CN116769950A - Molecular markers closely linked to the major QTL for ear length in maize and its application - Google Patents

Abstract

The invention belongs to the field of biotechnology, and specifically relates to a molecular marker closely linked to a major QTL for corn ear length, its primers and applications. The molecular marker is located on the third chromosome of maize, and includes molecular marker M158 and molecular marker M0900; the nucleotide sequence of the molecular marker M158 is shown in SEQ ID NO. 21, and the nucleotide sequence of the molecular marker M0900 is as follows SEQ ID NO.24 is shown. The primer sequence for amplifying molecular marker M158 is: M158‑F: 5'‑CCGAGTGTGAGTGAGGACAA‑3'; M158‑R: 5'‑CACGTGGATTGGTTACGATG‑3'; the primer sequence for amplifying molecular marker M0900 is: M0900‑F: 5'‑ACGATGCATGGTTGGAGTTG‑3';M0900‑R:5'‑CCATCAAACAAAGTGGCCCA‑3'. The molecular markers provided by the invention are closely linked to the main QTL of corn ear length, and can be used in ear length molecular marker-assisted breeding, in the screening of ear length germplasm resources, and in the genetic improvement of corn ear length.

Description

Molecular markers closely linked to the major QTL for ear length in maize and its application

Technical field

The invention belongs to the field of biotechnology, and specifically relates to a molecular marker closely linked to the main QTL for corn ear length and its application.

Background technique

The role of corn is diverse. It is not only a food crop for human survival, but also a feed crop for the animal world. It is also an industrial product that promotes economic development. Therefore, the level of corn yield has an extremely important impact on my country's agricultural production. As an important part of the yield component of corn ear length, it is of great significance to study it. The yield of corn depends on the number of kernels per ear and the weight of the kernels. The number of rows per ear and the number of kernels in the rows determine the number of kernels per ear, and the development integrity of the kernels determines the kernel weight. Therefore, screening and identifying ear length germplasm resources is an important way to cultivate new high-yield corn varieties.

Conventional breeding methods for breeding panicle length germplasm resources have a long breeding cycle and low efficiency. However, molecular marker-assisted breeding shortens the breeding years, speeds up the breeding process, improves breeding efficiency, and overcomes many difficulties in conventional breeding methods. Molecular marker-assisted selection requires the selection of target trait genotypes with the help of molecular markers by analyzing the genotypes of molecular markers that are closely linked to the target gene.

Linkage analysis, also known as QTL mapping analysis, is based on the mutual combination of genotype and phenotype of the target trait, constantly looking for linkage markers associated with the target trait, and drawing a linkage genetic map through the integration of marker positions. The single-segment substitution system means that except for the target segment, the rest of the chromosome is identical to the receptor. The characteristics of the single segment substitution system (SSSL) are as follows: strong stability; the influence of the environment can be eliminated; there are fewer positioning considerations and the results are highly accurate.

Single-segment substitution lines are widely used for QTL mapping due to their high stability and low environmental impact. However, the resulting mapping range is large and molecular markers cannot be used in production. Therefore, it is necessary to develop a molecular marker closely linked to the target gene for genetic improvement of corn ear length.

Contents of the invention

The purpose of the present invention is to provide a molecular marker closely linked to the main QTL for corn ear length and its application. The molecular marker is closely linked to the main QTL for corn ear length and can be used in molecular marker-assisted breeding for corn ear length.

In order to achieve the above objects, the technical solutions adopted by the present invention are:

Molecular markers closely linked to the major QTL for ear length in maize. The molecular markers are located on the third chromosome of maize and are molecular markers M158 and M0900.

Preferably, the molecular marker M158 is located on the third chromosome of maize, the specific location is chr3: 231733871-231734353, and the molecular marker M0900 is located on the third chromosome of maize, the specific location is chr3: 232377659-232377854.

The primer sequence of the molecular marker that is closely linked to the major QTL for corn ear length and amplifies the molecular marker M158 is:

M158-F: 5’-CCGAGTGTGAGTGAGGACAA-3’ (sequence 1);

M158-R: 5’-CACGTGGATTGGTTACGATG-3’ (sequence 2);

The primer sequence for amplifying the molecular marker M0900 is:

M0900-F: 5’-ACGATGCATGGTTGGGAGTTG-3’ (sequence 3);

M0900-R: 5'-CCATCAAACAAAGTGGCCCA-3' (sequence 4).

Application of molecular markers closely linked to maize ear length major QTL in genetic improvement of maize ear length.

Preferably, the method for identifying corn ear length traits during molecular marker-assisted breeding for corn ear length includes the following steps:

Extract genomic DNA from corn leaves;

Using corn leaf genomic DNA as a template, use the primers M158-F/M158-R and M0900-F/M0900-R to perform PCR amplification respectively;

Agarose gel electrophoresis identification of PCR amplification results: When the primer used is M158-F/M158-R, when the size of the molecular marker M158 is detected to be 321bp, it means that the spike length of the sample to be tested is longer; when the detection If the size of the molecular marker M158 is found to be 502bp, it means that the ear length of the sample to be tested is shorter; when the primer used is M0900-F/M0900-R, when the size of the molecular marker M0900 is detected to be 215bp, it means that the length of the sample to be tested is short. The ear length of the sample to be tested is longer; when the size of the molecular marker M0900 is detected to be 205 bp, it means that the ear length of the sample to be tested is shorter.

Preferably, the PCR amplification system is 8 μL, and the components include: 2 μL DNA, 1 μL each of the left and right primers, and 4 μL 2×TaqMaster Mix (Norwegian P112).

Preferably, the Touchdown PCR amplification program is used: 95°C for 5 minutes; 95°C for 30 seconds, 65°C for 30 seconds, each cycle decreases by 1°C, and 72°C for 45 seconds, a total of 8 cycles; 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 45 seconds. A total of 28 cycles; 72°C for 10 minutes.

Compared with the prior art, the beneficial effects of the present invention are:

The molecular marker of the present invention is closely linked to the main QTL of corn ear length and is closely linked to the main QTL of corn ear length, and can be applied to ear length molecular marker-assisted breeding, to the screening of ear length germplasm resources, and to the genetics of corn ear length. Improvement.

Description of drawings

Figure 1 is a photo of mature fruit ears of Xu 178 and SSSL3 in Example 1, the scale bar is 1cm;

Figure 2 is the phenotypic analysis of mature fruit ears of Xu 178 and SSSL3 in Example 1;

Figure 3 is a molecular marker polyacrylamide gel electrophoresis pattern of Example 1;

Among them, A and B are the electropherograms of umc1639 and umc1136 respectively; the samples in lanes 1-4 in A and B are SSSL3, Xu 178, dominant pool and recessive pool respectively;

Figure 4 shows the initial positioning of the qEL3 gene in Example 1;

Figure 5 shows the fine positioning of qEL3 in Example 1.

Detailed ways

In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention will be further described below with reference to specific embodiments and drawings.

In the description of the present invention, unless otherwise specified, all reagents used are commercially available, and all methods used are common techniques in this field.

Example 1

This example provides the positioning process of the main QTL for corn ear length, as follows:

(1) Identification of spike length single segment substitution line SSSL3

1.1 Construction of maize single-fragment substitution line population

The experimental materials were selected from more than 150 homozygous single-fragment substitution lines constructed in the laboratory through multi-generation backcrossing and self-crossing using Xu 178 as the recipient parent and Zong 3 as the donor parent.

1.2 Field determination of panicle phenotypes in single-fragment substitution line populations

In 2013 and 2014, 150 copies of the single-fragment substitution line and its receptor material Xu 178 were planted in Junxian, Xinxiang and Xuchang, Henan. Set up 2 replicates for each material, with 2 rows per replicate, row length 4 meters, row spacing 0.65 meters, and plant spacing 0.25 meters. After mature harvest, the ear length and ear diameter of mature fruit ears are measured using a seed tester (Jetion), and the number of ear rows and row grain numbers of the fruit ears are manually counted.

1.3 Phenotypic analysis of mature fruit ears

Through two-year four-point field phenotyping, it was found that compared with the background material Xu 178, the single-segment substitution line SSSL3 had significantly increased panicle length and row number of grains, but no significant difference in panicle thickness and row number. The results are shown in Figure 2.

(2) Preliminary mapping of the main QTL qEL3 for corn ear length

2.1 Construction of positioning population: Use the single-segment substitution line SSSL3 as the female parent and cross it with Xu 178 to obtain F1 plants. The F1 plants are then backcrossed with Xu 178 to obtain the BC ₁ F ₁ population.

2.2 Phenotypic identification of panicle length: BC ₁ F ₁ population was constructed in Hainan in 2018, planted in 45 rows with a row length of 4 meters. The leaves of individual plants in the BC ₁ F ₁ population were sampled, DNA was extracted, and cryopreserved, and the individual plants were self-pollinated to retain seeds. In the spring of 2019, single selfed seeds (BC ₁ F ₂ ) were planted in Yuanyang, with 2 replicates, 2 rows per replicate, row length 4 meters, row spacing 0.65 meters, and plant spacing 0.25 meters. After mature harvest, the panicle length of the BC ₁ F ₂ population was tested, and the BC ₁ F ₁ single plant genotype was judged by the panicle length phenotype of the BC ₁ F ₂ population.

2.3DNA extraction and molecular marker development

Genomic DNA from corn leaves was extracted using the CTAB method and stored in a -20°C refrigerator for later use.

SSR markers: The laboratory currently has 1,000 pairs of SSR markers covering the entire maize genome (MaizeGDB (http://www.maizegdb.org/) database IBM).

InDel marker development: Use the Indel primers known in the laboratory to select the Indel within the interval for synthesis. The synthetic sequence is shown in Table 1.

2.4PCR procedures and genotype analysis of amplified products

The components of the PCR amplification system (8 μL) include: 2 μL DNA, 2 μL primers (1 μL each of the left and right primers), and 4 μL 2×TaqMaster Mix (Novizan P112). Use Touchdown PCR amplification program: 95℃ for 5min; 95℃ for 30s, 65℃ for 30s (each cycle decreases by 1℃), 72℃ for 45s, a total of 8 cycles; 95℃ for 30s, 58℃ for 30s, 72℃ for 45s, a total of 28 cycles Cycle; 72℃10min. The PCR amplification products were subjected to 6% polyacrylamide gel electrophoresis and 4% agarose gel electrophoresis for genotypic analysis.

2.5 Preliminary mapping of the main QTL for corn ear length

Extract the DNA of the parental material Xu 178 and the single-fragment substitution line material SSSL3 to form two parent pools. Select 10 single plants with dominant traits (long panicles) (Aa genotype single plants in the BC1F1 population) and 10 single plants with recessive traits (short panicles) (all aa in the BC ₁ F ₁ population) in the segregating population. Two near-isogenic line pools were formed by mixing equal amounts of DNA from each genotype (single plant). Genotype analysis was performed on the parent pool using 1,000 pairs of SSR markers covering the entire maize genome, and a total of 2 pairs of polymorphic molecular markers were screened, namely umc1639 and umc1136. The electrophoresis patterns of these two pairs of molecular markers are shown in Figure 2. Continue to develop markers and screen polymorphic molecular markers on the left side of 3.09bin. See Table 1 for molecular marker primer information.

Table 1 Screened 19 pairs of linked differential marker sequence information

The polymorphic molecular markers in Table 1 were used to analyze the genotypes of individual plants in the BC ₁ F ₁ population in 2015 and 2016. Combined with the phenotypes of the offspring of individual plants, the 106 exchanged individual plants were classified into 8 different types of recombinant individual plants (4 medium and 4 short panicle individual plants). Through cross-stack mapping, the target gene was located between the molecular markers Chr3.09-14 and Chr3.09-176 on chromosome 3, with a physical distance of 4.5Mb. The results are shown in Figure 4. In Figure 4, the white box represents the genome fragment from Xu 178, and the black box represents the fragment of SSSL3.

(3) Fine mapping of the main QTL qEL3 for corn ear length

3.1 Construction of positioning population: In the BC ₁ F ₁ population, the target segment is selected as a heterozygous single plant and self-crossed to construct the BC ₁ F ₂ population.

3.2 Phenotypic identification of panicle length: BC ₁ F ₂ population was planted in Sanya, Hainan in the winter of 2019, and individual plants were self-crossed to save seeds. In the spring and late summer of 2020, the seeds of single self-bred progeny were planted in Yuanyang, Xinxiang for phenotypic identification. Two replicates were planted, and each replicate was planted with 2 rows of 4 meters in length, with a row spacing of 0.65 meters and a plant spacing of 0.25 meters. Use a seed tester to measure the ear length of the harvested population, and use the population's ear length phenotype results to determine the BC ₁ F ₂ single plant genotype.

3.3DNA extraction and molecular marker development

Genomic DNA from corn leaves was extracted using the CTAB method and stored in a -20°C refrigerator.

InDel marker development: Indel markers existing in the 10 chromosomes in the laboratory were used to develop Indel markers existing in the interval, and the parental SSSL3 and Xu 178 were used to screen for differential markers.

3.4PCR procedures and genotype analysis of amplified products

The components of the PCR amplification system (8 μL) include: 2 μL DNA, 2 μL primers (1 μL each of the left and right primers), and 4 μL 2×TaqMaster Mix (Novizan P112). Use Touchdown PCR amplification program: 95℃ 5min; 95℃ 30s, 65℃ 30s (each cycle drops 1℃), 72℃ 45s, a total of 8 cycles; 95℃ 30s, 58℃ 30s, 72℃ 45s, a total of 28 Cycle; 72℃10min. PCR amplification products were analyzed by agarose gel electrophoresis for genotype analysis.

3.5 Fine mapping of main QTL for corn ear length

Indel markers existing in the 10 chromosomes in the laboratory were used to develop Indel markers existing in the interval, and the parental SSSL3 and Xu 178 were used to screen differential markers. The screened polymorphic molecular marker primer information is shown in Table 2.

Table 2 Molecular marker primer information

DNA was extracted from the leaves of individual plants in the population planted in Hainan in 2019, and screened using molecular markers at both ends. 123 recombinant individual plants were obtained. They were genetically identified through two-point-two repeated panicle length phenotype identification in two years and using interval markers. By type analysis, the target gene was located between markers M158 and M0900 through the spanning diagram, and the distance was 643Kb. The white box represents the genome fragment from Xu 178, the black box represents the SSSL3 genome fragment, and the gray box represents the hybrid fragment between Xu 178 and SSSL3. The histogram on the right indicates the average panicle length of the selfed progeny of a single recombinant plant, and the asterisk is obtained by performing a t test with Xu 178. ** represents P value <0.01, *** represents P value <0.001. Molecular marker M158 is located on the third chromosome of maize, with a specific location of chr3: 231733871-231734353. Molecular marker M0900 is located on chromosome 3 of maize, with a specific location of chr3: 232377659-232377854.

The amplified sequence size of M158 in Xu 178 is 502bp, and the amplified sequence is SEQ ID NO26:

CCGAGTGTGAGTGAGGACAAAGTGTATAGAGGTGAACTGTGACTTCATAGGCCAATGTTTAGAGGGTGTTTGGTTTCTAAGGACTAATTTTTAGTCCCTATATTTTATTCTATTTTAGTTCAAAATTGTCAAATATAGAAACTAAAATTCTATTTTAATTTCTATATTTGGCAATTTATAGACTAAAATGAATAAAAATAAAGGGACTAAACATTAGTCCCTATAAACCAAACACCCCCTTAATATGATTCATATAATACCAATGCCAT CAAGTGCACCTTATTTTTGGGAAGTTTATCTAAAAACAATCTGGATTAAATGTGTTTAGCTTAGATTTTTTTTTTTGGGGATGTGACAAAAATTCCCCTCGAGAGTAATCACTGCTGATCGTACTGTCCGTGAGAGACTGAAGTGTTACAAATTAACTTGAAGTTCTGTTACGAATTAACTTAAAAGTATAACTTCGAGTAGCAACCTTTCTACATCGTAACCAATCCACGTG;

The amplified sequence size of SSSL3 M158 is 321bp, and the amplified sequence is SEQ ID NO27:

CCGAGTGTGAGTGAGGACAAAGTGTATAGAGGTGAACTGTGACTTCATAGGCCAATGCTTAATATGATTCATATAATACCAATGCCATCAAGTGCACCTTATTTTTTGGGAAGTTTATCTAAAAACAATCTGGATTAAATGTGTTTAGCTTAGATTTTTTTTTTTGGGGATGTGACAAAAATTCCCCTCGAGAGTAATCACTGCTGATCGTACTGTCCGTGAGAGACTGAAGTGTTACAAATTAACTTGAAGTTCTGTTACGAATT AACTTAAAAGTATAACTTCGAGTAGCAACCTTTCTACATCGTAACCAATCCACGTG;

The amplified sequence size of M0900 in Xu 178 is 205bp, and the amplified sequence is SEQ ID NO28:

ACGATGCATGGTTGGAGTTGGAGGGCTGAACGGTTTCGGGCCTGGGTCAAATTCAACTACGTACCACGGAGTAGCAACACATCAGTTGCAATTTGCAAATACGCAGCCGACACGTTACCCTTTTTTTTGCACCCTTTTTGGTATCGCCTTAAACCGCCGCTTGAAGCATAAACGGAAACCATATGGGCCACTTTGTTTGATGG;

The size of the M0900 amplified sequence in SSSL3 is 215bp, and the amplified sequence is SEQ ID NO29:

ACGATGCATGGTTGGAGTTGGAGGGCTGAACGGTTTCGGGCCTGGGTCAAATTCAACTACGTACCACGGAGTAGCAACACATCAGTTGCAATTTGCAAATACGCAGCCTCTGGGCAGCCGACACGTTACCCCTTTTTTTGCACCCTTTTTGGTATCGCCTTAAACCGCCGCTTGAAGCATAAACGGAAACCATATGGGCCACTTTGTTTGATGG.

Example 2

The molecular markers closely linked to the major QTL for corn ear length obtained in Example 1 and their primers can be used in the genetic improvement of corn ear length. The method for identifying the corn ear length trait in the process of molecular marker-assisted breeding for corn ear length includes the following step:

Extract genomic DNA from corn leaves;

Using corn leaf genomic DNA as a template, use the primers M158-F/M158-R and M0900-F/M0900-R to perform PCR amplification respectively;

Agarose gel electrophoresis identification of PCR amplification results: When the primer used is M158-F/M158-R, when the size of the molecular marker M158 is detected to be 321bp, it means that the spike length of the sample to be tested is longer; when the detection If the size of the molecular marker M158 is found to be 502bp, it means that the ear length of the sample to be tested is shorter; when the primer used is M0900-F/M0900-R, when the size of the molecular marker M0900 is detected to be 215bp, it means that the length of the sample to be tested is short. The ear length of the sample to be tested is longer; when the size of the molecular marker M0900 is detected to be 205 bp, it means that the ear length of the sample to be tested is shorter.

In this example, the PCR amplification system is 8 μL, and the components include: 2 μL DNA, 1 μL each of the left and right primers, and 4 μL 2×Taq Master Mix (Norwegian P112). Use Touchdown PCR amplification program: 95℃ for 5min; 95℃ for 30s, 65℃ for 30s, each cycle decreases by 1℃, 72℃ for 45s, a total of 8 cycles; 95℃ for 30s, 58℃ for 30s, 72℃ for 45s, a total of 28 cycles Cycle; 72℃10min.

It should be noted that since the steps and methods adopted are the same as those in the embodiments, in order to avoid redundancy, the present invention describes preferred embodiments. Although the preferred embodiments of the present invention have been described, those skilled in the art will be able to make additional changes and modifications to these embodiments once the basic inventive concepts are apparent. Therefore, it is intended that the appended claims be construed to include the preferred embodiments and all changes and modifications that fall within the scope of the invention.

Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the invention. In this way, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims (7)

1. A molecular marker closely linked to the major QTL for ear length in maize, characterized in that the molecular marker is located on the third chromosome of maize and is the molecular marker M158 and the molecular marker M0900. 2. The molecular marker closely linked to the main QTL for corn ear length according to claim 1, characterized in that the molecular marker M158 is located on the third chromosome of corn, the specific position chr3: 231733871-231734353, and the molecular marker M0900 Located on chromosome 3 of maize, the specific location is chr3: 232377659-232377854. 3. The molecular marker closely linked to the main QTL for corn ear length according to claim 1, characterized in that the primer of the molecular marker is: The primer sequence for amplifying the molecular marker M158 is: M158-F: 5’-CCGAGTGTGAGTGAGGACAA-3’; M158-R: 5’-CACGTGGATTGGTTACGATG-3’; The primer sequence for amplifying the molecular marker M0900 is: M0900-F: 5’-ACGATGCATGGTTGGAGGTTG-3’; M0900-R: 5’-CCATCAAACAAAGTGGCCCA-3’. 4. The application of molecular markers closely linked to the major QTL for corn ear length, characterized in that the molecular markers are used for genetic improvement of corn ear length. 5. The application of molecular markers closely linked to the main QTL for corn ear length according to claim 4, characterized in that the method for identifying the corn ear thick trait in the genetic improvement of corn ear length includes the following steps: Extract genomic DNA from corn leaves; Using corn leaf genomic DNA as a template, use the primers M158-F/M158-R and M0900-F/M0900-R to perform PCR amplification respectively; Agarose gel electrophoresis identification of PCR amplification results: When the primer used is M158-F/M158-R, when the size of the molecular marker M158 is detected to be 321bp, it means that the spike length of the sample to be tested is longer; when the detection If the size of the molecular marker M158 is found to be 502bp, it means that the ear length of the sample to be tested is shorter; when the primer used is M0900-F/M0900-R, and the size of the molecular marker M0900 is detected to be 215bp, it means that the sample to be tested is to be tested. The ear length of the sample to be tested is longer; when the size of the molecular marker M0900 is detected to be 205 bp, it means that the ear length of the sample to be tested is shorter. 6. The application of molecular markers closely linked to the main QTL for corn ear length according to claim 5, characterized in that the PCR amplification system is 8 μL, and the components include: 2 μL DNA, and 1 μL each of the left and right primers. , 4 μL 2×Taq MasterMix. 7. The application of molecular markers closely linked to the main QTL for corn ear length according to claim 5, characterized in that the Touchdown PCR amplification program is used: 95°C 5min; 95°C 30s, 65°C 30s, each cycle Lower 1°C, 72°C for 45s, a total of 8 cycles; 95°C for 30s, 58°C for 30s, 72°C for 45s, a total of 28 cycles; 72°C for 10 minutes.