 7). FIG. 11A shows CD70 expression for each of the three guide RNAs used, while FIG. 11B shows CD70 expression for natural NK cells, isotype controls, and unstained controls. Fig. 11C and 11D show the corresponding data from the second experiment (different donor). Although in several embodiments, the use of a single guide RNA is sufficient to achieve the desired level of reduced gene/protein expression, higher reduced levels of CD70 were studied given that CD70 expression by edited and engineered immune cells would lead to a suicide effect.

As used in several embodiments disclosed herein, the effect of using a single guide RNA compared to a combination of guide RNAs was studied. FIGS. 12A-12E relate to the use of single guide RNAs 1, 2, and 3 (12A, 12B, and 12C, respectively). NK cells in this experiment were edited/expanded using KD7 method (editing after expansion). As shown, approximately 20% -50% of NK cells retain CD70 expression. Fig. 12D and 12E are CD70 counts for non-electroporated NK cells and unstained controls. FIGS. 13A-13E show data for combinations of guide RNAs (also using KD 7). FIG. 13A shows NK cells whose CD70-1 and CD70-2 guide RNAs in combination reduced CD70 expression to about 24%. FIG. 13B shows that CD70-1 and CD70-3 guide RNAs in combination further reduced CD70 expression to about 13% NK cells. FIG. 13C shows that CD70-2 and CD70-3 guide RNAs in combination further reduced CD70 expression to less than 13% NK cells. FIGS. 13D and 13E repeat the control data of 12D/12E. These data demonstrate that, according to several embodiments, a significant reduction in CD70 expression can be achieved by using multiple guide RNAs for a target gene (e.g., CD 70).

As shown in fig. 14F, various alternative methods for gene editing cells (e.g., NK cells or T cells) are provided herein. FIG. 14F shows a modified KD7 method in which donor cells are expanded for 7 days, electroporated on day 7, cultured for 5 days to allow gene editing to occur (in some embodiments in high IL2 medium, followed by another 10 days of culture (in some embodiments with low IL2 medium)) CD70 expression is analyzed by FACS on day 21 FIGS. 14A-14E show data related to CD70 expression by NK cells using this method FIG. 14D shows CD70 expression on 96% of NK cells evaluated, while FIG. 14E demonstrates a limited background signal for undyed populations FIGS. 14A, 14B and 14C show a decrease in CD70 expression of NK cells in the range of about 78% to almost 97%.

Fig. 15A-15E show FACS analysis data of NK cells, wherein dual guide RNAs are used to target CD70. FIGS. 15D and 15E repeat the control data of 14D/14E. Fig. 15A shows guide RNAs 1 and 2, which resulted in nearly 80% knockdown of CD70 expression. Fig. 15B shows guide RNAs 1 and 3, which resulted in nearly 97% knockdown of CD70 expression. Fig. 15C shows guide RNAs 2 and 3, which resulted in a CD70 expression knockdown of over 98%. These data indicate that in some embodiments, editing a gene using a single guide RNA results in a significant reduction in expression of a target protein. However, in several embodiments, editing a gene using multiple guide RNAs can further reduce expression of a target protein.

FIGS. 16A-16C show additional gene editing (here using KD0 method) of NK cells from two different donors to further evaluate the effect of gene editing prior to expansion. FIG. 16A shows the knockdown of CD70 expression on NK cells from the first donor achieved using three different guide RNAs (CD 70-1, CD70-2, CD70-3, see Table 1). Fig. 16B shows the results of NK cells of the second donor, while fig. 16C shows control data (natural, unamplified NK cells, which express low levels of CD 70). From these data, it can be seen that substantially all of the native CD70 expression will be knocked out using various guide sets, as according to several embodiments. On day 5 post-amplification, guide groups 1, 2 and 3 reduced expression of native CD70 by almost 99%, 98% and 97%, respectively, for the first donor (16A). These guide RNAs achieved almost 98%, 99% and 97% (respectively) reduction of CD70 expression on NK cells of the second donor (16B). CD70 expression was assessed on day 13 post-editing (8 days after first assessing CD70 expression). Notably, NK cells were still robustly expanded despite CD70 knockdown, suggesting that NK cells could be expanded to clinically significant numbers even with gene editing. Figure 17A shows that CD70 expression was significantly reduced for the first donor even after 8 additional days of culture using guide group 1 and guide group 2 (about 70% -80% reduction in the case of those grnas). The "restoration" of CD70 expression is due to expansion of NK cells, where CD70 is not knocked out or is only partially knocked down. Maintaining CD70 expression at about 70% -80% still represents a significant part of the NK cell population, which can avoid cytotoxic effects on other NK cells expressing anti-CD 70 CARs. Using guide set 3, cd70 expression was higher (e.g., recovered). Similar results are shown for the second donor (fig. 17B), where guide RNA groups 1 and 2 also maintained CD70 knockdown by more than 80%. Fig. 17C shows control data. In several embodiments, successive rounds of CD70FACS can be used to obtain CD70 negative NK cell populations of greater than about 95%, about 96%, about 97%, about 98%, about 99% or more. In several embodiments, such screened NK cell populations may be further expanded after FACS to further increase NK cell numbers, and additional FACS screens may optionally be performed to further purify the expanded populations.

After demonstrating that NK cells can be edited and expanded, experiments were performed to assess the ability of those cells to exert cytotoxic effects on target cells. Jurkat cells express CD27, a ligand for CD 70. In contrast, reh cells do not express CD27. FIGS. 18A-18D show cytotoxicity data for Jurkat or Reh cells at indicated effector to target ratios, the experiment was performed on day 14 post electroporation. FIGS. 18A and 18B are data for NK cells from a first donor, while FIGS. 18C/18D are cells from a different donor. Notably, NK cells can exert cytotoxic effects whether or not the target cell expresses the CD70 ligand CD27. The decrease in the E:T ratio (which effectively dilutes the edited NK cells) resulted in the expected decrease in the measured total cytotoxicity. Thus, according to several embodiments disclosed herein, NK cells that have been edited to reduce their native CD70 expression are preserved for relative cytotoxicity against a given cell line. FIGS. 18A-18D also demonstrate that there is an alternative mechanism for NK cells to exert their cytotoxicity in addition to through CD70-CD27 interactions. This is demonstrated by the fact that: CD70 negative NK cells can still retain cytotoxicity against Jurkat cells (expressing CD70 ligand CD 27) and can also exert cytotoxicity against Reh cells that do not express CD27.

Experiments were also performed to review the extent, if any, of the effect of CD70 depletion on NK cell expansion. FIG. 19A shows a schematic of the KD0 gene editing protocol (the same protocol as used to generate the cells tested in FIGS. 18A-18D). However, on day 13, a fraction of cells were grown at a relatively low density (0.5X10 ⁶ Individual cells/well) were seeded in 24-well plates and expanded in low IL-2 medium for an additional 7 days. Cell counting was performed by FACS on day 20. Amplification data are summarized in fig. 19B. Cells from both donors, marked in each row by the guide RNA used, showed reasonably consistent viability between experimental samples, in terms of percent viable cells, was largeMost samples were around 70%. The fold growth of the cells is shown in the box of fig. 19B. These data indicate that experimental NK cells show about 1.7-fold to about 2.5-fold growth over 20 days even when CD70 expression is disrupted. FACS analysis of CD70 expression levels on NK cells was performed on day 20 and those data are shown in fig. 20A-20C. Figure 20A shows CD70 expression of a first donor using three knockout guides and figure 20B shows data for a second donor. FIG. 20C shows unedited NK cells and other related controls. The initial percentage of CD70 expression, the expression on day 7 (data discussed in fig. 16A-16B), and the final CD70 expression are listed herein. Knock-out 1 and knock-out 2 maintained less than about 7% expression between these four samples, with knock-out 2 showing less than 3% of NK cells expressing CD70 at the last 20 day time point. Interestingly, knockout 1 and knockout 2 exhibited the two lowest CD70 expression levels, but also exhibited some of the highest fold expansion values. Thus, according to several embodiments disclosed herein, knocking down or knocking out native CD70 expression on NK cells (or T cells) does not impair the ability of NK (or T) cells to expand in culture.

Example 2 CD70 knockout, CD70 expression and function of Jurkat cells

As discussed in more detail below, several embodiments provided herein relate to natural CD70 expression that is edited to reduce, significantly reduce or eliminate NK cells, and to engineering NK cells to express an anti-CD 70 CAR. The gene editing reduces the suicide effect of engineered cells expressing the CAR. To assess the ability of a given CAR to bind CD70, a control cell line is developed by gene editing to achieve high (e.g., at least about 100,000, at least about 150,000, at least about 200,000, at least about 250,000 or more copies of CD70 per cell) CD70 expression. As described above, jurkat cells express relatively high levels of CD70, however, to mimic tumor-like CD70 expression, native CD70 expression is first knocked out using gene editing and then replaced to achieve the desired copy number discussed above.

Fig. 21A and 21B relate to CD70 knockout on Jurkat cells. Figure 21A shows that each of guide RNAs group 1, group 2 and group 3 reduced Jurkat CD70 expression by at least 96%. Fig. 21B shows control data. FIG. 22A shows a schematic time frame for analysis of knockdown, expansion or storage of cells and CD70 expression. Figure 22B shows data for CD70 expression after use of guide RNA sets 1, 2 or 3, where Jurkat cells were kept in culture for the duration of the experiment until day 13 of CD70 FACS. In these data, each guide RNA set reduced expression by more than 94%, with guide RNA set 2 reducing expression by more than 97%, and guide RNA set 1 reducing expression by more than 98%. Fig. 22C shows data of Jurkat cells expanded in the same manner as the cells in 22B until day 11, at which time they were frozen. On day 13, those cells were thawed and assessed for CD70 expression. As shown in fig. 23C, the freeze/thaw cycles, which can generally disrupt gene expression and/or viability of the cells, appear to not substantially alter the efficacy of CD70 knockdown. This suggests that, according to several embodiments disclosed herein, jurkat cells can be edited to reduce CD70 expression, then expanded and stored (e.g., frozen) with shelf life and subsequent thawing cycles not adversely affecting the reduction in CD70 expression. Fig. 22D shows the relevant control data.

FIG. 23 shows a non-limiting schematic of a knock-in method for introducing expression of a gene or other desired construct into a specific location for final expression of the gene by a host cell. For example, in some embodiments, the host cell is an NK cell and the target locus is an endogenous CD70 locus. In some embodiments, native CD70 expression is eliminated by targeted insertion at this point, and a CD 70-targeted CAR may be inserted. Alternatively, the target locus may be CD70 and another gene of interest may be knocked in at that point. In further embodiments, for example, with the generation of high CD70 Jurkat cells, the endogenous locus of CD70 may be targeted/disrupted, and enhanced CD70 may be inserted (e.g., driven by an enhanced promoter or the like to enhance CD70 expression to a desired level) and/or a marker (e.g., GFP) may be included to enable visualization of the edited cells.

Continuing to develop high-expressing CD70 Jurkat cells for screening for CD70 CARs, viral constructs encoding human CD70 (hCD 70) labeled with GFP were generated and used to transduce wild-type Jurkat cells or Jurkat cells previously knockdown for CD70 by guide RNA set 1 or guide RNA set 2. FIG. 24A shows (from left to right) the expression of undyed wild-type Jurkat cells, secondary antibody controls and human CD70-GFP construct (which is essentially zero since these are wild-type cells). FIG. 24B shows the same data (from left to right) as discussed above, but using Jurkat cells transduced with the human CD70-GFP construct. Here, almost 85% of the cells express the delivered construct. Fig. 24C shows the corresponding data for Jurkat cells edited using guide RNA set 1. The rightmost plot shows that almost 97% of CD70 expression has been eliminated. FIG. 24D shows Jurkat cells edited with guide RNA set 1 and transduced with a human CD70-GFP construct. Almost 85% of edited and transduced Jurkat cells expressed a detectable human CD70-GFP construct. Fig. 24E shows the corresponding data for editing Jurkat cells with guide RNA set 2, which resulted in a reduction in CD70 expression of more than 98%. FIG. 24F shows the "surrogate" expression of human CD70-GFP by viral transduction, which resulted in more than 90% of Jurkat cells expressing hCD70-GFP. These data are summarized in fig. 25, where two different gating scenarios are used to observe the data in multiple ways. MFI represents the expression of human CDCD70-GFP by the indicated cells. 786-O cells are provided as a reference because they are renal cell carcinoma cells, which are tumor types known to highly express CD 70. Notably, direct viral transduction of Jurkat cells with the human CD70-GFP construct resulted in robust hCD70-GFP expression, which was also achieved with either guide RNA panel 1 or 2 to reduce endogenous CD70 expression. However, when data were gated on a population of Jurkat cells transduced to very high levels (rather than the entire Jurkat population), the expression of hCD70-GFP exceeded the CD70 expression of 786-ORCC cells. This suggests that according to several embodiments, edited and engineered Jurkat cell lines can be generated that can be used to screen for anti-CD 70 targeted CARs.

Jurkat cells were also subjected to viral transduction with human anti-CD 70 antibodies, shown as "NK71 scFv" and "NK72 scFv" (SEQ ID NO:36 and SEQ ID NO:37, respectively) as non-limiting embodiments in FIGS. 26B and 26C. Each of these antibodies has a flag tag (although according to some embodiments, none of the antibodies used in the CAR construct comprise a flag tag or any other tag). Fig. 26A shows control data. Fig. 26B shows the expression of NK71 antibodies on Jurkat cells, and fig. 26C shows the expression of NK72 antibodies, which were elevated above the expression of NK71 antibodies.

FIGS. 27A-27F show data relating to determining whether Jurkat cells expressing NK71 or NK72 can bind to human CD70. FIG. 27A shows (from left to right) the negative control, isotype control (hFC-APC) and binding of Jurkat cells to CD70 (using DNA sequences encoding the extracellular domain (Gln 39-Pro 193) of human CD70 (NP 001243.1) fused at the N-terminus to the Fc region of human IgG1 via a polypeptide linker) when added at two different concentrations (2 ug/ml) or (10 ug/ml). FIG. 27B shows (from left to right) control binding when Jurkat cells were exposed to murine Fc targeting antibodies, binding of murine CD70 to Jurkat cells (again at two concentrations), and the extent of NK71/NK72 expression as measured by APC-labeled anti-flag antibodies. These data indicate that Jurkat cells with endogenous CD27 (ligand for CD 70) expression bind to human CD70, but less to murine CD70. Fig. 27C and 27D show the corresponding data of Jurkat cells transduced with NK71 antibodies. Exposure of Jurkat cells to 2ug/mL of CD70 resulted in nearly 50% of Jurkat cells binding to CD70, while using 10ug/mL increased this binding to more than 80%. A similar pattern was also seen in murine CD70 (27D), where the overall binding was less robust. The right-most plot of fig. 27D shows that binding data was achieved with only about 16% of Jurkat cells expressing NK71 antibody. Fig. 27E and 27F show the corresponding data for Jurkat cells transduced to express NK 72. Figure 27E shows (from left to right) negative control, isotype antibody control, and significant binding of CD70 to Jurkat cells at 2 and 10ug/mL, the latter showing almost 97% binding of Jurkat cells to CD70. Fig. 27F shows the corresponding data for murine CD70 and shows (right-most plot) that NK72 expression is fairly robust, with almost 83% of Jurkat expressing NK72 antibodies. Overall, these data demonstrate that, according to several embodiments, a target gene of interest can be effectively knocked out by a combination of guide RNAs, and that, according to several embodiments, cells can also be engineered to express antibodies that bind to the target of interest. In several embodiments, such cells facilitate, for example, screening candidate binding moieties to obtain one or more desired characteristics, such as affinity for a target.

Example 3-editing of multiple genes and engineering NK cells Using anti-CD 70 CAR

As described above, in several embodiments, immune cells (e.g., NK cells) are edited, e.g., to knock down or knock out expression of a target gene. In some embodiments, multiple genes are edited. In several embodiments, in addition to editing one or more target genes, immune cells (e.g., NK cells) are engineered to express chimeric antigen receptors that target one (or more) target antigens (e.g., tumor markers). In several embodiments, immune cells (e.g., NK cells) are edited to reduce, significantly reduce, and/or eliminate CD70 expression, and engineered to express CD 70-targeted CARs. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate CISH expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate TGFBR (e.g., TGFBR 2) expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate NKG2A expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate ADORA2A (adenosine 2A receptor) expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate cytokine signaling 2 (SOCS 2) expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate Casitas B lineage lymphoma-B (Cbl-B) expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate beta-2 microglobulin (B2-microglobulin or B2M) expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate T cell immune receptor (TIGIT) expression with Ig and ITIM domains. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate programmed cell death protein-1 (PD-1) expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate expression of T cell immunoglobulin and mucin domain protein-3 (TIM-3). In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate CD38 expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate T cell receptor alpha (TCR alpha) expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate CEACAM1 expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate DDIT4 expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate MAPKAP kinase 3 (MAPKAPK 3) expression. In several embodiments, the immune cells are also optionally edited to reduce, significantly reduce, and/or eliminate SMAD3 expression. Non-limiting examples of guide RNAs (e.g., using Cas9, casX, casY, or other endonucleases) for editing one or more such targets can be found in U.S. provisional patent application No. 63/20159 filed 4/15 at 2021, the entire contents of which are incorporated herein by reference.

As suggested by nomenclature, a Tumor Microenvironment (TME) is an environment surrounding a tumor, including surrounding blood vessels and capillaries, immune cells circulating through or remaining within the region, fibroblasts, various signaling molecules associated with tumor cells, immune cells or other cells in the region, and surrounding extracellular matrix. Tumors employ various mechanisms to evade detection and/or destruction of host immune cells, including modification of TMEs. Tumors can alter TMEs by releasing extracellular signals, promoting tumor angiogenesis, or even inducing immune tolerance, in part by restricting immune cells into the TME and/or restricting proliferation/expansion of immune cells in the TME. Tumors can also alter ECM, which can allow the development of pathways that extravasate tumors to new sites. Transforming growth factor beta (TGFb) has beneficial effects in reducing inflammation and preventing autoimmunity. However, it can also suppress anti-tumor immune responses, and thus up-regulated expression of TGFb is associated with tumor progression and metastasis. The TGFb signal can inhibit the cytotoxic function of NK cells by interacting with an NK cell-expressed TGFb receptor, such as TGFb receptor isoform II (TGFBR 2). According to several embodiments disclosed herein, reducing or eliminating expression of TGFBR2 by gene editing (e.g., by CRISPR/Cas9 guided by TGFBR2 guide RNAs) interrupts the inhibition of NK cells by TGFb.

As described above, the CRISPR/Cas9 system is used to specifically target and reduce TGFBR2 expression by NK cells. Various non-limiting examples of guide RNAs were tested and are summarized below.

Table 2: TGFb receptor type 2 isoform guide RNA

SEQ ID NO:	Name of the name	Sequence(s)
			124	TGFBR2-1	CCCCTACCATGACTTTATTC
125	TGFBR2-2	ATTGCACTCATCAGAGCTAC
			126	TGFBR2-3	AGTCATGGTAGGGGAGCTTG
127	TGFBR2-4	TGCTGGCGATACGCGTCCAC
			128	TGFBR2-5	GTGAGCAATCCCCCGGGCGA
129	TGFBR2-6	AACGTGCGGTGGGATCGTGC

According to further embodiments, disruption or elimination of expression of a receptor, pathway, or protein on an immune cell can result in enhanced activity (e.g., cytotoxicity, persistence, etc.) of the immune cell against a target cancer cell. In several embodiments, this results from an inverse inhibitory effect of the immune cells. Natural killer cells express a variety of receptors, particularly those in the natural killer family 2 receptor family. According to several embodiments disclosed herein, one such receptor, the NKG2D receptor, is used to generate a cytotoxic signaling construct that is expressed by NK cells and results in enhanced anti-cancer activity of such NK cells. In addition, NK cells express the NKG2A receptor, which is an inhibitory receptor. One mechanism by which tumors develop resistance to immune cells is through the expression of peptide-loaded HLA class I molecules (HLA-E), which inhibit NK cell activity through the linkage of HLA-E to the NKG2A receptor. Thus, while one approach may be to block the interaction of HLA-E with NKG2A receptors expressed on NK cells, according to several embodiments disclosed herein, the expression of NKG2A is disrupted, which shorts out the inhibition pathway and allows for enhanced NK cell cytotoxicity.

Using the non-limiting guide RNA example shown in Table 3 below, CRISPR/Cas9 was used to disrupt NKG2A expression.

Table 3: NKG2A guide RNA

SEQ ID NO:	Name of the name	Sequence(s)
			135	NKG2A-1	GGAGCTGATGGTAAATCTGC
136	NKG2A-2	TTGAAGGTTTAATTCCGCAT
			137	NKG2A-3	AACAACTATCGTTACCACAG

In several embodiments, other pathways that may affect immune cell signaling are edited. One such example is the CIS/CISH pathway. Cytokine-inducible SH 2-containing proteins (CIS) are negative regulators of IL-15 signaling in NK cells and are encoded by CISH genes in humans. IL-15 signaling can have a positive impact on NK cell expansion, survival, cytotoxicity, and cytokine production. Thus, disruption of CISH may make NK cells more sensitive to IL-15, thereby increasing their anti-tumor effect.

As described above, CRISPR/CAS9 is used to disrupt CISH expression, but in other embodiments, other gene editing methods may be used. Non-limiting examples of CISH-targeted guide RNAs are shown in table 4 below.

Table 4: CISH guide RNA

FIG. 28A shows a schematic diagram of a non-limiting embodiment of a gene editing method used in accordance with embodiments disclosed herein. Cells (e.g., NK cells) were electroporated on day 0 to initiate gene editing by using the gene editing mechanism. In several embodiments, CRISPR-Cas based editing is used. Cells were cultured in high IL-2 medium for one day and then expanded on feeder cells in low IL-2 medium for another 6 days. On day 7, cells were transduced with a viral construct encoding a CAR against the tumor, and then re-expanded for at least another 5 days prior to FACS analysis. In this experiment, double gene editing was performed to knock down the expression of CD70 and to inhibit the expression of the receptor NKG2A, or the expression of the combination of CD70 and TGFBR2 (CD 70 knockdown is shown above). Fig. 28B shows FACS analysis of NKG2A expression after editing, while fig. 28C shows the relevant control. Gene editing reduced NKG2A expression by more than 50%, with less than 20% of edited NK cells expressing inhibitory receptors. Figure 28D shows data for TGFBR2 expression after editing and figure 28E shows the relevant control. TGFBR2 expression is reduced such that only about 3% of the cells express the receptor. These data, together with the data described above in connection with CD70 editing, demonstrate that immune cells (e.g., NK cells) can be successfully edited to alter the expression of two or more target genes.

Double knockouts have been determined to be possible, and the ability to express CARs as disclosed herein on NK cells has also been assessed. FIG. 29A shows NK71 CD70 targeted CAR expression on NK cells that were edited (using CD70-1 guide RNA) to reduce CD70 expression. Almost 90% of NK cells express NK71 CAR. Fig. 29B shows substantially eliminated CD70 expression in those NK cells (only about 5% of cells express CD 70). Fig. 29B shows NK71 CAR expression by cells double edited to reduce CD70 and CISH expression. Likewise, almost 90% of doubly edited NK cells express NK71 CAR. Fig. 29D again demonstrates a significant decrease in CD70 expression on NK cells. Fig. 29E shows the expression of NK71 CAR for cells double edited for CD70 and NKG 2A. More than 90% of doubly edited NK cells express CAR. As shown in fig. 29F, CD70 expression was also significantly reduced in these doubly edited NK cells. Fig. 29G shows NK71 expression on NK cells double edited to reduce expression of CD70 and TGFBR2, with more than 87% of the cells expressing CAR. As shown in fig. 29H, CD70 expression was reduced by almost 90% in these cells. Fig. 29I and 29J show control data (simulated gene editing, e.g., electroporation only). All data shown in fig. 29 were obtained on day 11 (4 days post transduction).

Data from these assay groups were collected on day 18 (11 days post transduction) to assess the persistence of gene editing and stability of CAR expression. Data for NK71 expression in CD70 knockdown is shown in fig. 30A, and corresponding CD70 expression data is shown in fig. 30B. Data for NK71 expression in CD70-CISH knockdown is shown in FIG. 30C, and corresponding CD70 expression data is shown in FIG. 30D. Data for NK71 expression in CD70-NKG2A knockdown is shown in FIG. 30E, and corresponding CD70 expression data is shown in FIG. 30F. Data for NK71 expression in CD70-TGFRB2 knockdown is shown in FIG. 30G and corresponding CD70 expression data is shown in FIG. 30H. Corresponding control data are shown in fig. 30I and 30J. Note in this data that NK71 expression was maintained in each knockout group and CD70 expression was further reduced in each group, with all groups showing 97% or more reduction in CD70 expression.

Looking at the expression data in another way, FIG. 31A shows a graph of the Mean Fluorescence Intensity (MFI) (representing NK71 expression) detected after each gene editing method was performed. It can be seen that each gene editing cell, either single gene editing or double gene editing, expressed NK71 CAR at a higher level than the control and had a relatively consistent MFI in each gene editing method. The percentage of NK71 positive cells (throughout the population tested) is shown in figure 31B. Regardless of the gene editing method employed, at least 60% of NK cells express NK71. The maximum percentage of single CD70 knockouts and combined CD70/CISH knockouts expressed NK71 was almost 80% and about 85%, respectively. Fig. 31C shows the percentage of CD70 expression (expressed as a percentage reduction). It can be seen that each gene editing technique, either targeting CD70 alone or in combination with other targets, resulted in nearly 100% reduction in CD70 expression. FIGS. 32A-32B show corresponding data for NK cells expressing NK 72. Together, these data indicate that genetically edited cells, either editing a single target or both targets, are still capable of expressing CARs at significant expression levels.

Since multiple gene edits can affect signaling pathways (thereby increasing or enhancing proliferation, cytotoxicity, and/or persistence), an experiment was conducted to assess the effect of gene edits on proliferation of edited/engineered NK cells. Transduction of 3×10 with viral constructs encoding NK71 or NK72 CARs ⁵ NK cells (day 7 after gene editing). As discussed above, single or double gene editing was performed. FIG. 33A shows proliferation of CD70 knockdown and CD70/TGFBR2 knockdown at about the same rate in culture over 5 days on day 12 (5 days post transduction). Interestingly, CD70/CISH showed significantly more (about 30%) proliferation than either CD70 knockout or CD70/TGFBR2 knockout. In contrast, CD70/NKG2A gene knockouts showed reduced proliferation compared to all other groups. Fig. 33B shows a similar pattern of cell proliferation for cells transduced with NK72 CAR.

Additional data was collected to assess the long term viability/proliferation of engineered/edited NK cells. Culture of engineered and edited NK cells was performed up to 35 days, with cell population viability measured on days 14, 21, 28 and 35. The results of NK cells expressing NK71 and NK72 are shown in fig. 34A and 34B, respectively. The pattern of viability in this experiment was similar to the proliferation data discussed above. Regardless of the editing method used, overall viability was increased for all groups between day 14 and day 21. The increase in CD70/NKG2DA group was minimal, CD70 alone and CD70/TGFBR2 performed similarly, and CD70/CISH exceeded the other groups. From day 21 to day 28 to day 35, each group showed a decrease in population viability, but the decrease in CD70/CISH edited cells was minimal over time and overall viability was significantly higher at day 35 than in the other groups. According to several embodiments, gene editing may not only enhance the proliferative capacity of edited cells, but may also enhance their viability, as compared to unedited cells. In several embodiments, the dual modifications (or more) can synergistically interact to produce robust proliferating cells that express the CAR, and the viability of those cells is enhanced. Advantageously, in several embodiments, these modifications result in easier production of clinically significant cell numbers.

The edited and engineered cells have been confirmed to express CARs, proliferate successfully in culture and have enhanced viability compared to the unedited cells, thus their antitumor effect was studied. FIG. 35A shows indicated cytotoxicity data of edited and engineered NK cells against 786-O cells (renal cell carcinoma line expressing high levels of CD 70). These edited NK cells were transduced with NK71 CAR and cytotoxicity was measured from day 14 post-editing. TGFb, a cytokine acting as NK cell inhibitor in the tumor microenvironment, was not added here. CD 19-targeted CAR constructs expressed by NK cells (not edited) were used as controls, as were 786-O cells cultured alone. At an E:T ratio of 1:1, each gene editing group significantly reduced 786-O growth during the experiment, and the end result was largely indistinguishable between groups. FIG. 35B shows the same setup, but with an E:T ratio of 1:2. As the number of effector NK cells decreased, various gene editing methods began to show different results. Each of the CD70, CD70/TGFBR2 and CD70/NKG2A groups successfully controlled 786-O tumor cell growth, but to a different extent than the NK cells expressing NK71 edited by CD 70/CISH. Not only does this group show a more rapid anti-tumor effect, but the number of tumor cells is generally reduced more. FIG. 35C shows corresponding data for NK cells edited and engineered to express NK72 CAR and using E:T at 1:1. The data are similar to that of NK71 constructs, with all the edited groups successfully controlling tumor growth. FIG. 35D shows NK72 cytotoxicity data at 1:2 E:T. Similar to NK71 cells, the editing method employed resulted in some differentiation of NK cell cytotoxicity, but not as pronounced as NK71 CARs. Here, CD70 and CD70/NKG2A edited cells showed less robust tumor growth control. CD70/CISH edited NK cells successfully controlled growth (slightly improved over the first two groups) and CD70/TGFBRR2 performed moderately better than CD70/CISH cells. According to several embodiments, the editing method employed works synergistically with a given CAR, and in some embodiments, a particular CAR may be more effective with one or more particular knockouts of the target gene in the engineered cell.

Fig. 36A-36D show data corresponding to those of fig. 35A-35D, but using the ACHN tumor cell line as a target because it expressed low levels of CD70. These data indicate that not only have cytotoxicity of NK cells engineered/edited by CD 70-mediated means, but also have normal cytotoxicity provided by NK cells. FIG. 36A shows that each of the edited groups of cells expressing NK-71 effectively prevented ACHN tumor cell growth at 1:1 E:T. Figure 36B shows the vast differentiation of groups in which CD70/CISH edited cells showed robust anti-tumor effects. FIGS. 36C and 36D show similar patterns when NK72 expressing cells were edited using CD70/CISH, showing the most effective tumor growth control. Thus, in several embodiments, gene editing enhances cytotoxicity of engineered immune cells in a target independent manner. For example, according to several embodiments, CD70/CISH editing confers an increased ability to express NK cells of an anti-CD 70 CAR to exert a cytotoxic effect on a tumor, whether the target tumor is enriched or depleted of the marker identified by the CAR.

FIG. 37A shows additional cytotoxicity data against 786-O RCC tumor cells currently 14 days after transduction (21 days after gene editing). Here a 1:2 E:T ratio was used and NKG 2D-directed NK-cells expressing CAR (NKX 101) were added for comparison. Those cells from another donor were previously engineered to express the NKG2D-OX40-CD3Z construct, amplified, frozen and thawed for this comparative assay. Edited NK cells expressing NK71 all showed robust tumor control, but the CD70/NKG2A group allowed a greater degree of tumor growth, which then tended to smooth and inhibit further increases. Further dilution of effector cells (E: T ratio of 1:4) again resulted in differences in cytotoxicity of the different groups. NK cells expressing NK71 edited by CD70/NKG2A showed minimal tumor growth control, and NK cells expressing NK71 edited by CD70 alone showed modest improvement. CD70/TGFBR2 edited cells exhibited a relatively sustained decrease in 786-O cell number after entering the initial peak of the experiment for about 2 days. Notably, CD70/CISH edited NK cells reduced tumor cell growth to the lowest level of any group, including those operating via the non-CD 70 pathway. Fig. 38A shows the corresponding data for ACHN cells at a 1:2 ratio. Given the lower CD70 expression on these cells, CD70/NKG2A edited NK cells failed to control tumor growth, as the previously discussed groups reduced proliferation and viability. Each of the CD70 and CD70/TGFBR2 edited groups showed reasonable control of tumor growth. Most notably, however, the CD70/CISH edited group was almost similar to the significant inhibition of tumor growth exhibited by NKG 2D-targeted NK cells, although CD70/CISH cells were directed to targets with reduced presence on this tumor cell line. This is consistent with the embodiments discussed above, wherein CD70/CISH gene editing positively affects edited NK cells in a target independent manner, e.g., by enhanced generation of cytotoxic signals, improved NK cell metabolic profile, such that the edited NK cell population can expand to change the starting E: T ratio from 1:2 starting point. This becomes clearer when the results presented in fig. 38B are observed, wherein a 1:4E: T ratio is used, and all groups except NK cells expressing NK71 edited by CD70/CISH allow significant tumor growth. According to several embodiments disclosed herein, the combination of gene editing of CD70 and CISH results in unexpectedly effective editing of immune cells (e.g., NK cells) against tumor cells, even those cells that express a limited amount of a targeting marker. Fig. 39A-39B show corresponding data for NK cells expressing NK72 CAR, where the data have a substantially similar trend, as CD70/CISH edited cells perform better than other editing methods employed in controlling 786-O cell growth among the edited cells. Likewise, fig. 40A and 40B show the corresponding data for NK cells expressing NK72 editing for low CD70ACHN cells. As described above, CD70/CISH edited cells showed the most robust tumor cell growth control. According to several embodiments, CD70 and CISH editing drive edited NK cells (or T cells) exhibit unexpectedly superior anti-tumor effects, even at lower initial E: T ratios. As described above, in several embodiments, CD70 and CISH editing allows NK cells to avoid the suicide effect of anti-CD 70 CAR, and also up-regulate various aspects of edited NK cell metabolism and/or cytotoxic effects.

Further experiments were performed to evaluate CD70/CISH gene knockouts and their enhanced anti-tumor effects. Fig. 41A shows an embodiment of gene editing and engineering for this example, and fig. 41B to 41O show the expression results. In this experiment, the guide RNAs used were CD70-1 and CISH-1. The edited NK cells were transduced with a viral construct encoding NK71 or NK72 on day 7. Fig. 41B is an undyed control and fig. 41C is a CD70 positive control cell. Fig. 41D shows CD70 expression on NK cells after editing, and fig. 41D shows NK71 expression. FIGS. 41F-41G show corresponding data for CD70 and NK72 expression, respectively. Fig. 41H-41I show the corresponding data for CD70 and NK71 expression when both CD70 and CISH are edited, respectively. Fig. 41J-41K show the corresponding data for CD70 and NK72 expression when both CD70 and CISH were edited, respectively. Fig. 41L-41M show the corresponding data for CD70 and NK71 expression, respectively, when cells were exposed to electroporation alone (without guide RNA/CRISPR) and transduced with NK 71. Fig. 41N-41O show the corresponding data for CD70 and NK72 expression, respectively, when cells were exposed to electroporation alone (without guide RNA/CRISPR) and transduced with NK 72. As discussed above, these methods result in a significant (if not complete) reduction in the amount of CD70 and/or CISH expressed by NK cells. If expression does not decrease below a detectable level, the function of the relevant pathway of CD70 and/or CISH is significantly or significantly disrupted according to several embodiments. Disrupting CD70 and CISH expression, and evaluating NK cell cytotoxicity of NK71 and NK72 expressing cells. FIG. 42A shows cytotoxicity data of NK71 expressing NK cells against 786-O cells that have been edited in the manner shown. NK cells were pretreated overnight with (or without) TGF-beta in culture using 1:2 E:T, and prior to and during the experiment as shown. As mentioned above, tgfβ is a cytokine released by tumor cells into the tumor microenvironment and is a way for some tumors to evade immune cells. As with the data discussed above, CD70/CISH edited NK cells were able to control tumor growth. However, it is notable that CD70/CISH edited NK cells significantly controlled the ability of tumor growth after pretreatment with and in the presence of TGFb. In view of the inhibition of immune cell activity by TGFb, the presence of TGFb would be expected to limit the ability of NK cells expressing NK71 to effectively control tumor cell growth, an effect observed in NK cells expressing NK71 edited with CD70 treated with TGFb, which controls tumor growth in a manner indistinguishable from the control. Unexpectedly, CD70/CISH edited cells exposed to TGFb controlled tumor growth almost as well as those that were not inhibited by the presence of TGFb. These effects were observed on cells with low CD70 expression ACHN, see fig. 42B. In this experiment, it was expected that the experimental group in which TGFb was present showed limited ability to control ACHN cell growth, because ACHN cells lack robust CD70 expression by certain cells (such as 786-O) and TGFb was expected to inhibit NK cells. The data in fig. 42B unexpectedly show that even in the presence of inhibitory TGFb, CD70/CISH editing enabled NK cells to achieve the same level of tumor growth control as those experimental groups that were not exposed to the inhibitory signal of TGFb. In some embodiments, CISH knockouts enable edited cells to overcome the inhibitory effects of TGFb in a significant (if not complete) manner. In several embodiments, this confers enhanced ability to effectively control tumor progression to CD70-CISH edited NK cells expressing a CAR (e.g., anti-CD 70 CAR), wherein the cytotoxic effect limits (if not reduces/eliminates) the tumor cells. Fig. 42C shows corresponding cytotoxicity data for edited NK cells engineered to express NK72 CAR. As noted above, CD70/CISH edited NK cells showed significant anti-tumor effects even in the presence of inhibitory TGFb cytokines, which corresponds to several embodiments of the edited and engineered NK cells disclosed herein.

Example 4-further editing of multiple genes including tumor microenvironment related genes

According to several embodiments disclosed herein, gene editing of NK and/or T cells results in edited cells having increased resistance to inhibitors that may be present in the tumor microenvironment. In addition to the experiments discussed above, other experiments were performed to further evaluate the effect of gene editing on NK (or T cell) cytotoxicity.

As described above, NK cells express endogenous CD70, and expression of an anti-CD 70 CAR (designed to target a CD70 expressing tumor) will result in disruption of the engineered NK cell population due to the lack of differentiation between CD70 expressing NK cells and CD70 expressing tumor cells. Thus, several embodiments in which NK cells are engineered to express CD70 also include gene editing to reduce or knock out CD70 expression by NK cells. FIGS. 43A-43I show data related to gene editing of NK cells using different guide RNAs or combinations of guide RNAs to knock out CD70 expression (expression assessed 7 days after electroporation). FIG. 43A shows CRISPR-Cas9 gene editing using CD70-1 guide RNA reduces CD70 expression by more than 75%. CD70 expression was reduced by more than 60% using CD70-2 guide RNA editing (43B). CD70 expression was reduced by more than 55% using CD70-3 guide RNA editing (43C). The combination of guide RNAs 1 and 3 reduced CD70 expression on NK cells by more than 75% (43D). The combination of guide RNAs 1 and 2 also reduced CD70 expression on NK cells by more than 75% (43E). The combination of guide RNAs 2 and 3 reduced CD70 expression on NK cells by almost 85% (43F). As discussed herein, in several embodiments, multiple genes are edited in a combined manner. FIG. 43G shows reduced expression of CD70 (reduced by almost 80%) when NK cells were edited using a combination of CD70-1 guide RNA and CISH-targeting guide RNA (CISH-1). Similarly, CD70 expression was reduced by more than 80% when using CD70-1 guide RNA in combination with three guide RNAs targeting the adenosine receptor (A2 AR). Three non-limiting examples of guide RNAs targeting A2AR are shown in table 5.

Table 5: adenosine receptor (A2 AR) guide RNAs

These data indicate that targeting multiple genes in combination does not reduce the effectiveness of CD70 gene editing. FIG. 43I shows control (electroporation only) CD70 expression on NK cells.

Data concerning cytotoxicity of these different constructs. Figure 44A shows the percent cytotoxicity of gene-edited NK (note that NK cells were not engineered to express CAR for this data) cells against REH tumor cells at a 1:1 or 1:2e:t ratio. These genetically edited cells exhibit about 35% -50% cytotoxicity to REH tumor cells at a 1:1E:T ratio, whereas Electroporation (EP) alone and Unedited (UN) NK cells produce about 20% -25% cytotoxicity at a 1:1E:T ratio. The E:T ratio converted to 1:2 reduced cytotoxicity in all groups, with the control group reduced to about 10% and the majority of the edited cells produced about 20% -30% cytotoxicity. These data are also shown in different ways in fig. 44B (1:1) and fig. 44C (1:2), which allows further insight into how various edits can affect the efficacy of NK cells. Editing NK cells with either CD70-1 or-2 guide RNA alone resulted in similar cytotoxicity. The use of guide RNA CD70-3 or CD70-1+3 appears to slightly improve cytotoxicity. In contrast, combinations of guide RNAs CD70-2+3 or 1+2 were shown to reduce cytotoxicity. CISH and A2AR edited NK cells showed the same (CISH) or slightly higher (A2 AR) cytotoxicity at a 1:1e:t ratio as CD70 edited cells. A similar pattern is shown in fig. 44C with an E: T ratio of 1:2. These data indicate that in some embodiments, specific guide RNAs may be particularly useful. However, these data also indicate that even though there is some slight difference in cytotoxicity change between editing mechanisms used, editing results in increased cytotoxicity (e.g., through resistance to TME signaling) compared to non-edited cells.

Figure 44D shows additional data demonstrating further increases in cytotoxicity when genetically edited cells were engineered to express an anti-tumor CAR. In this experiment, nalm6 cells were used as target tumor cells and incubated with various NK cells at an E: T ratio of 1:1 (20,000 target cells). As expected, nalm6 cells alone increased throughout the experiment. Nalm6 cells incubated with control NK cells (either Electroporated (EP) alone or not electroporated (UN)) showed reduced growth over time compared to Nalm6 alone. Editing NK cells (but not engineered) further reduced Nalm6 growth as shown by the two traces of CD70-1 and CD 70-2. Those NK cells that were edited using CD70-1 or CD70-2 guide RNAs and engineered to express a non-limiting embodiment of a CD 19-targeted CAR, as well as unedited NK cells engineered to express the same CAR, resulted in complete eradication of the target Nalm6 tumor cells. Thus, according to several embodiments, expression of an anti-tumor CAR and gene editing of immune cells (e.g., NK cells) results in highly cytotoxic edited/engineered cells. In several embodiments, other aspects of the edited/engineered cells are enhanced, such as the lifetime (e.g., persistence) of the cells, particularly in vivo persistence, the ability of the cells to expand and/or store, and the like. In several embodiments, editing allows edited and engineered cells to be used at lower E: T ratios, but still effectively control tumor growth.

FIG. 45A further discusses the effect of gene editing, wherein CD70 knockout NK cells were also edited for CISH knockout or adenosine receptor (A2 AR) knockout. Indicated edited cells (non-engineered) or control cells (electroporated only (EP) or not (UN)) were incubated with Reh tumor cells at an E: T ratio of 1:1 (20,000 NK cells). Control Reh cells proliferated significantly over the first few days of the experiment, with growth remaining stable and maintaining elevated population levels during the experiment. Control EP and UN NK cells delayed the expansion of the Reh cells at the initial stage, but eventually Reh cells began to expand rapidly near the end of co-culture. In contrast, CD 70-edited cells (CD 70-1 gRNA) were allowed to grow moderately only on the last day of the experiment. Likewise, the combination of editing with CD70-1gRNA and editing CISH resulted in further control of tumor cell growth. Following this trend, the combination of editing with CD70-1gRNA and editing of the adenosine receptor resulted in maximum control of Reh cell growth. FIG. 45B shows similar experimental results, but using an E:T ratio of 1:2. These data indicate that the relative properties of double edited NK cells are more concentrated, making it more difficult to determine which group of cells exhibits greater cytotoxicity. However, this data also demonstrates that single or multiple gene edits to reduce or eliminate expression of certain genes (e.g., CISH, A2AR, or other genes associated with immunosuppressive properties of tumor microenvironment) produce immune cells (e.g., NK cells or T cells, depending on the embodiment) with enhanced tumor-directed cytotoxicity. As discussed above, in several embodiments, other characteristics of the edited immune cells, such as persistence, expansion capacity, etc., may also be enhanced.

Further studies were conducted on the enhanced anti-tumor effect of genetically edited immune cells by gene editing of certain tumor microenvironment related genes and engineering the immune cells (here NK cells) to express anti-CD 70 CARs (targeting CD70 expressing tumor cells). Fig. 46A-46J show FACS analysis incorporating various gene edits engineered to induce expression of a non-limiting embodiment of an anti-CD 70 CAR (here NK 71). FIG. 46A shows the distribution of NK cells (based on editing of NK cells used with guide RNA CD 70-1) positive for NK71 expression and (ii) negative for CD70 expression. About 84% of the NK cells sampled fit the expression profile. Similarly, in the case of editing cells with CD70-2 guide RNA, about 85% of NK cells sampled exhibited NK71 expression and reduced CD70 expression (fig. 46B). When CD70 was edited using guide RNA CD70-3 or a combination of guide RNA CD70-1 and-3, a slightly higher degree of NK71/CD 70-edited expressing cells were detected (both almost 87%; FIG. 46C-FIG. 46D). Using guide RNA CD70-2 and-3 produced almost 90% of the NK cells sampled with this phenotype (FIG. 46E). Similarly, using guide RNAs CD70-1 and-2 produced more than 85% of sampled NK cells with this phenotype (fig. 46F). Similar values were generated when cells were edited using CD70-1 knockdown expressed by CD70 and CISH-1 guide RNA knockdown expressed by CISH (approximately 84%, FIG. 46G) and A2AR-1, -2 and-3 guide RNA knockdown expressed by CD70 and A2AR (FIG. 46H). Fig. 46I and 46J show control data. Taken together, these data demonstrate that a significant number of immune cells (e.g., NK cells) can be successfully edited (in several embodiments, multiple targets) and engineered to express tumor-targeted CARs.

It has been shown that immune cells (such as NK cells) can be edited (in several embodiments, multiple targets) and engineered to express CARs, and experiments were therefore performed to determine cytotoxicity of such cells. 786-O cells (renal cell carcinoma cell lines known to express high levels of CD 70) were used as target tumor cells as part of this experiment. FIG. 47A shows experimental results when various NK cell constructs were present at an E:T ratio of 1:2 (10,000 NK cells). As expected, the 786-O cells of the negative control alone expanded rapidly and maintained a relatively high cell count throughout the experiment. Electroporation of cells (EP) alone allowed a fairly robust early stage increase followed by a long time gradual decline starting about 2 days after co-culture with 786-O cells. CD70-1 guide RNA edited cells exhibited a similar pattern, but were accompanied by improved overall control of tumor cell numbers. The overall cytotoxicity profile was only similar in shape to CD70-1 guide RNA edited cells, with those cells that were otherwise engineered to express NK71 (non-limiting CD70 targeted CARs) exhibiting more significant control over tumor expansion. Notably, in this experiment, the apparent control of tumor growth was at an E:T ratio of 1:2, indicating the highly effective nature of cells according to embodiments disclosed herein generally directed against tumor cells, but in particular against cells expressing targets of elevated levels of CAR expressed by edited/engineered cells.

Further shown is the data shown in fig. 47B for enhanced cytotoxicity against cells expressing elevated levels of a tumor marker targeted by a CAR expressed by edited and/or engineered immune cells. The experimental setup here reduced the E:T ratio to 1:4 (5,000 NK cells) and used high CD70 expressing Reh cells and indicated edited and/or edited and engineered NK cells. From this data, it can be seen that editing NK cells to reduce NK cell expression continues to allow edited CD70 knockout cells (CD 70-1) to control tumor growth more effectively than control NK cells. Engineering the edited NK cells additionally to express anti-CD 70 CAR (cd70+nk 71) further improved the cytotoxic effect. Advantageously, editing multiple genes cd70+cish or cd70+a2ar in NK cells in combination with engineering the cells to express anti-CD 70 CAR still resulted in a further improvement in cytotoxicity against target 786-O cells, which was most pronounced with A2AR editing. A similar trend is shown in FIG. 47C, where the E:T ratio is further reduced (1:8, 2,500 NK cells). These data further demonstrate enhanced cytotoxicity against target cells not only due to editing immune cells (e.g., NK cells) induction, but also due to unexpectedly enhanced cytotoxicity caused by editing multiple targets (e.g., TME-related genes) and engineering cells to express CARs.

It was further demonstrated that an advantage of using CAR specific for this marker to target tumor markers ubiquitous on target cells is the data presented in fig. 47D-47F, wherein co-culture of various edited and/or edited and engineered NK cells was employed for ACHN tumor cells expressing relatively low levels of CD 70. As can be seen in fig. 47D (1:2 e: t,10,000 NK cells), CD70 editing alone resulted in NK cells with cytotoxicity comparable to NK cells subjected to Electroporation (EP) alone. Tumor growth in this experimental set-up was similar, whether NK cells were present or not, suggesting that ACHN cells were expected to perform worse than EP cells alone by a series of signal growth and expansion that did not involve expression of CD27 (binding agent of CD70 (typically expressed by NK cells)) or involved some other TME signaling moiety that blocks/reduces immune cell function. Even with relatively low expression of CD70 in ACHN cells, engineering NK cells to express NK71 (a non-limiting example of an anti-tumor CAR) produced a significant improvement in reducing tumor growth compared to controls, but overall tumor cell counts increased over time. These trends are illustrated in fig. 47E and 47F, which employ 1:4 and 1:8e:t ratios, respectively (in these cytotoxicity assays, the target cell number remains constant at 20,000 cells). This effectively dilutes effector cells compared to the target, and ACHN tumor growth progresses to a level indistinguishable from the control without the ability to bind to overexpressed CD70 via the CAR. These data support the approach that gene editing in combination with CAR engineered immune cells targeting markers expressed by target tumor cells can result in enhanced resistance to immunosuppressive signals from the tumor microenvironment, and ultimately enhanced cytotoxicity, persistence, and/or overall efficacy against the tumor for a given cancer.

To further elucidate the ability to genetically edit immune cells (e.g., NK cells), additional experiments were performed that compared the cytotoxicity of genetically edited cells engineered to express a non-limiting embodiment of a CAR against CD70 (here NK 71) in the presence and absence of inhibitors of the edited gene. In this experiment, the high affinity adenosine receptor agonist NECA was used. NECA has Ki (inhibitory concentration) of 6.2, 14 and 20nM for human adenosine receptor subtypes A3, A1 and A2A receptor, respectively, and an EC50 of 2.4. Mu.M for human A2B receptor. Adenosine, e.g., extracellular adenosine in the blood stream, acts on immune cells, including NK cells, by binding to one of these four adenosine receptors, most notably the A2A receptor (A2 AR), thereby inhibiting NK cell immune function. Thus, the presence of NECA in a co-culture of tumor cells and NK cells is expected to negatively affect the cytotoxic function of NK cells. As can be seen in fig. 48A (in cytotoxicity map) and fig. 48B (histogram), NK cells expressing NK71 alone and having NECA in co-culture with 786-O cells exhibited a greater degree of cytotoxicity than NK cells expressing NK71 and edited for A2AR disruption. The comparison of the two groups is indicated by a dashed line. Note that figure 48A does not include traces of 786-O cells alone, which allows for greater visual separation of the cytotoxicity curves of the various treatment groups. Additional data is shown in fig. 48C and 48D. Here, a 1:2 E:T (1:1 used in 48A) was used, and the tested constructs showed relatively similar cytotoxicity profiles (controls were not shown again to reduce compression of the line graph in FIG. 48C). The histogram of fig. 48D summarizes these data. It can be seen that CISH editing of NK cells increased the cytotoxic effect of NK cells expressing NK71 (compare bar 1 with 2 histograms). Interestingly, the editing of CISH (bar 5) and A2AR (bar 6) resulted in increased cytotoxicity (less signal detection from tumor cells) even when NECA was present (bar 4). It is expected that there may be some common downstream signaling between CISH and A2AR that accounts for this resistance to NECA, which mimics the agonist-based inhibition of NK cell function that can be observed in tumor microenvironment. Thus, according to several embodiments, editing CISH and/or A2AR (or another target involved in tumor microenvironment-related immunosuppression) may not only provide a degree of resistance to immunosuppression by the tumor microenvironment in immune cells (e.g., NK cells), but may also act synergistically with anti-tumor CARs expressed by immune cells (e.g., anti-CD 70 CARs), resulting in enhanced cytotoxicity against the tumor. According to several embodiments, the method may also result in other improved characteristics of the cells, such as enhanced persistence (especially in tumor microenvironments), increased expansion capacity, increased target specificity and reduced dose requirements (lower number of cells administered or increased time between doses, etc.).

Additional genes known to affect NK cell activity have also been studied. More specifically, the following genes were studied: DPP homolog 3 (SMAD 3), MAP kinase activated protein kinase 3 (MAPKAPK 3), carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM 1), and DNA damage-inducing transcript 4 (DDIT 4) are currently in use. SMAD3 is an intracellular downstream signaling protein of the TGFb ligand superfamily. SMAD3 mediated TGFb receptor or ALK4 signaling can result in inhibition of NK cells. MAPKAPK3 activity inhibits IFN-gamma gene expression and reduces NK cell cytotoxicity. CEACAM1 is a checkpoint molecule on the surface of NK cells and is highly upregulated during NK cell feeder cell expansion. DDIT4 is a negative regulator of mTORC 1; mTORC1 effects IL-15 mediated NK cell survival, proliferation, cytotoxicity, and glucose metabolism. Thus, it was investigated whether knocking out these genes would improve the efficacy of anti-CD 70 CAR NK cells. Non-limiting embodiments of guide RNAs for disrupting SMAD3, MAPKAPK3, CEACAM1, and DDIT4 are provided in table 6.

Table 6: additional guide RNA

A non-limiting schematic of the anti-CD 70 CAR and gene editing/amplification scheme is provided in fig. 49A. NK cells were first gene edited (e.g., using CRISPR/Cas electroporation) to double knock out CD70 and one of these target genes. The electroporated cells were cultured under high IL-2 conditions followed by expansion of NK cells using IL-12 and IL-18. On day 7 after gene editing, NK cells were transduced with viruses containing CAR gene sequences (e.g., NK 71) (as shown in figure 6). After transduction, NK cells were assessed for CAR expression and used for cytotoxicity assays. CD70 expression was continuously decreased under different conditions on day 7 after double knockout of CD70 and target genes (SMAD 3, MAPKAPK3[ MK3], CEACAM1, DDIT4, A2AR, NKG2A, CISH) (FIG. 49B). On day 10 post double knockout (and NK71 CAR transduction on day 7), essentially no CD70 expression was detected, and NK71 expression was consistent under different conditions (fig. 49C). NK cell population genes edited for the target were amplified on their respective exons at the targeted locus as shown in fig. 49D. The locus amplicons were sequenced to determine the frequency of indels within NK cell populations (fig. 49D).

SMAD3 was knocked out in NK cell populations expressing NK71 CAR. Loss of SMAD3 protein was confirmed by loss of phosphorylated SMAD3 signal following western blot and TGFb treatment (fig. 49E). Cytotoxicity assays were performed using NK cell populations knocked out of SMAD3 or CISH and expressing NK71 CARs with or without 20ng/mL TGFb (fig. 49F-49G). Unlike the CISH knockout population, SMAD3 gene knockout failed to overcome the inhibition of NK71 cell cytotoxicity by TGFb, as seen by: the number of tumor cells remaining under smad3ko+tgfb treated conditions was greater than that under TGFb-only treatment.

A2AR was knocked out in NK cell populations expressing NK71 CAR. Cytotoxicity assays were performed using NK cell populations knocked out of A2AR or CISH and expressing NK71 CARs with or without treatment with the adenosine receptor agonist NECA at 10uM (fig. 49H-49I). The results observed here are similar to those discussed above (e.g., fig. 48). Cytotoxicity assay results indicate that A2AR knockout or CISH knockout can overcome the inhibitory effect of NECA on NK71 cell cytotoxicity.

MAPKAPK3 (MK 3) was knocked out in NK cell populations expressing NK71 CAR. Cytotoxicity assays were performed using NK cell populations knocked out of MK3 or CISH and expressing NK71 CARs (fig. 49J-49K). MK3 knockout moderately enhanced NK cell cytotoxicity.

NKG2A was knocked out in NK cell populations expressing NK71 CAR. Cytotoxicity assays were performed using NK cell populations knocked out of NKG2A or CISH (or MK3 for comparison) and expressing NK71 CARs. Under normal conditions, NKG2A knockdown increased NK cell cytotoxicity against 786-O tumor cells (fig. 49L-49N). However, NKG2A knockdown did not overcome inhibition of NK cells when tested in 20ng/mL TGFb (1:1 E:T; FIG. 49O) or 10. Mu.M NECA (1:2 E:T; FIG. 49P).

DDIT4 was knocked out in NK cell populations expressing NK71 CAR. Cytotoxicity assays were performed using NK cell populations knocked out of DDIT4 or CISH and expressing NK71 CARs (fig. 49Q-49R). With 50. Mu.M CoCl ₂ The cells are treated to induce hypoxia, thereby inducing DIT4 to inhibit mTor. DDIT4 knockdown was not found to enhance NK cell cytotoxicity.

CEACAM1 was knocked out in NK cell populations expressing NK71 CAR. Cytotoxicity assays were performed using NK cell populations knocked out of CEACAM1 or CISH and expressing NK71 CARs (fig. 49S-49T). CEACAM5 was added at 1 μg/mL, which could be found on the tumor cell surface and interacted with CEACAM1. CEACAM1 knockdown was not found to enhance NK cell cytotoxicity.

NK cell populations edited to knock out CISH, A2AR, SMAD3, MK3, DDIT4 or CEACAM1 (over 42 days, FIG. 49U) or CISH or NKG2A (over 49 days, FIG. 49V) were evaluated to observe NK cell proliferation and viability as measured by cell count. At the final time point of the test, CISH knockout was found to have the greatest benefit on NK cell survival. Thus, in several embodiments, CISH is edited to confer a beneficial effect on NK or T cells expressing one or more anti-CD 70 CAR constructs disclosed herein. In further embodiments, genes other than CISH are edited to provide further benefits, in some embodiments, they cooperate with those of CISH-edited cells to produce highly efficient and durable edited cells for use in the therapy of CD 70-expressing tumors.

Example 5-anti-CD 70 binding Domain screening and characterization

As described above, various anti-CD 70 binding domains were generated and evaluated for expression, cytotoxicity to target cells, and additionally characterized according to the non-limiting methods and experiments described herein.

A pool of 1600 candidate anti-CD 70 binding domains was screened to identify nearly 1000 unique scFv. They are further screened for their ability to bind to either or both of a monomer or trimer of CD70 epitopes, and their ability to compete with (or block) known anti-CD 70 binding agents for binding to such CD70 epitopes. The test for CD70 trimer allows identification of binders selective for the naturally occurring trimeric conformation of CD70, while the test for CD70 monomer allows selection of high affinity binders.

Based on the CD70 binding assay, 74 individual scFv were identified and selected for further characterization. Non-limiting examples of nucleotide sequences for selected scFv are provided in SEQ ID NOS.38-111. Non-limiting examples of nucleotide sequences for the individual heavy chain variable regions (VH) of selected scFv are provided in SEQ ID NOS 1038-1111. Non-limiting examples of nucleotide sequences for the individual light chain variable regions (VL) of selected scFv are provided in SEQ ID NOS 1112-1185. The peptide sequence of the selected scFv is provided in SEQ ID NO 230-303. The peptide sequences of the individual VHs of the selected scFv are provided in SEQ ID NO 890-963. The peptide sequences of the individual VL of the scFv selected are provided in SEQ ID NOS 964-1037. It is contemplated that other nucleotide sequences provided (e.g., sequences having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology) can be translated into the same peptide scFv sequence as conventionally understood. Non-limiting examples of nucleic acid and peptide sequences for each of the 74 selected anti-CD 70 scFv are depicted in fig. 50A.

Divalent scfvs were prepared from some of the selected anti-CD 70 scFv. The bivalent scFv prepared included: 1) NK77.38/NK77.38, 2) NK77.64/NK77.64, 3) NK77.65/NK77.65, 4) NK77.38/NK77.67, 5) NK77.38/NK77.68, 6) NK77.64/NK77.67, 7) NK77.64/NK77.68, 8) NK77.65/NK77.67, 9) NK77.65/NK77.68. The name of the bivalent combination corresponds to the nomenclature used for the monovalent scFv as disclosed herein (e.g., in fig. 50A). Non-limiting examples of nucleotide sequences for these bivalent scFv are provided in SEQ ID NOS 112-120. The corresponding peptide sequences of these bivalent scFv are provided in SEQ ID NO. 304-312.

Separate heavy and light chain variable region Complementarity Determining Regions (CDRs) are also provided. A non-limiting example of CDR-H1 is provided in SEQ ID NOS 428-501. Non-limiting examples of CDR-H2 are provided in SEQ ID NOS 502-575. A non-limiting example of CDR-H3 is provided in SEQ ID NO 576-649. Non-limiting examples of CDR-L1 are provided in SEQ ID NOS 668-741. A non-limiting example of CDR-L1 is provided in SEQ ID NOS: 742-815. Non-limiting examples of CDR-L1 are provided in SEQ ID NOS 816-889. Combinations of each selected anti-CD 70 scFv are provided in figure 50B. It is contemplated that other anti-CD 70 scFv (or sdAb) can be produced by other combinations of heavy and light chain CDRs provided herein.

The anti-CD 70 scFv disclosed herein is produced in an immunoglobulin framework conventionally known in the art. For example, each heavy and light chain variable region framework used has 4 framework sequences (FW-1, FW-2, FW-3, FW-4) in which three CDRs are provided. Non-limiting examples of FW-H1 are provided in SEQ ID NOS: 399-402. Non-limiting examples of FW-H2 are provided in SEQ ID NOS: 403-406. Non-limiting examples of FW-H3 are provided in SEQ ID NOS: 407-422. Non-limiting examples of FW-H4 are provided in SEQ ID NOS: 423-427. Non-limiting examples of FW-L1 are provided in SEQ ID NOS: 650-653. Non-limiting examples of FW-L2 are provided in SEQ ID NOS: 654-657. Non-limiting examples of FW-L3 are provided in SEQ ID NOS 658-661. Exemplary FW-L4 is provided in SEQ ID NOS 662-667. It is contemplated that alternate frames may be substituted for any of the frames disclosed herein, as will be appreciated by those of skill in the art.

CARs were prepared from these selected 74 anti-CD 70 scFv. The CAR is constructed using an anti-CD 70 scFv, CD8a hinge, CD8a transmembrane domain, OX40 subdomain, and CD3 zeta subdomain, as depicted in fig. 6, however, according to further embodiments, other domains disclosed herein (e.g., 4-1BB, CD28, etc.) may also be used. Non-limiting examples of nucleotide sequences for monovalent CARs are provided in SEQ ID NOS: 138-211. Non-limiting examples of nucleotide sequences for bivalent CARs are provided in SEQ ID NOS.212-220. Other non-limiting examples of codon optimized sequences for bivalent CARs are provided in SEQ ID NOS 221-229. The corresponding peptide sequence of the monovalent CAR is provided in SEQ ID NO. 313-386. The corresponding peptide sequence of the bivalent CAR is provided in SEQ ID NO 387-395.

The tonic signaling and activation capacity of the first 74 CARs were measured in Jurkat cells. A schematic diagram for this is depicted in fig. 50C. Briefly, jurkat cells that have previously undergone gene editing to knock out CD70 are transduced, amplified with standard titers of viruses containing the anti-CD 70 CAR gene sequence, and cultured alone (to test for tonic signaling) or co-cultured with tumor cells to test for CAR-mediated activation. Activation was measured by CD69 expression. Most of the prepared anti-CD 70 CARs did not exhibit significant tonic signaling except for clone NK77.48 and two bivalent CARs, NK77.78 (NK 77.65 repeat bivalent) and NK77.83 (NK 77.65/NK77.67 bivalent) (figure 50D). The ratio of activation to tonic signaling after tumor cell co-culture indicates which constructs effectively function to transduce immune cell activation (fig. 50E). From this screening a set of 10 CAR constructs (NK 77.11, NK77.16, NK77.17, NK77.31, NK77.44, NK77.55, NK77.58, NK77.65, NK77.71, NK 77.73) was obtained (fig. 50F). Most of the anti-CD 70 CARs tested in the subsequent assays are part of the set of 10 selected CARs, but any anti-CD 70 CAR disclosed herein can be similarly assayed in any combination and/or used in the cell therapy compositions or methods disclosed herein.

In some embodiments, provided herein are also nucleic acid or amino acid sequences that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% (and ranges therein) sequence identity and/or homology as compared to the corresponding nucleic acid or amino acid sequence of SEQ ID No.138-395 (or a combination of two or more of SEQ ID No. 138-395) and that exhibit one or more functions as compared to the corresponding nucleic acid or amino acid sequence of SEQ ID No.138-395 (or a combination of two or more of SEQ ID No. 138-395), including but not limited to (i) enhanced proliferation, (ii) enhanced activation, (iii) enhanced cytotoxic activity against cells that exhibit ligands bound by NK cells containing receptors encoded by the nucleic acid and amino acid sequences, (iv) enhanced homing to tumors or sites of infection, (v) reduced off-target cytotoxicity, (vi) enhanced immune stimulatory cytokines and chemokines (including but not limited to IFNg, TNFa, IL-22, perforins, CCL3, CCL4, and CCL 5), (vii) enhanced immune responses and further combinations thereof.

Example 6-anti-CD 70 CAR screening and characterization

Several in vitro experimental examples are provided herein to characterize and verify the cytotoxic ability of anti-CD 70 CAR constructs expressed by NK cells lacking CD 70.

As shown in fig. 51A-51B, NK cells from one donor (denoted donor 451) were transduced to express an anti-CD 70 CAR and were genetically edited to reduce expression of CD 70. Constructs NK77.55, NK77.58, NK77.65, NK77.71 and NK77.73 were tested, but any CD70 CAR disclosed herein may be used (throughout the disclosure unless otherwise noted) depending on the embodiment. Flow cytometry plots detecting anti-CD 70 CAR (anti-FLAG antibody conjugated by Allophycocyanin (APC)) and loss of CD70 expression (anti-CD 70 antibody conjugated by Phycoerythrin (PE)) showed variability between tested CAR constructs expressed by NK cell populations (fig. 51A). Clones with higher transduction efficiencies (e.g., NK77.58 and NK 77.71) exhibited greater killing of cd70+ NK cells (i.e., where CD70 knockdown was unsuccessful or incomplete), resulting in low abundance of cd70+ cells in the figure (fig. 51B). NK8 refers to the control structure expressing GFP instead of CAR/mbiL 15.

As shown in fig. 52A-52D, NK from another donor (denoted donor 454) was transduced to express anti-CD 70 CAR and gene edited to lose expression of CD 70. Constructs NK77.55, NK77.58, NK77.65, NK77.71 and NK77.73 were tested and the untransduced and NK71 constructs served as controls. Flow cytometry plots detecting anti-CD 70 CAR (APC-anti FLAG) and loss of CD70 expression (PE-anti CD 70) showed robust expression of anti-CD 70 CAR and few cd70+ cells (fig. 52A). The high frequency and low cd70+ abundance of CAR transduction suggests that transduced NK cells killed any remaining cd70+ cells that were unsuccessful or incomplete in CD70 knockout (fig. 52B). Measurement of the raw Mean Fluorescence Intensity (MFI) indicated that the relative expression level/cell for each CAR may be different, although the transduction efficiency was high (fig. 52C). The set of CAR NK cells were subjected to cytotoxicity assays against 786-O cancer cells at different effector to target (E: T) ratios, and ECs were calculated ₅₀ . NK71 CAR was used as a control. Each CAR tested produced an EC in the range of about 0.25e:t or less ₅₀ These CAR NK cells were shown to be effective in clearing co-cultured tumor cells.

As shown in fig. 53A-53F, CAR NK cells from donor 454 (shown in fig. 52) were subjected to cytotoxicity assays. anti-CD 70 CAR NK77.55, NK77.58, NK77.65, NK77.71 and NK77.73 were tested as provided above, and NK71 served as controls. Cytotoxicity was tested at E:T ratios of 1:2 (FIGS. 53A-53C), 1:4 (FIGS. 53D-53E) and 1:8 (FIG. 53F). For the 1:2 ratio condition, NK cells were re-stimulated with additional tumor cells on day 7 and cytotoxicity was measured continuously until day 10 (fig. 53C). Each anti-CD 70 CAR construct tested resulted in increased cytotoxicity to 786-O cells relative to the negative control. Constructs NK77.58 and NK77.71 consistently had the greatest relative cytotoxicity compared to other CARs and positive control CAR NK 71.

As shown in fig. 54A-54D, CAR NK cells from donor 454 (shown in fig. 52, 53) or similarly transduced to NK92 (immortalized NK cell-like cell line) were subjected to additional cytotoxicity assays. As a non-limiting example, NK cell populations with NK77.58 and NK77.71 were tested as they had the greatest activity, as shown in figure 53. ACHN cells expressing 786-O of GFP or stained with NucRed were subjected to cytotoxicity assays at E:T ratios of 1:2 (FIGS. 54A-54B) or 1:4 (FIGS. 54C-54D). Cytotoxicity of the two CAR constructs was consistent under different conditions, which resulted in a significant reduction of tumor cells relative to negative controls. NK71 transduced only to NK92 cells was found to be more cytotoxic compared to both constructs.

As shown in fig. 55A-55M, additional anti-CD 70 CARs were tested with NK cells from donor 451. CD70 knockout NK cells from donor 451 were transduced to express constructs NK77.11, NK77.16, NK77.17, NK77.31 and NK77.44, with NK71 as positive control. Flow cytometry plots detecting anti-CD 70 CAR (APC-anti FLAG) and loss of CD70 expression (PE-anti CD 70) showed robust expression of CAR and negligible presence of cd70+ cells (fig. 55A). These CAR NK cells were subjected to cytotoxicity assays against 786-O cells at different E: T ratios and ECs were calculated ₅₀ (FIGS. 55B-55C). EC of constructs NK77.11, NK77.16, NK77.17, NK77.31 and NK77.44 ₅₀ Ranging from about 0.5 to 0.63, which is lower than the EC measured for NK71 constructs ₅₀ . NK77.44 results in an EC of about 1.5 ₅₀ This may indicate lower cytotoxicity efficacy. These CAR NK cells were further subjected to time course cytotoxicity assays at an E: T ratio of 1:2 (fig. 55D-55I) or 1:4 (fig. 55J-55M). NK cell cultures were re-stimulated with additional tumor cells over longer periods of time (fig. 55G and 55M). In this case, the re-challenge was at day 7 and cytotoxicity was measured until day 11. Each anti-CD 70 CAR tested resulted in cytotoxicity relative to the negative control . Construct NK77.11 performed best overall. EC as in FIGS. 55B-55C ₅₀ As the data show, NK77.44 does not perform as well as the other CARs tested. Interestingly, control CAR NK71 performed best at earlier time points, but NK71 performed less well after re-challenge and longer culture than experimental CAR constructs, which might indicate improved persistence of these constructs.

As shown in fig. 56A-56J, the same additional anti-CD 70 CAR tested in fig. 55A-55M was tested with NK cells from the donor 454. CD70 knockout NK cells from donor 454 were transduced to express constructs NK77.11, NK77.16, NK77.17, NK77.31 and NK77.44, with NK71 as positive control. Flow cytometry plots detecting anti-CD 70 CAR (APC-anti FLAG) and loss of CD70 expression (PE-anti CD 70) showed robust expression of CAR and negligible presence of cd70+ cells (fig. 56A). These CAR NK cells were subjected to cytotoxicity assays against 786-O cells at different E: T ratios and ECs were calculated ₅₀ (FIGS. 56B-56C). In agreement with that observed with donor 451 (FIGS. 55B-55C), EC of NK77.11, NK77.16, NK77.17 and NK77.31 ₅₀ EC generally lower than NK71 ₅₀ While NK77.44 is higher. These CAR NK cells were further subjected to time course cytotoxicity assays at an E: T ratio of 1:2 (fig. 56D-56E), 1:4 (fig. 56F-56H), or 1:8 (fig. 56I-56J). For the 1:2 ratio, NK cell cultures were re-stimulated with additional tumor cells on day 6 and cytotoxicity measurements were performed until day 10 (fig. 56E). As shown in fig. 55, the CAR construct resulted in cytotoxicity relative to the negative control. Construct NK77.11 generally still performed well, but in some cases construct NK77.17 resulted in even greater cytotoxicity. In longer time period testing using re-challenge, control NK71 did not perform as well as figures 55G and 55M, with most of the CARs tested being more cytotoxic both before and after re-challenge. This variability may be due to NK cell donor sources tested or variable CAR transduction.

As shown in fig. 57A-57H, CAR NK cells from donor 451 (shown in fig. 55) were subjected to additional cytotoxicity assays. All CARs tested in fig. 55 (NK 77.11, NK77.16, NK77.17, NK77.31, NK 77.44) were tested. Cytotoxicity against ACHN cells was tested at an E: T ratio of 1:2 (fig. 57A-57E) or 1:4 (fig. 57F-57H). Cytotoxicity of the CARs tested was consistent with that shown in figure 55.

As shown in fig. 58A-58H, CAR NK cells from donor 454 (shown in fig. 56) were subjected to additional cytotoxicity assays. All CARs tested in fig. 56 (NK 77.1, NK77.16, NK77.17, NK77.31, NK 77.44) were tested. Cytotoxicity against ACHN cells was tested at an E: T ratio of 1:4 (fig. 58A-58E) or 1:8 (fig. 58F-58H). Cytotoxicity of the CARs tested was consistent with that shown in figure 56.

As shown in fig. 59A-59D, NK cells from donor 451 were transduced to express the 10 anti-CD 70 CARs shown in fig. 50G and the genes were edited to lose expression of CD 70. Constructs NK77.11, NK77.16, NK77.17, NK77.31, NK77.44, NK77.55, NK77.58, NK77.65, NK77.71, NK77.73 were tested and NK71 served as positive control. These CAR constructs were also tested in the previous experiments provided in this example. Flow cytometry plots detecting anti-CD 70 CAR (APC-anti FLAG) and loss of CD70 expression (PE-anti CD 70) showed expression and negligible presence of cd70+ cells for each of the 10 CARs tested (fig. 59A). The high frequency and low cd70+ abundance of CAR transduction suggests that transduced NK cells killed any remaining cd70+ cells that were unsuccessful or incomplete in CD70 knockout (fig. 59B). Measurement of the original MFI indicated that although transduction was very efficient, the relative expression levels/cells of each CAR might be different (fig. 59C). CAR NK cells were subjected to cytotoxicity assays against 786-O cancer cells at different Et ratios, and ECs were calculated ₅₀ . Although the EC is calculated ₅₀ There was some variability compared to previous experiments (e.g. EC of NK77.44 ₅₀ Here, it appears to be competitive, but higher in fig. 55C and 56C), but this suggests that these selected anti-CD 70 CARs confer cytotoxic activity relative to the negative control.

As shown in fig. 60A-60O, NK cells from donor 451 as shown in fig. 59 with 10 anti-CD 70 CARs were subjected to additional cytotoxicity assays. Cytotoxicity was tested at an E:T ratio of 1:2 for 786-O (FIGS. 60A-60D), 1:2 for ACHN (FIGS. 60E-60H), 1:4 for 786-O (FIGS. 60I-60L), or 1:4 for ACHN (FIGS. 60M-60P). All CARs tested conferred cytotoxicity compared to the negative control. Based on these cytotoxicity assays, the anti-CD 70 CAR constructs NK77.11, NK77.16, NK77.17, NK77.31, NK77.58, NK77.71 generally showed greater cytotoxicity compared to the NK71 CAR control. In contrast, NK77.55, NK77.65 and NK77.73 perform less well than NK71, and NK77.44 has some variability in this regard.

As shown in fig. 61A-61O, NK cells from another donor (denoted donor 512) were transduced to express anti-CD 70 CAR and were genetically edited to lose expression of CD 70. Flow cytometry plots showed a lower percentage of NK cells expressing CD70 after transfection of the CD 70-directed CRISPR/Cas9 knockout construct (fig. 61A). All 10 CAR constructs observed in fig. 50G (NK 77.11, NK77.16, NK77.17, NK77.31, NK77.44, NK77.55, NK77.58, NK77.65, NK77.71, NK 77.73) were tested and NK71 served as positive control. The flow cytometry plots showed robust expression of CAR and negligible presence of cd70+ cells (fig. 61B). The high frequency and low cd70+ abundance of CAR transduction suggests that transduced NK cells killed any remaining cd70+ cells that were unsuccessful or incomplete in CD70 knockout (fig. 61C). Measurement of the original MFI indicated that although transduction was very efficient, the relative expression levels/cells of each CAR might be different (fig. 61D). CAR persistence as a function of time was tested for CAR NK cell populations with NK77.11, NK77.16, NK77.17, NK77.58 and NK 77.71. Over a period of three weeks, these tested CARs were robustly maintained, while NK71 controls experienced some reduction in expression over the same length of time (fig. 61E-61J). In the cytotoxicity assays, the NK constructs NK77.11, NK77.16, NK77.17, NK77.58 and NK77.71 tested in donor 512NK cells all exhibited greater cytotoxicity against 786-O cells (FIG. 61K-FIG. 61L) or ACHN cells (FIG. 61M-FIG. 61N) at E:T ratios of 1:2 or 1:4 relative to NK71 control and negative control. These anti-CD 70 CAR constructs are the most well-performing constructs in the previous embodiments disclosed herein.

As shown in fig. 62A-62B, NK cell viability was not affected by expression of the anti-CD 70 CAR construct. NK cells from donor 451 or 512 transduced with anti-CD 70 constructs NK77.11, NK77.16, NK77.17, NK77.58 or NK77.71 were cultured over a 5 week time span and total viable cells were quantified weekly. NK cells expressing anti-CD 70 CAR persisted in comparison to control cells (fig. 62A-62B).

As shown in fig. 63A-63B, NK cells from donor 512 (seen in fig. 61 and 62) were genetically edited to knock out CD70 and optionally CISH, transduced with an anti-CD 70 CAR construct, and subjected to cytotoxicity assays. Constructs NK77.17, NK77.58 and NK77.71 were tested. Cytotoxicity against 786-O cells (FIG. 63A) or ACHN cells (FIG. 63B) was tested at an E:T ratio of 1:8. Each anti-CD 70 CAR construct effectively confers NK cell tumor cytotoxicity. These data demonstrate that anti-CD 70 CAR expressing cells according to several embodiments disclosed herein are effective in controlling and/or reducing tumor cell growth. According to several embodiments, gene editing (e.g., CISH editing) of cells expressing the anti-CD 70 CAR further enhances one or more aspects of the engineered cells, including, but not limited to, cytotoxicity and/or persistence.

Example 7-further screening and related characterization of anti-CD 70CAR

Additional experiments were conducted to further evaluate the characteristics of cells engineered to express anti-CD 70CAR and edited to knock out CD70 expression and optionally further edited with respect to one or more additional editing targets (e.g., CISH) disclosed herein. As a non-limiting example, donor-derived NK cells are used for engineering and editing as described herein.

Initially, NK cells engineered and edited in accordance with embodiments disclosed herein were traced over time in two respects—first the target binding capacity of the expressed CD70CAR over time and the durability of CD70 knockdown over time, that is, durability of engineering and editing. Figure 64A shows data for NK cells of the first donor with respect to the ability of the CD70CAR to bind to naturally occurring CD70 trimers. As shown, the control NK cells (EPNTs) electroporated only showed essentially zero trimer binding (see trimer below 64A right + panel 2). In contrast, each of the NK cell populations expressing the non-limiting CD70CAR construct showed robust binding to trimers. The evaluation was performed 1 week after transduction of the cells with the CAR construct. Fig. 64B shows the corresponding data from the second donor. Figures 64C and 64D provide a table depicting summary data for each CAR construct, where the data is presented as both the percentage of cells expressing CARs that bind CD70 trimer (in the whole CD70 cell population evaluated) and as MFI values. Considering the flow cytometry scatter plot, numerical data confirm the expression of CARs capable of binding to their targets one week after transduction. Fig. 64E and 64F graphically illustrate this data, with CAR constructs NK77.71, 77.11, and 77.16 showing the highest ability to bind to their targets.

Turning to the knockout of CD70, fig. 64G shows that for donor one, endogenous CD70 expression was near zero for all experimental groups compared to the EPNT control. Fig. 64H demonstrates the same effect of donor two. Figures 64I and 64J show numerical data for CD70 expression, both expressed as a percentage of the total NK cell population expressing CD70 and MFI. As shown, CD 70-edited cells expressing any non-limiting example of a CD70 CAR expressed a greatly reduced amount of CD70 compared to the unedited eprt CD70 control for both donors.

Figure 65A shows data relating to cells of the first donor two weeks after transduction in terms of their ability to bind to native CD70 trimer. As observed 1 week after transduction, the ability of CAR-expressing cells to bind to the target was significant compared to EPNT cells and even to NK 71-expressing cells. For the second donor, a similar maintenance of binding capacity is shown in figure 65B. These data for each donor are listed in fig. 65C and 65D, both expressed as a percentage of NK cell populations expressing CARs that bind to the natural CD70 trimer and based on the MFI detected. Fig. 65E and 65F graphically depict this summary data for each donor, with CAR constructs NK77.71, 77.11, and 77.16 again showing the highest ability to bind their targets.

Turning to the knockout of CD70, fig. 65G shows that for donor one, endogenous CD70 expression was near zero for all experimental groups compared to the EPNT control. Fig. 65H demonstrates the same effect of donor two. Figures 65I and 65J show numerical data for CD70 expression, both expressed as a percentage of the total NK cell population expressing CD70 and MFI. As shown, CD 70-edited cells expressing any non-limiting example of a CD70 CAR expressed a greatly reduced amount of CD70 compared to the unedited eprt CD70 control for both donors.

Figure 66A shows data relating to cells of the first donor three weeks after transduction in terms of their ability to bind to native CD70 trimer. As observed at 1 and 2 weeks post transduction, the ability of CAR expressing cells to bind to the target was significant compared to EPNT cells and even to NK71 expressing cells. For the second donor, a similar maintenance of binding capacity is shown in fig. 66B. These data for each donor are listed in fig. 66C, both expressed as a percentage of NK cell populations expressing CARs that bind to the natural CD70 trimer and based on the MFI detected. Fig. 66D and 66E graphically depict this summary data for each donor, with CAR constructs NK77.71, 77.11, and 77.16 again showing the highest ability to bind their targets.

Turning to the knockout of CD70, fig. 66F shows that for donor one, endogenous CD70 expression was near zero for all experimental groups compared to the EPNT control. Fig. 66G demonstrates the same effect of donor two. Figures 66H and 66I show numerical data for CD70 expression, both expressed as a percentage of the total NK cell population expressing CD70 and MFI. As shown, CD 70-edited cells expressing any non-limiting example of a CD70 CAR expressed a greatly reduced amount of CD70 compared to the unedited eprt CD70 control for both donors.

Figure 67A shows data relating to cells of the first donor four weeks after transduction in terms of their ability to bind to native CD70 trimer. As observed at 1 week, 2 weeks and three weeks post transduction, the ability of CAR expressing cells to bind to the target was significant compared to EPNT cells and even to NK71 expressing cells. For the second donor, a similar maintenance of binding capacity is shown in figure 67B. These data for each donor are listed in fig. 67C and 67D, both expressed as a percentage of NK cell populations expressing CARs that bind to the natural CD70 trimer and based on the MFI detected. Fig. 67E and 67F graphically depict this summary data for each donor, with CAR constructs NK77.71, 77.11, and 77.16 (and 77.58) again showing the highest ability to bind their targets.

Turning to the knockout of CD70, fig. 67G shows that for donor one, endogenous CD70 expression was near zero for all experimental groups compared to the EPNT control. Fig. 67H demonstrates the same effect of donor two. Figures 67I and 67J show numerical data for CD70 expression, both expressed as a percentage of the total NK cell population expressing CD70 and MFI. As shown, CD 70-edited cells expressing any non-limiting example of a CD70 CAR expressed a greatly reduced amount of CD70 compared to the unedited eprt CD70 control for both donors.

Figure 68A shows data relating to cells of the first donor five weeks after transduction in terms of their ability to bind to native CD70 trimer. As observed from 1 to 4 weeks after transduction, the ability of CAR-expressing cells to bind to the target was significant compared to EPNT cells and even to NK 71-expressing cells. For the second donor, a similar maintenance of binding capacity is shown in figure 68B. These data for each donor are listed in fig. 68C and 68D, both expressed as a percentage of NK cell populations expressing CARs that bind to the natural CD70 trimer and based on the MFI detected. Fig. 678 and 68F graphically depict this summary data for each donor, with CAR constructs NK77.71, 77.11, and 77.16 again showing the highest ability to bind their targets.

Turning to the knockout of CD70, fig. 68G shows that for donor one, endogenous CD70 expression was near zero for all experimental groups compared to the EPNT control. Fig. 68H demonstrates the same effect of donor two. Figure 68I shows numerical data for CD70 expression, both expressed as a percentage of the total NK cell population expressing CD70 and MFI. As shown, CD 70-edited cells expressing any non-limiting example of a CD70 CAR expressed a greatly reduced amount of CD70 compared to the unedited eprt CD70 control for both donors.

Figure 69A shows data relating to cells of the first donor seven weeks after transduction in terms of their ability to bind to native CD70 trimer. As observed from 1 week to 5 weeks after transduction, the ability of CAR-expressing cells to bind to the target was significant compared to EPNT cells and even to NK 71-expressing cells. For the second donor, a similar maintenance of binding capacity is shown in fig. 69B. These data for the two donors are listed in figure 69C, both expressed as a percentage of NK cell populations expressing CARs that bind to the natural CD70 trimer and based on the MFI detected. Fig. 69D and 69E graphically depict this summary data for each donor, with CAR constructs NK77.71, 77.11, and 77.16 again showing the highest ability to bind their targets.

Turning to the knockout of CD70, fig. 69F shows that for donor one, endogenous CD70 expression was near zero for all experimental groups compared to the EPNT control. Fig. 69G demonstrates the same effect of donor two. Figure 69H shows numerical data for CD70 expression, both expressed as a percentage of the total NK cell population expressing CD70 and MFI. As shown, CD 70-edited cells expressing any non-limiting example of a CD70 CAR expressed a greatly reduced amount of CD70 compared to the unedited eprt CD70 control for both donors.

Figures 70A-70B show data relating to CAR expression (in terms of MFI) during 7 weeks after transduction of the indicated non-limiting CAR construct. These data confirm that the selected non-limiting CAR constructs exhibit increased CAR expression compared to the control. Importantly, as with the previous figures, this is also the expression of a functional CAR (as indicated by CD70 trimer binding). Thus, according to several embodiments, the CAR constructs as disclosed herein exhibit durable expression and function in culture for an extended period of time. Advantageously, in several embodiments, such stable expression imparts an extended functional lifetime in vivo to the CAR-expressing cells (e.g., NK cells), which in turn facilitates longer effective treatment of the CAR-directed tumor.

Additional data characterizing CAR-expressing cells were collected. NK cells expressing the indicated anti-CD 70 CAR construct (and also edited to knock out endogenous CD70 expression) were co-cultured with 786-O tumor cells or ACHN tumor cells at the indicated E: T ratio (as in the experimental set-up discussed elsewhere herein) on day 14 after the start of the cell production process (e.g., electroporation for gene editing followed by transduction with vectors encoding the particular CAR construct) and again on day 28 after the start of the cell production process. After 3 days of co-culture, the concentration of the selected cytokines in the medium was assessed. FIG. 71A shows the level of interferon gamma in the medium with co-cultures of 786-O (FIG. 71A) or ACHN (FIG. 71B) cells. As shown, cytokine release levels increased in the 14 day cell batch and interferon production decreased over time until day 28. Even 28 days after the start of the cell production process, certain CAR constructs (e.g., NK 77.71) induced release of relatively elevated levels of interferon gamma, particularly compared to ACHN cells or electroporation negative controls. Fig. 71C-71D show corresponding data for the second donor tested, which has a similar overall interferon gamma release profile, since there is a trend of decreasing interferon production as the cells remain in culture longer, but in most arrays the extent of release is still higher than the control.

FIGS. 71E-71F show data relating to the detection of GM-CSF at the same time points as described above. Interestingly, the edited and engineered NK cells showed a trend towards increased GMCSF production over time, with most constructs tested resulting in elevated levels of GMCSF at day 28 compared to the corresponding point at day 14. There was some amount of GMCSF produced de novo from 786-O and ACHN cells themselves, but these levels were constant over time, indicating that GMCSF release was likely induced by co-culture with tumor cells and reflected in NK cell cytotoxic activation. Fig. 71G-71H show corresponding data for the second donor tested, with similar overall GMCSF release profile.

FIGS. 71I-71J show data relating to TNFα levels in medium from donor one after co-cultivation as described above. In this experiment, tnfα levels generally increased between 14 and 28 days, but some CAR expressing cells remained more stable between the two time points. Donor two had similar data, at least with respect to tnfα release during co-culture with ACHN cells. The overall trend of tnfα release in donor two was declining between the 14 and 28 day time points. In several embodiments, this may be an artifact of the overall cytokine environment in the co-culture, as an increase or decrease in only one cytokine alone may be explained based on a corresponding increase or decrease in the other cytokines.

Similar changes in cytokine production profiles are also shown in fig. 71M-71N (donor one, perforin release) and fig. 71O-71P (donor two, perforin release). While donor one showed a clear trend to increase perforin release over time of culture (for both tumor cell types), donor two showed an overall trend to decrease perforin release between 14 and 28 day time points. As discussed above with respect to tnfα, the overall cytokine release profile is one aspect of the overall cytotoxic effect of a given cell deliverer, and there is variability between donors in the profile of any individual given cytokine exhibited by an individual cell batch.

FIGS. 71Q-71R (donor one) and FIGS. 71S-71T (donor two) relate to granzyme B production at two co-cultivation time points. In general, granzyme B levels remained stable or increased between 14 and 28 day time points for both donors and for both types of tumor cells. Taken together, these data demonstrate that edited and engineered immune cells (e.g., NK cells) retain the ability to release cytotoxic cytokines even after approximately 1 month of culture, indicating that gene editing (e.g., gene knockout) is stable, CAR expression is stable, and CAR function is stable. Together, these confer enhanced persistence and cytotoxicity to edited and engineered cells, resulting in a more effective cellular immunotherapy product.

In several embodiments, more than one gene edits are made. For example, in some embodiments, endogenous genes are knocked out, which improves survival of the edited cells, such as removal of expression of markers or proteins that overlap with tumor markers (e.g., CD 70) that are targets. In several embodiments, other genes are also edited. In several embodiments, CISH is edited (as discussed in more detail above). In several embodiments, multiple edits act through enhanced signaling or interrupted signaling along one or more non-redundant pathways to enhance viability, persistence, and/or cytotoxicity of the resulting immune cells. Figures 72A-72B show data relating to in vitro persistence of cells edited for CD70 and CISH knockouts and expressing anti-CD 70 CAR as measured by the percentage of cell population expressing CAR (figure 72A) and by the overall MFI detected (figure 72B). These edited and engineered cells showed enhanced persistence in culture compared to control cells (electroporated, but not transduced with CAR) and increased CAR expression levels significantly over time (week 1 time point was two weeks post transduction, 20 days post electroporation). Whichever method was used to measure expression, the indicated CAR constructs were expressed relatively stably in culture for 8 weeks, indicating persistence of expression. Not only is expression stable over time, additional editing of CISH confers increased survival to the edited cells. Figure 72C shows the longitudinal viability data over 8 weeks of culture (assessed at 0 week (culture start), 4 weeks and 8 weeks). As shown on total cell count, cells further edited to knock out CISH (substantially or completely eliminate CIS protein expression) showed improved survival compared to cells edited for CD70 (right panel). This is consistent with several embodiments disclosed herein, wherein the plurality of edits increases synergistic improvements to one or more features of the edited cells.

Turning to cytotoxicity of various anti-CD 70 CAR expressing cells, figure 72D shows the cytotoxicity profile of one donor cell against 786-O tumor cells (experimental setup discussed elsewhere herein). From the data, it can be observed that the addition of any CAR construct resulted in a dramatic decrease in tumor cell numbers. The cells tested (edited CD70 and in paired groups double edited for CD70 and CISH) showed a CISH editing-dependent overall cytotoxicity increase at the time point of the final measurement. Thus, in several embodiments, immune cells (such as NK cells) are double-edited (or edited at a greater number of targets) to knock out CISH and another endogenous target (here CD70 as a non-limiting example), where CISH editing imparts enhanced function (e.g., persistence and/or cytotoxicity) to the resulting cells. Fig. 72E summarizes the cytotoxicity curve data in a histogram, which depicts detection of tumor cell fluorescence signals at the final time point. Cells edited by CD70 are shown in the left panel, while cells double edited (CD 70 and CISH) are shown in the right panel. Each of the matched pairs showed a decrease in the presence of tumor cells with additional editing of CISH, suggesting that CISH knockout by gene editing enhanced cytotoxicity of such edited NK cells expressing a cytotoxic CAR.

Figures 72F and 72G show data relating to edited cells tested at 1:4e:t on day 14 after initiation of the cell production process against ACHN or 786-O cells. Data at the final time point are shown, but data at the intermediate point are not shown (e.g., no cytotoxicity curve is shown). The corresponding data for the 1:8E:T ratio are shown in FIGS. 72H-72I. Regardless of whether ET is high or low, the data repeatedly show that editing for knockout CISH results in a modest to significant further increase in cytotoxicity for a given NK cell population editing for CD70 knockout and expressing anti-CD 70 CAR.

Genetically edited and engineered immune cells (e.g., NK cells) were assayed in a re-stimulated format, as performed in several previous examples, with experimental cells introduced into new doses of tumor cells at intermediate time points during co-culture. FIG. 72J shows the re-excitation data for ACHN cells at 1:4E:T, while 72K shows the corresponding data for 786-O cells (day 14 after the start of the cell production process). Consistent with the data described immediately above, additional edits to CISH resulted in modest to significant increases in cytotoxicity (as measured by residual tumor cell signaling at the last time point). Fig. 72L and 72M show the corresponding data for the 1:8e:t ratio for each target tumor cell type. At lower effector cell ratios, the decrease in tumor cell numbers was consistent in the first part of the experiment, but after re-excitation, the number of tumor cells tended to increase. However, despite this trend, CISH knockout editing again resulted in relatively consistent cytotoxicity enhancement in experimental pairs.

Additional cytotoxicity assays were performed at longer time points, particularly at day 21 and day 28 after the initiation of the cell-production process of editing CD70 and editing or non-editing for CISH followed by transduction with the indicated non-limiting CAR construct. The re-excitation form is also used herein. Summary data (no cytotoxicity curves shown) are provided for the time points prior to re-excitation and the final time points. FIGS. 72A and 73B show data for indicated CD70-CAR constructs expressed by NK cells (initial co-culture 21 days after initiation of the cell production process) and measured cytotoxicity against 786-O cells after co-culture at a 1:4 (FIG. 73A) or 1:8 (FIG. 73B) E: T ratio for 72 hours. While significant differences between all constructs were difficult to discern among those yielding the most significant cytotoxicity, the positive effects of CISH editing could be observed in those constructs that were less cytotoxic (note that all CD70CAR expressing cells were significantly more potent than control cells). For example, the NK77.17 construct exhibited a decrease in the signal detected between the unedited population (histogram bar 1 in fig. 73A) and the CISH-edited population (histogram bar 5 in fig. 73A). At reduced effector cell concentrations (fig. 73B), overall stabilization of the signal detection to a decreasing trend (indicating increased cytotoxicity) was observed.

Fig. 73C and 73D show the corresponding data collected 6 days after re-excitation. As shown at the 1:4 and 1:8e:t ratios, gene editing for knockout CISH resulted in a significant reduction of tumor cells at either ratio tested. With the introduction of fresh tumor cells, this increase in cytotoxicity is particularly pronounced in the case of CISH editing in a re-excitation environment, and the edited cells are still able to significantly inhibit the growth of tumor cells.

FIGS. 73E and 73F show data of NK cells (edited or unedited) and ACHN cells at a ratio of 1:4 (FIG. 73E) or 1:8 (FIG. 73F) E:T for 72 hours after initiation of co-culture (21 days after initiation of the cell production process). Like the 786-O cells discussed above, CISH editing did not show significant changes in those constructs that were already fairly robust in cytotoxicity. Also, NK77.17, which allowed more tumor growth than other CAR constructs, showed a significant decrease in signal (enhanced cytotoxicity) at least in this experiment with editing for knockout CISH. At lower 1:8E:T, increased cytotoxicity was observed for each test construct (except for the internal control NK 71). Fig. 73G and 73H show data collected at the last time point of 6 days after re-excitation. CISH knockdown resulted in a significant reduction in tumor burden at the final time point in each case, observed at both 1:4 and 1:8E:T ratios. These data, in combination with other data discussed herein, demonstrate the positive impact of CISH editing on persistence and cytotoxicity of cells so edited.

Turning to cell testing 28 days after initiation of the cell production process, figures 74A-74B show data for NK cells expressing CD70 CAR against 786-O cells indicated at a 1:4 or 1:8e:t ratio. As with cells on day 21, the highly potent nature of NK cells tended to mask some positive CISH editing effects at 1:4, but construct 77.71 and internal control NK71 showed further enhanced cytotoxicity in the case of CISH editing. The effect of CISH editing was more pronounced at the 1:8 ratio, with a more pronounced reduction in tumor cell growth observed with the 77.71 and NK71 constructs. A more pronounced positive effect of CISH was detected 6 days after re-excitation. All tested constructs showed a stable pattern (77.17) or further increase in cytotoxicity in case of CISH editing (77.58, 77.71 and NK 71) using 1:4e:t. Likewise, a similar pattern was observed at a lower 1:8E:T ratio, indicating that CISH editing imparts an enhanced effect.

Fig. 74E and 74F show the corresponding data prior to re-excitation with ACHN cells. Each non-limiting construct tested showed robust cytotoxicity at 1:4e:t, but CISH editing did further enhance cytotoxicity of NK771.71 and NK71 constructs. At 1:8E:T, CISH edits summarize the enhanced cytotoxicity in both constructs, while the other two remain relatively stable. After re-excitation, a similar pattern was recorded. In this non-limiting experiment, CISH editing enhanced cytotoxicity of both constructs before and after re-excitation, consistent with several embodiments disclosed herein. In some embodiments, the combination of CD70 editing and CISH editing with expression of an anti-CD 70 CAR results in significantly enhanced persistence and/or cytotoxicity of the cells so edited and engineered.

Fig. 75A and 75B show data relating to indels (insertions or deletions) frequency, as measured in the population of ontologies edited for CISH (fig. 75A) or CD70 (fig. 75B). These data indicate that random indels are less frequent and that editing of CISH results in much higher indels detection in DNA regions where editing based on complementary guide RNAs is expected. With respect to CD70, edits were detected in both CISH-edited and non-CISH-edited cell populations, as both were with respect to CD70 editing. An increase in indel frequency is observed with additional CISH editing, which in some embodiments is related to CISH editing that causes an increased number of CD70 editing events. However, in several embodiments, the effect of CISH editing is not directly affecting CD70 editing events, but rather the result of enrichment of doubly edited cells over time after editing and transduction with CD70 CAR. In other words, cells edited for CISH will have increased cytotoxicity (as shown in the data above), and cells edited for CD70 will be more robustly protected from suicide due to CD70 CAR expression. Thus, double knockout cells are enriched in the population over time, as compared to cells that are not proceeding against CD70 (which would be reduced due to CD70 CAR-based autopsy). Regardless, in several embodiments, dual editing provides multiple benefits (enhanced viability, persistence, and/or cytotoxicity) to the edited and engineered cells.

Assessing CD70 editing is a relatively simple task because endogenous CD70 is expressed on the surface of NK cells. Thus, flow cytometry or other similar methods may be used to detect the extent of successful editing of CD70 in a cell population. As a mechanism to analyze the effect of editing on CISH (an intracellular protein), alternative methods were evaluated. Fig. 75C depicts a schematic of CISH signaling. Since CISH encodes CIS proteins that act as negative regulators of STAT5/JAK signaling, knockout of CISH will inhibit this pathway, leading to an increase in STAT5 phosphorylation, which can then be detected, for example, by western blotting or intracellular staining followed by flow cytometry. For example, figure 75D shows western blotting for phosphorylated Stats5 using proteins isolated from cells expressing NK77.71 CAR construct, editing for CD70, expressing CD70 CAR, and not editing for CISH or editing for CISH (represented by "CISH" indicators). Fig. 75E and 75F show two sets of normalized data. Fig. 75E shows data normalized to the intensity of the bands on western blots corresponding to electroporation control Signals (EPs). Fig. 75F shows the normalized data for the EP control (but set to a value of 1). By either analysis, these data indicate that editing CISH results in an increase in phosphorylated Stat 5. Thus, in several embodiments, the extent of pStat5 present in cells edited for CISH is further analyzed as an alternative to assessing CISH directly at the genomic level.

It is contemplated that various combinations or sub-combinations of the specific features and aspects of the above-disclosed embodiments can be made and still fall within one or more of the inventions. Furthermore, the disclosure herein regarding any particular features, aspects, methods, features, qualities, attributes, elements, etc. associated with an embodiment may be used in all other embodiments set forth herein. Thus, it should be understood that various features and aspects of the disclosed embodiments can be combined with or substituted for one another in order to form varying modes of the disclosed invention. Therefore, the scope of the invention disclosed herein should not be limited by the particular disclosed embodiments described above. Furthermore, while the invention is susceptible to various modifications and alternative forms, specific examples thereof have been shown in the drawings and are herein described in detail. It should be understood, however, that the invention is not to be limited to the particular forms or methods disclosed, but to the contrary, the invention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the various embodiments described and the appended claims. Any of the methods disclosed herein need not be performed in the order described. The methods disclosed herein include certain actions taken by a practitioner; however, they may also explicitly or implicitly include any third party indication of those actions. In addition, where features or aspects of the present disclosure are described in terms of Markush groups (Markush groups), those skilled in the art will recognize that the present disclosure is thus also described in terms of any individual member or subgroup of members of the Markush group.

The scope of the disclosure herein also includes any and all overlaps, sub-ranges, and combinations thereof. Languages such as "up to", "at least", "greater than", "less than", "between … …", and the like include the recited numbers. Terms such as "about" or "approximately" preceding a number include the recited number. For example, "about 90%" includes "90%". In some embodiments, at least 95% sequence identity or homology includes 96%, 97%, 98%, 99% and 100% sequence identity or homology to a reference sequence. Furthermore, when a sequence is disclosed as "comprising" a nucleotide or amino acid sequence, unless otherwise indicated, such reference shall also include, consist of, or consist essentially of the recited sequence. Any headings or sub-headings used herein are for organizational purposes and are not meant to be used to limit the scope of the embodiments disclosed herein.

All references cited herein, including but not limited to published and unpublished applications, patents and literature references, are incorporated herein by reference in their entirety and thereby form a part of this specification. To the extent that publications and patents or patent applications incorporated by reference contradict the disclosure included in the specification, the specification is intended to supersede and/or take precedence over any such contradictory material.

Sequence(s)

In several embodiments, amino acid sequences corresponding to any of the nucleic acids disclosed herein (and/or contained in the appended sequence listing) are provided, while accounting for the degeneracy of the nucleic acid code. Moreover, it is contemplated that sequences (whether nucleic acids or amino acids) other than those explicitly disclosed herein (and/or contained in the accompanying sequence listing) that have functional similarity or equivalence are also within the scope of the present disclosure. The foregoing include mutants, truncations, substitutions, codon optimization, or other types of modifications.

According to some embodiments described herein, any sequence may be used, or truncated or mutated forms of any sequence disclosed herein (and/or contained in the appended sequence listing) and in any combination may be used.

Claims

1. A population of genetically engineered Natural Killer (NK) cells for use in cancer immunotherapy, said population comprising:

a plurality of NK cells that have been expanded in culture,

wherein the plurality of NK cells are engineered to express a Chimeric Antigen Receptor (CAR) comprising a tumor binding domain, a transmembrane domain and a cytotoxic signaling complex,

wherein the tumor binding domain targets CD70,

Wherein the cytotoxic signaling complex comprises an OX-40 subdomain and a CD3 zeta subdomain,

wherein the NK cells are engineered to express membrane bound IL-15 (mbiL 15),

wherein the NK cells are genetically edited to express reduced levels of CD70 as compared to unedited NK cells that have been expanded in culture, and wherein the reduced CD70 expression is engineered by the editing of the endogenous CD70 gene.

2. The population of genetically engineered NK cells of claim 1, wherein the NK cells are genetically edited to express reduced levels of cytokine induced SH 2-Containing (CIS) protein encoded by CISH genes as compared to unedited NK cells.

Wherein the reduced CIS expression is engineered by editing CISH genes, and

wherein the genetically engineered NK cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target cells, and enhanced persistence as compared to NK cells expressing native levels of CIS.

3. The population of genetically engineered NK cells of claim 2 wherein said NK cells are genetically edited to express reduced levels of adenosine receptors,

Wherein the reduced expression of the adenosine receptor is achieved by editing a gene encoding the adenosine receptor, and wherein the genetically engineered NK cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target cells, and enhanced persistence as compared to NK cells expressing native levels of the adenosine receptor.

4. The population of genetically engineered NK cells of claim 1, wherein the tumor binding domain comprises a heavy chain variable region (VH), wherein the VH is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 1104, 1053, 1091, 1047, 1106, 1052, 1077, 1064, 1098, and 1088.

5. The population of genetically engineered NK cells of claim 1, wherein the tumor binding domain comprises a light chain variable region (VL), wherein the VL is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 1178, 1127, 1165, 1121, 1180, 1126, 1151, 1138, 1171 and 1162.

6. The population of genetically engineered NK cells of claim 1, wherein the tumor binding domain comprises a single chain variable fragment (scFv), wherein the scFv is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 104, 53, 91, 47, 106, 52, 77, 64, 98 and 88.

7. The population of genetically engineered NK cells of claim 1, wherein the tumor binding domain comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3, and wherein

The CDR-H1 comprises a sequence having at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 494, 443, 481, 437, 496, 442, 467, 454, 488 and 478;

the CDR-H2 comprises a sequence having at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 568, 517, 555, 511, 570, 516, 541, 528, 562 and 552;

the CDR-H3 comprises a sequence having at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 642, 591, 629, 585, 644, 590, 615, 602, 636 and 626;

The CDR-L1 comprises a sequence having at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 734, 683, 721, 677, 736, 682, 707, 694, 728, and 718;

the CDR-L2 comprises a sequence having at least 95% sequence identity to one or more sequences selected from the group consisting of SEQ ID NOs 808, 757, 795, 751, 810, 756, 781, 768, 802 and 792; and is also provided with

The CDR-L3 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs 882, 831, 869, 825, 884, 830, 855, 842, 876 and 855.

8. The population of genetically engineered NK cells of claim 1, wherein the tumor binding domain comprises a VH, wherein the VH comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 956, 905, 943, 899, 958, 904, 929, 916, 950, and 940.

9. The population of genetically engineered NK cells of claim 1, wherein the tumor binding domain comprises VL, wherein the VL comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 1030, 979, 1017, 973, 1032, 978, 1003, 990, 1024 and 1014.

10. The population of genetically engineered NK cells of claim 1, wherein the tumor binding domain comprises an scFv, wherein the scFv comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 296, 245, 283, 239, 298, 244, 269, 256, 290, 280.

11. The population of genetically engineered NK cells of claim 1, wherein the mbIL15 is bicistronic encoded on a polynucleotide encoding the CAR.

12. The population of genetically engineered NK cells of claim 11, wherein the polynucleotide encoding the CAR and the mbIL15 comprises a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 204, 153, 191, 147, 206, 152, 177, 164, 198 and 188.

13. The genetically engineered NK cell population of claim 1, wherein the CAR comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 379, 328, 366, 322, 381, 327, 352, 339, 373, and 363.

14. The population of genetically engineered NK cells of any one of claims 1 to 13, wherein said OX40 subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID No. 5.

15. The population of genetically engineered NK cells of any one of claims 1 to 14, wherein said cd3ζ subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID No. 7.

16. The population of genetically engineered NK cells of any one of claims 1 to 15, wherein said mbIL15 is encoded by a sequence having at least 95% sequence identity to SEQ ID No. 1188.

17. The population of genetically engineered NK cells of any one of claims 2-16, wherein expression of CIS is significantly reduced compared to NK cells not edited for CISH.

18. The population of genetically engineered NK cells of any one of claims 2-17, wherein said NK cells do not express detectable levels of CIS protein.

19. The population of genetically engineered NK cells of any one of claims 3-18, wherein the expression of the adenosine receptor is significantly reduced compared to NK cells not edited for the adenosine receptor.

20. The population of genetically engineered NK cells of any one of claims 3-18, wherein said NK cells do not express detectable levels of adenosine receptors.

21. The population of genetically engineered NK cells of claim 19 or 20, wherein the adenosine receptor comprises an A2A adenosine receptor, A2B adenosine receptor, A3 adenosine receptor, or A1 adenosine receptor.

22. The population of genetically engineered NK cells of claim 19, 20 or 21, wherein the adenosine receptor comprises an A2A adenosine receptor (A2 AR).

23. The population of genetically engineered NK cells of any one of claims 1 to 22, wherein said NK cells are further genetically edited to express reduced levels of transforming growth factor β receptor (TGFBR) compared to unedited NK cells.

24. The population of genetically engineered NK cells of any one of claims 1-23, wherein said NK cells are further genetically edited to express reduced levels of β -2 microglobulin (B2M) as compared to unedited NK cells.

25. The population of genetically engineered NK cells of any one of claims 1-24, wherein said NK cells are further genetically edited to express reduced levels of CIITA (class II major histocompatibility complex transactivator) as compared to unedited NK cells.

26. The population of genetically engineered NK cells of any one of claims 1-25, wherein said NK cells are further genetically edited to express reduced levels of natural killer group 2 member a (NKG 2A) receptor as compared to unedited NK cells.

27. The population of genetically engineered NK cells of any one of claims 1-26, wherein said NK cells are further genetically edited to express reduced levels of Cbl proto-oncogene B protein encoded by a CBLB gene as compared to unedited NK cells.

28. The population of genetically engineered NK cells of any one of claims 1-27, wherein said NK cells are further genetically edited to express reduced levels of a triple motif-containing protein 29 protein encoded by the TRIM29 gene as compared to unedited NK cells.

29. The population of genetically engineered NK cells of any one of claims 1-28, wherein said NK cells are further genetically edited to express reduced levels of a cytokine signaling inhibitor 2 protein encoded by the SOCS2 gene as compared to unedited NK cells.

30. The population of genetically engineered NK cells of any one of claims 1 to 29, wherein the gene editing for reduced expression or the gene editing for induced expression is performed using a CRISPR-Cas system.

31. The population of genetically engineered NK cells of claim 30, wherein the CRISPR-Cas system comprises Cas selected from Cas9, csn2, cas4, cpf1, C2C3, cas13a, cas13b, cas13C, casX, casY, and combinations thereof.

32. The population of genetically engineered NK cells of claim 31, wherein the Cas is Cas9.

33. The population of genetically engineered NK cells of any one of claims 1 to 28, wherein the CD70 gene is edited using one or more guide RNAs having at least 95% sequence identity to SEQ ID No. 121, SEQ ID No. 122 or SEQ ID No. 123.

34. The population of genetically engineered NK cells of any one of claims 2 to 29, wherein one or more guide RNAs having at least 95% sequence identity to SEQ ID No. 130, SEQ ID No. 131, SEQ ID No. 132, SEQ ID No. 133 or SEQ ID No. 134 are used to edit the CISH gene.

35. The population of genetically engineered NK cells of any one of claims 2 to 30, wherein the adenosine receptor gene is edited using one or more guide RNAs that have at least 95% sequence identity to SEQ ID No. 396, SEQ ID No. 397, or SEQ ID No. 398.

36. The population of genetically engineered NK cells of any one of claims 23 to 35, wherein said TGFBR2 gene is edited using one or more guide RNAs having at least 95% sequence identity to SEQ ID No. 130,SEQ ID NO:131,SEQ ID NO:132,SEQ ID NO:133 or SEQ ID No. 134.

37. The population of genetically engineered NK cells of any one of claims 1 to 29, wherein said gene editing for reduced expression or said gene editing for induced expression is performed using Zinc Finger Nucleases (ZFNs).

38. The population of genetically engineered NK cells of any one of claims 1 to 29, wherein said gene editing for reduced expression or said gene editing for induced expression is performed using a transcription activator-like effector nuclease (TALEN).

39. A method of treating cancer in a subject, the method comprising administering to the subject the population of genetically engineered NK cells of any one of the preceding claims.

40. The method of claim 39, wherein the cancer is renal cell carcinoma or metastasis of renal cell carcinoma.

41. The population of genetically engineered NK cells of any of the preceding claims for use in the treatment of cancer.

42. Use of a mixed population of immune cells according to any one of the preceding claims in the manufacture of a medicament for the treatment of cancer.

43. A method for treating cancer in a subject, the method comprising

Administering to the subject a population of genetically engineered immune cells, the population comprising:

a plurality of NK cells that have been expanded in culture,

wherein the tumor binding domain targets CD70,

wherein the chimeric antigen receptor comprises an OX40 subdomain and a CD3 zeta subdomain,

wherein the NK cells are engineered to express membrane bound IL-15 (mbiL 15),

44. The method of claim 43, wherein the NK cells are further genetically engineered to express reduced levels of cytokine induced SH 2-Containing (CIS) proteins encoded by CISH genes as compared to non-engineered NK cells, wherein the reduced CIS expression is engineered by the editing of CISH genes, and wherein the genetically engineered NK cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target cells, and enhanced persistence as compared to NK cells expressing native levels of CIS.

45. The method of claim 44, wherein said NK cells are genetically engineered to express reduced expression of an adenosine receptor, wherein said reduced adenosine receptor expression is achieved by editing a gene encoding said adenosine receptor, and wherein said genetically engineered NK cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target cells, enhanced persistence as compared to NK cells expressing natural levels of said adenosine receptor.

46. The method of any one of claims 43 to 45, wherein the tumor binding domain comprises a heavy chain variable region (VH), wherein the VH is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 1104, 1053, 1091, 1047, 1106, 1052, 1077, 1064, 1098 and 1088, and wherein the tumor binding domain comprises a light chain variable region (VL), wherein the VL is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 1178, 1127, 1165, 1121, 1180, 1126, 1151, 1138, 1171 and 1162.

47. The method of any one of claims 43-46, wherein the tumor binding domain comprises a single chain variable fragment (scFv), wherein the scFv is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 104, 53, 91, 47, 106, 52, 77, 64, 98 and 88.

48. The method of any one of claims 43-47, wherein the tumor binding domain comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3, and wherein

49. The method of any one of claims 43 to 48, wherein the tumor binding domain comprises a VH, wherein the VH comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 956, 905, 943, 899, 958, 904, 929, 916, 950, and 940, and wherein the tumor binding domain comprises a VL, wherein the VL comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 1030, 979, 1017, 973, 1032, 978, 1003, 990, 1024, and 1014.

50. The method of any one of claims 43-49, wherein the tumor binding domain comprises an scFv, wherein the scFv comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 296, 245, 283, 239, 298, 244, 269, 256, 290, 280.

51. The method of any one of claims 43 to 50, wherein the mbIL15 is bicistronic encoded on a polynucleotide encoding the CAR.

52. The population of genetically engineered NK cells of claim 51, wherein the polynucleotide encoding the CAR and the mbIL15 comprises a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs 204, 153, 191, 147, 206, 152, 177, 164, 198 and 188.

53. The method of any one of claims 43-52, wherein the CAR comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 379, 328, 366, 322, 381, 327, 352, 339, 373, and 363.

54. The method of any one of claims 43-53, wherein the OX40 subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID No. 5, wherein the CD3 zeta subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID No. 7, and wherein the mbIL15 is encoded by a sequence having at least 95% sequence identity to SEQ ID No. 1188.

55. The method of any one of claims 44 to 54, wherein expression of CIS is significantly reduced compared to NK cells not edited for CISH, and/or wherein the NK cells do not express detectable levels of CIS protein.

56. The method of any one of claims 48 to 55, wherein the expression of the adenosine receptor is significantly reduced compared to an NK cell not edited for the adenosine receptor, and/or wherein the NK cell does not express a detectable level of adenosine receptor.

57. The method of claim 56, wherein the adenosine receptor comprises an A2A adenosine receptor, an A2B adenosine receptor, an A3 adenosine receptor, or an A1 adenosine receptor.

58. The method of any one of claims 43 to 57, wherein the gene editing is performed using a CRISPR-Cas system, and wherein the Cas comprises a Cas9 enzyme.

59. A polynucleotide encoding an anti-CD 70 chimeric antigen receptor, wherein the CAR comprises an anti-CD 70 binding domain,

wherein the anti-CD 70 binding domain is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of SEQ ID NOS: 36-120, 221-229, 1038-1111, 1112-1185 and/or comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOS: 230-312, 890-963, 964-1037, or is capable of generating a portion of a cytotoxic signal upon binding with CD70 on a target cell;

The domain of OX40,

wherein the OX40 subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID NO. 5, an

The cd3ζ domain,

wherein said CD3ζ subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID NO. 7.

60. The polynucleotide of claim 59, further comprising a polynucleotide encoding mbIL15, wherein said mbIL15 is encoded by a sequence having at least 95% sequence identity to SEQ ID No. 1188.

61. The polynucleotide of claim 59 or 60, wherein one or more of SEQ ID NOs 38-120, 221-229, 1038-1111 or 1112-1185, the polynucleotide encoding OX40, the polynucleotide encoding CD3 ζ and the polynucleotide encoding mbIL15 are arranged in a 5 'to 3' direction within said polynucleotides.

62. A method of enhancing persistence of a population of immune cells for cancer immunotherapy, the method comprising:

identifying a target marker on the tumor to be treated,

determining whether a population of immune cells to be engineered to express a CAR that binds to the target marker also endogenously expresses the target marker;

editing the genome of the population of immune cells to disrupt the gene encoding the endogenous target marker, and

Engineering the population of immune cells to express the CAR,

wherein disruption of endogenous expression of the target marker by the immune cell reduces the ability of the CAR to bind to the endogenous target marker on the immune cell, thereby enhancing persistence of the population of immune cells.

63. The method of claim 62, wherein the immune cell is an NK cell, a T cell, or a combination thereof, wherein the target marker is CD70, and wherein the gene editing is performed using a CRISPR-Cas system.

64. The method of any one of claims 62 to 63, further comprising disrupting expression of a cytokine induced SH 2-Containing (CIS) protein encoded by a CISH gene using a CRISPR-Cas system, and/or further comprising disrupting expression of an adenosine receptor using a CRISPR-Cas system, wherein the adenosine receptor comprises an A2A adenosine receptor, an A2B adenosine receptor, an A3 adenosine receptor, and/or an A1 adenosine receptor.

65. An anti-CD 70 Chimeric Antigen Receptor (CAR), wherein the CAR comprises an anti-CD 70 binding domain, an OX40 domain, and a CD3 zeta domain,

wherein the anti-CD 70 CAR is encoded by a polynucleotide having at least 95% sequence identity to one or more of SEQ ID NOs 138-220.

66. An anti-CD 70 Chimeric Antigen Receptor (CAR), wherein the CAR comprises an anti-CD 70 binding domain, an OX40 domain, and a CD3 zeta domain,

wherein the anti-CD 70 CAR comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs 313-395, or a portion thereof capable of generating a cytotoxic signal upon binding to CD70 on a target cell.

67. An anti-CD 70 binding domain comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3, and wherein:

the CDR-H1 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 428-501;

the CDR-H2 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOs 502-575;

the CDR-H3 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOs 576-649;

the CDR-L1 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs 668-741;

the CDR-L2 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS 742-815; and is also provided with

The CDR-L3 comprises a sequence having at least 95%, 99% or 100% sequence identity to a sequence selected from SEQ ID NOS 816-889.

68. The anti-CD 70 binding domain of claim 67, wherein the heavy chain variable domain is encoded by a nucleic acid sequence having at least 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOs 1038-1111.

69. The anti-CD 70 binding domain of any one of claims 67-68, wherein the light chain variable domain is encoded by a nucleic acid sequence having at least 95%, 99% or 100% sequence identity to any sequence selected from SEQ ID NOs 1112-1185.

70. The anti-CD 70 binding domain according to any one of claims 67-69, wherein the anti-CD 70 binding domain is an antibody, fab 'fragment, F (ab') ₂ Fragments or scfvs.

71. A CAR comprising the anti-CD 70 binding domain of any one of claims 67 to 69.

72. The CAR of claim 71, further comprising an OX40 subdomain and a cd3ζ subdomain.

73. A cell comprising the anti-CD 70 binding domain of any one of claims 67 to 70 or the CAR of any one of claims 71 or 72.

74. The cell of claim 73, wherein the cell is an immune cell.

75. The cell of claim 73 or 74, wherein the cell is an NK cell.

76. The cell of any one of claims 73-75, wherein the cell is genetically edited to express reduced levels of CISH, adenosine receptor, A2A adenosine receptor, A2B adenosine receptor, A3 adenosine receptor, A1 adenosine receptor, A2AR, TGFBR, B2M, CIITA, NKG2A, CBLB, TRIM29, SOCS2, SMAD3, MAPKAPK3, CEACAM1, or DDIT4, or any combination thereof, as compared to an unedited cell.

77. A method of treating cancer in a subject, the method comprising administering to the subject the anti-CD 70 binding domain of any one of claims 67-70, the CAR of any one of claims 71 or 72, or the cell of any one of claims 73-76.

78. Use of an anti-CD 70 binding domain according to any one of claims 67 to 70, a CAR according to any one of claims 71 or 72, or a cell according to any one of claims 73 to 76 for treating cancer.

79. Use of an anti-CD 70 binding domain according to any one of claims 67 to 70, a CAR according to any one of claims 71 or 72, or a cell according to any one of claims 73 to 76 in the manufacture of a medicament for the treatment of cancer.

80. A population of genetically engineered Natural Killer (NK) cells for use in cancer immunotherapy, said population comprising:

a plurality of NK cells that have been expanded in culture,

wherein the plurality of NK cells are engineered to express a Chimeric Antigen Receptor (CAR) comprising a CD 70-targeting tumor binding domain, a transmembrane domain and a cytotoxic signaling complex,

81. A method of preparing a population of genetically engineered immune cells for use in cancer immunotherapy, the method comprising:

engineering a population of immune cells to express a CAR that binds a target marker, wherein at least a portion of the population of immune cells also endogenously expresses the target marker; and

editing the genome of the population of immune cells to disrupt the gene encoding the endogenous target marker,

wherein disruption of endogenous expression of the target marker by the immune cell reduces the ability of the CAR to bind to the endogenous target marker on the immune cell.