CN116768999A - Leaf rust resistance related protein AcLRR2P-1, biological material and application thereof - Google Patents

Leaf rust resistance related protein AcLRR2P-1, biological material and application thereof Download PDF

Info

Publication number
CN116768999A
CN116768999A CN202310688971.9A CN202310688971A CN116768999A CN 116768999 A CN116768999 A CN 116768999A CN 202310688971 A CN202310688971 A CN 202310688971A CN 116768999 A CN116768999 A CN 116768999A
Authority
CN
China
Prior art keywords
protein
plant
wheat
leaf rust
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310688971.9A
Other languages
Chinese (zh)
Inventor
刘伟华
李立会
徐世锐
吉夏洁
韩海明
张锦鹏
周升辉
杨欣明
李秀全
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Original Assignee
Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Crop Sciences of Chinese Academy of Agricultural Sciences filed Critical Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority to CN202310688971.9A priority Critical patent/CN116768999A/en
Publication of CN116768999A publication Critical patent/CN116768999A/en
Pending legal-status Critical Current

Links

Abstract

The application discloses a leaf rust resistance related protein AcLRR2P-1, and a biological material and application thereof. The application aims to solve the technical problem of improving the leaf rust resistance of plants, in particular wheat. Specifically disclosed is the use of a protein as described in sequence 2, a substance that increases the expression of a gene encoding the protein, or a substance that increases the activity or content of the protein in any of the following; a1 Use in improving leaf rust resistance of a plant and/or use in the manufacture of a product for improving leaf rust resistance of a plant; a2 Use in plant breeding and/or use in the preparation of products for plant breeding. Wheat leaf rust resistance can be improved by improving the expression of a protein AcLRR2P-1 coding gene in wheat.

Description

Leaf rust resistance related protein AcLRR2P-1, biological material and application thereof
Technical Field
The application relates to a leaf rust resistance related protein AcLRR2P-1, and biological materials and applications thereof.
Background
Wheat (Triticum aestivum l.) is the largest crop planted in the world, with 40% of the population being alive worldwide, but disease severely threatens wheat yield. Leaf rust is a fungal disease of wheat, caused by leaf rust bacteria (Puccinia triticina), and can severely cause yield losses of up to 50%. The cultivation of resistant varieties is an economic and environment-friendly breeding measure, however, the generation of new toxic strains caused by the continuous change of pathogenic strains and the long-term planting of single disease-resistant varieties lead to the loss of disease-resistant effects of the original disease-resistant varieties. The development and cloning of new disease-resistant genes of wheat can accelerate the disease-resistant breeding process and has important significance for cultivating durable disease-resistant varieties. The wheat cultivar has a relatively deficient leaf rust resistance gene, and the development of a new leaf rust resistance gene has important significance for disease resistance breeding application.
Disclosure of Invention
The application aims to solve the technical problem of improving the leaf rust resistance of plants, in particular wheat.
In order to solve the above problems, the present application provides the following applications.
Use of a protein, a substance that increases expression of a gene encoding the protein, or a substance that increases activity or content of the protein in any of the following;
a1 Use in improving leaf rust resistance of a plant and/or use in the manufacture of a product for improving leaf rust resistance of a plant;
a2 Use in plant breeding and/or use in the preparation of products for plant breeding;
the protein is any one of the following:
b1 Amino acid sequence is a protein shown in sequence 2;
b2 A protein which has 80% or more identity with the protein represented by B1) and has the same function as the protein represented by B1) and is obtained by substitution and/or deletion and/or addition of an amino acid residue of the protein described by B1);
b3 Fusion proteins obtained by ligating the N-terminal or/and C-terminal of B1) or B2) with a protein tag.
Sequence 2 is specifically shown below:
MSPVQSLPLIILVLSSLLTCSLLGAAALHGDASTDFQALRCLKLHLSISSSGIPASWKIDDSLQQFCTWSGVTCSKRHTSRVVALDLESLHLNGQIPPCIANLTLLTRIHLPDNQLWGPIPAELGQLNRLRYLNLSSNNLSGIIPSNLSSCSQLQFIDLGRNFINGVIPSTLGNFSSLSVLLLGDNSFQGSIPVSIGFGVIICKKKKKGKQAAHPSVKELKKFTYVDLVKATNGFSLANLVGSGTYGSVYKARTESEEHHTVAIKVFKLDQLGATKSFIAECEALRNTRRRNLVRVITVCSTSDLTGNEFKALVLEFMVNGDLESWLHPTLLHEHHPKRPLCLGSRITISVGIAAALDYLHNQCMPPMVHCDLKPSNVLLDDVMDARVGDFGLAKFLHGCSSSSGIDSSTSLVGPRGSVGYIAPEYGFGSKISTDGDVYSYGVIILEMLTGKRPTDEMFKDGLSLYKFVEDSFPEKIYKILDPRIIIPYYGNRDEEEAGSSSGQENHQMAAGIVSCITALTKLGLQCAAETPKDRPAMQDVYADATAIKEAFAALHG。
among the above proteins, the protein tag (protein-tag) refers to a polypeptide or protein that is fusion expressed together with a target protein by using a DNA in vitro recombination technique, so as to facilitate the expression, detection, tracing and/or purification of the target protein. The protein tag may be a Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag, and/or SUMO tag, etc.
In the above proteins, the identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity.
In the above protein, the 80% or more identity may be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.
In the above protein, sequence 2 (SEQ ID No. 2) consists of 557 amino acid residues. This was designated AcLRR2P-1 protein. The coding gene is AcLRR2P-1 gene.
In the present application, the purpose of the breeding includes breeding a plant with high leaf rust resistance.
The high leaf rust resistant plants have improved leaf rust resistance compared to the plant of interest.
In the above application, the protein is derived from wheat-agrocybe aegerita disease-resistant translocation line 2PT5.
In the above, the wheat may be a wheat strain Fielder.
In the above, the substance that regulates gene expression may be a substance that performs at least one of the following 6 regulation: 1) Regulation at the level of transcription of said gene; 2) Regulation after transcription of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) Regulation of RNA transport of the gene (i.e., regulation of nuclear to cytoplasmic transport of mRNA of the gene); 4) Regulation of translation of the gene; 5) Regulation of mRNA degradation of the gene; 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated by the gene).
In the above application, the substance for regulating the expression of the encoding gene of the protein is any one of the following:
d1 A nucleic acid molecule encoding the above protein;
d2 An expression cassette comprising D1) said nucleic acid molecule;
d3 A recombinant vector comprising D1) said nucleic acid molecule, or a recombinant vector comprising D2) said expression cassette;
d4 A recombinant microorganism comprising D1) said nucleic acid molecule, or a recombinant microorganism comprising D2) said expression cassette, or a recombinant microorganism comprising D3) said recombinant vector;
d5 A transgenic plant cell line comprising D1) said nucleic acid molecule, or a transgenic plant cell line comprising D2) said expression cassette, or a transgenic plant cell line comprising D3) said recombinant vector;
d6 A transgenic plant tissue comprising D1) said nucleic acid molecule, or a transgenic plant tissue comprising D2) said expression cassette, or a transgenic plant tissue comprising D3) said recombinant vector;
d7 A transgenic plant organ comprising D1) said nucleic acid molecule, or a transgenic plant organ comprising D2) said expression cassette, or a transgenic plant organ comprising D3) said recombinant vector.
D1 In said nucleic acid molecules, the person skilled in the art can easily mutate the nucleotide sequence encoding the protein AcLRR2P-1 according to the application by known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 80% or more identity to the nucleotide sequence of the protein AcLRR2P-1 isolated according to the present application are all nucleotide sequences derived from the present application and are equivalent to the sequences of the present application, as long as they encode the protein AcLRR2P-1 and have the function of the protein AcLRR2P-1.
The 80% or more identity may be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.
Herein, identity refers to identity of an amino acid sequence or a nucleotide sequence. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, by using blastp as a program, the Expect value is set to 10, all filters are set to OFF, BLOSUM62 is used as Matrix, gap existence cost, per residue gap cost and Lambda ratio are set to 11,1 and 0.85 (default values), respectively, and search is performed to calculate the identity of amino acid sequences, and then the value (%) of identity can be obtained.
Herein, such vectors are well known to those skilled in the art, including but not limited to: plasmids, phages (e.g., lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), ti plasmids, or viral vectors. Specifically, the vector can be a pWMB110 vector;
in the above biological material, the expression cassette of D2) means a DNA capable of expressing the gene in a host cell, and the DNA may include not only a promoter for promoting transcription of the gene but also a terminator for terminating transcription of the gene. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present application include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: a constitutive promoter of cauliflower mosaic virus 35S; wound-inducible promoters from tomato, leucine aminopeptidase ("LAP", chao et al (1999) Plant Physiol 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related (PR 1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester); tomato protease inhibitor II promoter (PIN 2) or LAP promoter (both inducible with jasmonic acid ester); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5, 057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN 101063139B (China patent 200710099169.7)), seed storage protein-specific promoters (e.g., promoters of phaseolin, napin, oleosin, and soybean beta-cone (Beachy et al (1985) EMBO J. 4:3047-3053)). They may be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator (see, e.g., odell et al (I985) Nature 313:810; rosenberg et al (1987) Gene,56:125; guerineau et al (1991) mol. Gen. Genet. 262:141; proudfoot (1991) Cell,64:671; sanfacon et al Genes Dev.,5:141; mogen et al (1990) Plant Cell,2:1261; munroe et al (1990) Gene,91:151; ballad et al (1989) Nucleic Acids Res.17:7891; joid et al (1987) Nucleic Acid Res. 15:9627).
In the above D3), the recombinant vector may be a recombinant expression vector comprising the gene expression cassette constructed using a plant expression vector. The plant expression vector may be a Gateway system vector or a binary agrobacterium vector, etc., such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, pMDC85, or pCAMBIA1391-Xb. When OsSOAR1 is used to construct a recombinant expression vector, any one of enhanced, constitutive, tissue-specific or inducible promoters such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin gene Ubiqutin promoter (pUbi) and the like may be added before the transcription initiation nucleotide thereof, and they may be used alone or in combination with other plant promoters; in addition, when the gene of the present application is used to construct a plant expression vector, enhancers, including translational enhancers or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene. As a specific example, the present application uses pWMB110 vector as expression vector.
As a specific example, the microorganism strain in the recombinant microorganism may be Agrobacterium C58C1.
In the above application, the nucleic acid molecule of D1) may be a DNA molecule having a nucleotide sequence represented by sequence 1 or 3.
The sequence 1 is specifically as follows:
ATGTCTCCTGTGCAGTCACTGCCTCTAATAATCCTTGTCCTATCTTCTCTCTTGACATGTTCATTACTAGGTGCCGCCGCACTCCACGGTGATGCTAGCACTGACTTCCAAGCCCTCCGTTGCCTTAAACTCCATCTCAGCATTTCTTCATCTGGAATCCCAGCCTCATGGAAGATTGATGATTCCCTCCAACAGTTCTGCACTTGGTCCGGTGTTACTTGCAGCAAGAGGCACACATCTCGTGTTGTTGCACTGGACCTCGAGTCGCTCCACCTTAATGGCCAAATACCGCCTTGCATTGCAAACCTCACTCTCCTCACAAGAATCCACCTCCCAGACAATCAGCTTTGGGGTCCAATCCCAGCTGAACTTGGGCAACTGAATAGGTTGAGGTATCTTAACCTCAGCTCAAACAATCTTAGTGGCATCATCCCAAGCAATCTATCCTCATGCTCTCAGCTTCAATTCATTGATCTTGGGAGGAACTTCATCAATGGTGTGATACCTTCTACTCTAGGGAATTTTTCTTCCCTTAGCGTGCTCTTACTTGGAGATAACAGTTTTCAAGGTAGCATCCCAGTGAGTATTGGCTTTGGAGTCATTATTTGTAAGAAGAAAAAGAAAGGCAAACAAGCAGCACATCCATCTGTCAAGGAGTTAAAGAAGTTCACATATGTCGATTTAGTGAAAGCAACAAATGGTTTTTCTTTGGCCAACTTGGTTGGTTCAGGAACATATGGGTCTGTATACAAAGCTAGAACTGAGTCTGAAGAGCATCATACAGTTGCTATCAAAGTTTTCAAACTCGATCAACTTGGAGCAACAAAGAGTTTCATTGCTGAATGTGAGGCACTGAGAAACACTCGTCGTCGTAATCTTGTAAGGGTGATCACCGTATGCTCAACAAGTGACCTGACGGGAAATGAGTTCAAAGCTCTTGTTCTTGAGTTTATGGTAAATGGCGACCTAGAGAGTTGGCTCCATCCAACACTGCTCCACGAGCATCATCCAAAAAGGCCGTTGTGTTTGGGTTCAAGAATAACAATATCAGTGGGCATAGCTGCTGCTTTGGATTACCTCCATAACCAATGCATGCCTCCTATGGTCCACTGTGATCTGAAGCCTAGCAATGTCCTTCTAGATGATGTCATGGACGCACGTGTTGGTGACTTTGGGTTGGCTAAGTTTCTACATGGTTGTTCTTCTTCTTCGGGGATTGATTCTTCTACAAGCTTAGTGGGGCCAAGAGGATCAGTTGGATACATTGCACCAGAATATGGATTTGGGAGCAAAATCTCCACGGATGGTGATGTTTACAGCTATGGAGTCATTATCTTAGAGATGCTCACAGGGAAGCGTCCAACTGATGAGATGTTTAAAGATGGCCTGAGCCTTTACAAATTTGTCGAAGACTCATTTCCTGAGAAGATCTACAAGATTCTAGATCCTAGAATCATCATTCCCTATTATGGGAACCGAGATGAAGAAGAAGCAGGGAGTTCCTCAGGCCAGGAAAATCATCAAATGGCTGCAGGAATAGTGAGCTGCATCACTGCTCTCACTAAGCTTGGCCTGCAATGCGCCGCGGAGACACCGAAAGATCGCCCAGCGATGCAGGACGTTTACGCTGATGCCACCGCAATCAAAGAAGCATTTGCAGCACTGCACGGC。
in the above application, the plant is any one of the following:
g1 Monocotyledonous plants;
g2 A gramineous plant;
g3 Wheat genus plant;
g4 Wheat.
In order to solve the problems, the application also provides a method for cultivating the high leaf rust resistance.
The method comprises up-regulating or enhancing or increasing the expression level of the above protein coding gene in the target plant, and/or the activity and/or content of the protein gives a high leaf rust resistance, which is higher than the target plant.
In order to solve the problems, the application also provides a method for improving the leaf rust resistance of plants.
The method comprises increasing leaf rust resistance of a plant by up-regulating or enhancing or increasing expression of a gene encoding the above protein in the plant and/or activity and/or content of the above protein.
In the present application, the plant may be wheat. The wheat may be a wheat strain Fielder.
In the above method, the up-regulating or enhancing or increasing expression of a gene encoding the above protein in a plant comprises introducing the above nucleic acid molecule, expression cassette or recombinant vector into the plant of interest.
In the above, the nucleic acid molecule may be a nucleic acid molecule as described in sequence 1 or sequence 3.
In the above method, the plant is any one of the following:
j1 Monocotyledonous plants;
j2 A gramineous plant;
j3 Wheat genus plant;
j4 Wheat.
In the present application, the wheat may be a wheat strain Fielder.
In order to solve the above problems, the present application also provides a protein or substance.
The protein or the substance is the protein or the substance.
Advantageous effects
The application discloses a leaf rust resistance related protein AcLRR2P-1, and a biological material and application thereof. The application discovers a gene AcLRR2P-1 related to leaf rust infection through transcriptome sequencing. The gene AcLRR2P-1 was inserted into the expression vector pWMB110. Constructing a recombinant plasmid pWMB110-AcLRR2P-1, wherein the recombinant plasmid pWMB110-AcLRR2P-1 is a fragment between restriction enzyme Sac I recognition sites of a pWMB110 vector, which is replaced by a DNA fragment shown by nucleotide 1-3619 from the 5' end of a sequence 3, and other nucleotide sequences of the pWMB110 vector are unchanged, so as to obtain the recombinant plasmid pWMB110-AcLRR2P-1.
The recombinant plasmid pWMB110-AcLRR2P-1 is transferred into agrobacterium and then into wheat. Obtaining a positive plant T 0 -1、T 0 -2、T 0 -3、T 0 -4、T 0 -5、T 0 -6, and for positive plants (T 0 -1、T 0 -2、T 0 -3、T 0 -4、T 0 -5、T 0 -6) and negative plants T 0 -7 performing a phyllotreta striolata resistance experiment with Fielder as negative control; three wheat strains T with high positive over-expression level are selected through expression level identification 0 -1、T 0 -4 and T 0 T of-5 1 The leaf rust resistance test was performed instead, with Fielder as a negative control. The results show that the positive over-expression wheat strain T 0 -1、T 0 -4 and T 0 -5 and T thereof 1 The generation positive plants show high resistance to rust bacteria, while the negative plants T 0 -7, fielder and T 1 The negative plants showed a disease with rust.
Drawings
FIG. 1 shows the temporal and spatial expression specificity and tissue expression specificity of AcLRR2P-1 gene.
FIG. 2 shows the amplified band of AcLRR2P-1.
FIG. 3 shows AcLRR2P-1 transgenic T 0 And (5) molecular marker detection of the plants.
FIG. 4 shows AcLRR2P-1 transgenic T 0 And detecting the expression quantity of the generation plants.
FIG. 5 shows AcLRR2P-1 transgenic T 0 And identifying the leaf rust resisting bacteria of the generation plants.
FIG. 6 shows AcLRR2P-1 transgenic T 1 And (5) molecular marker detection of the plants.
FIG. 7 shows AcLRR2P-1 transgenic T 1 And identifying the leaf rust resisting bacteria of the generation plants.
Detailed Description
The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.
The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
In the following examples:
wild-type Fielder, also known as wild wheat Fielder, the variety Fielder of The common wheat (Triticum aestivum L.), acceptor wheat Fielder or Fielder is described in The literature "The gene TaWOX5overcomes genotype dependency in wheat genetic transformation", which is available to The public from The national academy of agricultural sciences of crop science.
Z559 (Bingcao Z559, also known as Bingcao) is described in the following literature: production ofnew wheat-A.cristatum translocation lines with modifed chromosome 2P coding for powdery mildew and leaf rust resistance ".
Wheat Fukuho (also known as parent wheat Fukuho or Fukuho) is obtained from a national germplasm library, and the above materials can be queried from the national germplasm resource information network https:// www.cgris.net/#, and the wheat Fukuho is uniformly numbered as MY005601. Wheat Fukuho is also described in the following documents: "Production ofnew wheat-A.cristatum translocation lines with modifed chromosome 2P coding for powdery mildew and leafrust resistance", known in the literature as Fukuho.
2PT5 (Chinese name wheat-wheatgrass disease-resistant translocation line 2PT5, also known as translocation line 2PT 5) is described in the following literature: production ofnew wheat-A.cristatum translocation lines with modifed chromosome 2P coding forpowdery mildew and leafrust resistance ".
The wheatgrass (Agropyron cristatum (l.) gaertn., 2n=4x=28, pppp) is a wild kindred plant of wheat with a genome P, and has excellent characteristics of leaf rust resistance, powdery mildew resistance, stripe rust resistance and other diseases, and flowers and grains with high yield. The wheatgrass 2P chromosome carries excellent genes such as powdery mildew resistance, leaf rust resistance, compact plant type and the like. Early researches show that the wheat-agropyron aegerita translocation line 2PT5 carried agropyron aegerita 2P long arm 0.66-0.86 section chromatin contains leaf rust resistance and powdery mildew resistance genes, and the wheat-agropyron aegerita translocation line 2PT5 is a gene source with important utilization value for disease resistance genetic improvement of wheat. The above biological materials are used only for repeated experiments related to the present application, and cannot be used for other purposes. Screening out a leucine-rich repeated receptor kinase AcLRR2P-1 gene from transcriptome data of wheat-agropyron disease-resistant translocation line 2PT5 and infectious parent wheat Fukuhokomu (also called wheat Fukuho) inoculated with leaf rust bacteria, constructing an over-expression vector-driven AcLRR2P-1 gene, and transforming into a common wheat field by using an agrobacterium-mediated method to obtain transgenic wheat plants. Under the condition of inoculating the epidemic physiological race THT of the leaf rust bacteria, the over-expressed transgenic wheat positive strain has high resistance property compared with the control wheat field and the transgenic wheat negative strain. Provides scientific basis for effective utilization of the long-arm leaf rust resistance gene of the agropyron cristatum 2P.
EXAMPLE 1 development of AcLRR2P-1 Gene
1. Treatment of plant material
When wheat-agropyron aegerita disease-resistant translocation line 2PT5 and a disease-sensitive parent Fukuho grow to one leaf and one heart, inoculating a puccinia strigosa physiological race THT, sequentially sampling after inducing for 6h, 12h, 24h, 48h and 72h, taking 3 leaves with the same size at each time point to form one sample, taking the non-induction as a control, repeating three biological processes, and extracting sample RNA for sequencing a second generation transcriptome; RNA samples from the translocation line 2PT5 strain and the non-strain at five periods were mixed in equal amounts for three-generation full-length sequencing.
Screening of AcLRR2P-1 Gene
Transcriptome differential expression gene analysis is carried out on samples before and after the inoculation of translocation line 2PT5 by using a third generation full length sequencing (Iso-Seq) combined with a second generation transcriptome sequencing method. And performing quality control on the second generation transcriptome sequencing data of the inoculation and non-inoculation treatment on the translocation line 2PT5 and the infectious parent wheat Fukuho respectively, and then obtaining clearready by taking the transcripts of which the full-length transcriptome is subjected to redundancy removal as references, and analyzing the differential expression genes before and after the translocation line 2PT5 is inoculated with the phyllotreta striolata physiological race THT. Differential Expression Gene (DEGs) analysis was performed on transcriptome data before and after inoculation of the physiological race THT of puccinia striolata with translocation line 2PT5 and the infectious parent Fukuho, and transcripts specifically expressed in translocation line 2PT5 were screened. Functionally annotating transcripts significantly upregulated after translocation line 2PT5 vaccination, the AcLRR2P-1 gene from the agropyron 2P chromosome was selected. The AcLRR2P-1 gene sequence is shown in sequence 3.
The sequence 3 is specifically as follows:
ATGTCTCCTGTGCAGTCACTGCCTCTAATAATCCTTGTCCTATCTTCTCTCTTGACATGTTCATTACTAGGTGCCGCCGCACTCCACGGTGATGCTAGCACTGACTTCCAAGCCCTCCGTTGCCTTAAACTCCATCTCAGCATTTCTTCATCTGGAATCCCAGCCTCATGGAAGATTGATGATTCCCTCCAACAGTTCTGCACTTGGTCCGGTGTTACTTGCAGCAAGAGGCACACATCTCGTGTTGTTGCACTGGACCTCGAGTCGCTCCACCTTAATGGCCAAATACCGCCTTGCATTGCAAACCTCACTCTCCTCACAAGAATCCACCTCCCAGACAATCAGCTTTGGGGTCCAATCCCAGCTGAACTTGGGCAACTGAATAGGTTGAGGTATCTTAACCTCAGCTCAAACAATCTTAGTGGCATCATCCCAAGCAATCTATCCTCATGCTCTCAGCTTCAATTCATTGATCTTGGGAGGAACTTCATCAATGGTGAGATCCCACCAAACCTAAGCCAATGTTCAAATATGCAGCAGCTCAACTTAGATCACAACAAGCTCACTGGAGGCATCCCAGAAGGGTTAGGGACACTCCGCGACCTTTCAGTTCTGCGTCTTGCTGGAAATGGTCTAACAGGAAATATTCCTCTCTCACTTGGAAGCAACTCTATTCTCCACTCTGTTTATCTCACTAACAATAGCCTCACAGGACCCATCCCTTCTCTCCTAGCCAATAGTTCATCACTTCGATCATTGGTCTTGACCAACAATCACCTTAGTGGAGAGATTCCACGTGCACTATTTAATAGCACATCAGTTCAAGTCTTGAACCTAGGAGTGAACAACTTTGTTGGGTCCATACCTGTTGTTTTCCCGAATATTGCTGACTTACCCTTGCAGTGTCTTATCTTGACATCAAATAATCTTGCAGGTGTGATACCTTCTACTCTAGGGAATTTTTCTTCCCTTAGCGTGCTCTTACTTGGAGATAACAGTTTTCAAGGTAGCATCCCAGTGAGTATTGGTAAGCTTCCCAACCTGCAAGTACTAGACCTGAGTTACAACATTTTGTCAGGGAGTGTCCCAGCCTCTATTTACAACATATCTACACTCACATACCTAGGCATGGGTGTGAATATTCTTGAAGGGGAAGTTCCATTTAACATTGGATTTACCCTTCCAAGCATCCAAACATTGATTATGGGAGTGAACAAATTCCACGGCCAAATCCCCACTTCACTAGCCAACACAAT
CATCTTCGAGAGATTGATCTCAGCAACAATTCATTCCATGGTATTGTGCCTTCTTTTGGTA
CTCTTCCCAACTTAATCTACCTGACTCTTGGCAAGAATCGCCTTGAAGCAGGAGATTGGT
CTTTCTTAACCTCATTGACCAATTGCACCCAACTGTTAGAATTATCCTTGAATGCAAACA
CCCTTCAAGGAGATTTGCCGAGTTCCATTGGAGGACTTTCAAAGAGGTTAGAGGTATTG
CTATTAAGAGAAAATAAAATATCAGGCACTATACCACAGGAGATAGAGCATCTCACAAAC
ATCAAACGTCTTTACATGGACAAAAACTTGCTTAGTGGAAGTATCCCCAACTCACTTGG
AAATCTTCAAAAATTGGGTGGCCTAGGCTTATCCCAAAACAAACTTTCCGGACAAATTC
CGCTGTCAATTGGCAACCTAAGTCAATTGACTAAGCTATATTTACAAGAAAATAAGTTGA
GCGGCCCAATCCCAATAACTCTAGGGGACTGCAAAAGTTTGGAAACATTAAACCTCTCT
AGTAACAGATTTGATGATAGTATACCAAAAGAGCTCTTTATTCTTTCCTCCCTTTCAGTAG
GTTTGGACTTATCTCATAACAAACTTTCAGGACAAATACCACTAGAGATTGGCAGCTTGG
TCAATCTTGGCTCATTGAATATTTCCAATAACCAGTTGTCTGGACAAATACCCTCCACTCT
CGGTGAGTGCCTCCACTTGGAGTCGCTGCACATGGAGGGGAACAATTTTCATGGGCGAA
TTCCTAAATCTTTCATGAACTTGAGAGGCATCATTGTGATGGATCTATCTAAAAACAACTT
ATCCGGTGAAATCCCTGACTTCTTTGAGTCCTTTGGTTCCATGAAGCATCTCAATTTGTC
GTTCAACAACCTCGAGGGGCCAGTACCACTAGGTGGAATGTTTCAGAATGGAAGTGAG
GTGTTCATACAAGGAAACAATAAATTATGTGCGAGCACCGCATTGCTAGAGTTGCCACTT
TGCAATGCCGTGATACACAAAAAAAAGTTGTACACCTCCAAGATTCTGAAGATAGTAGC
AATTACTGCTCTTTCTTTGGTTCTGTTATCAGGCTTTGGAGTCATTATTTGTAAGAAGAAA
AAGAAAGGCAAACAAGCAGCACATCCATCTGTCAAGGAGTTAAAGAAGTTCACATATG
TCGATTTAGTGAAAGCAACAAATGGTTTTTCTTTGGCCAACTTGGTTGGTTCAGGAACAT
ATGGGTCTGTATACAAAGCTAGAACTGAGTCTGAAGAGCATCATACAGTTGCTATCAAAG
TTTTCAAACTCGATCAACTTGGAGCAACAAAGAGTTTCATTGCTGAATGTGAGGCACTG
AGAAACACTCGTCGTCGTAATCTTGTAAGGGTGATCACCGTATGCTCAACAAGTGACCT
GACGGGAAATGAGTTCAAAGCTCTTGTTCTTGAGTTTATGGTAAATGGCGACCTAGAGA
GTTGGCTCCATCCAACACTGCTCCACGAGCATCATCCAAAAAGGCCGTTGTGTTTGGGT
TCAAGAATAACAATATCAGTGGGCATAGCTGCTGCTTTGGATTACCTCCATAACCAATGC
ATGCCTCCTATGGTCCACTGTGATCTGAAGCCTAGCAATGTCCTTCTAGATGATGTCATGG
ACGCACGTGTTGGTGACTTTGGGTTGGCTAAGTTTCTACATGGTTGTTCTTCTTCTTCGG
GGATTGATTCTTCTACAAGCTTAGTGGGGCCAAGAGGATCAGTTGGATACATTGCACCAG
GTAAAAATTTCATAATACAAGATATTGTACTTTTGGAATATATCTTATATGCTCTTCTTCTG
GATATGTAAGTAGTATATTTTTTTTAATTTTTTACAGAAAATCTTCTGATTCTTCTGCTCCA
ATCCTTCTGTGCTAATTAATTGTTTGAATAACTTTACCTATTGCAGAATATGGATTTGGGAGCAAAATCTCCACGGATGGTGATGTTTACAGCTATGGAGTCATTATCTTAGAGATGCTCACAGGGAAGCGTCCAACTGATGAGATGTTTAAAGATGGCCTGAGCCTTTACAAATTTGTCGAAGACTCATTTCCTGAGAAGATCTACAAGATTCTAGATCCTAGAATCATCATTCCCTATTATGGGAACCGAGATGAAGAAGAAGCAGGGAGTTCCTCAGGCCAGGAAAATCATCAAATGGCTGCAGGAATAGTGAGCTGCATCACTGCTCTCACTAAGCTTGGCCTGCAATGCGCCGCGGAGACACCGAAAGATCGCCCAGCGATGCAGGACGTTTACGCTGATGCCACCGCAATCAAAGAAGCATTTGCAGCACTGCACGGCTGA。
EXAMPLE 2 spatial-temporal and tissue expression specificity of AcLRR2P-1 Gene
1. Spatiotemporal specific expression
Taking wheat-agropyron aegerita disease-resistant translocation line 2PT5 as a material, respectively taking 6h, 12h, 24h, 48h and 72h leaves of the physiological micro-seed THT of inoculated and non-inoculated leaf rust bacteria in a period from growing to one leaf and one heart, extracting total RNA, and performing reverse transcription to obtain cDNA for space-time specificity expression analysis.
2. Tissue-specific expression
Taking wheat-agropyron aegerita disease-resistant translocation line 2PT5 as a material, respectively taking and extracting total RNA from each tissue of inoculated and non-inoculated puccinia leaf rust physiological micro-seed THT in a period from growing to one leaf and one heart, and carrying out reverse transcription into cDNA for tissue-specific expression analysis.
3. Extraction of Total RNA
The total RNA of 2PT5 leaves of the wheat-agropyron cristatum disease-resistant translocation line was extracted using a plant total RNA extraction kit (Beijing bang nationality biological gene technologies Co., ltd., product number ZP 405). The method comprises the following specific steps:
(1) Taking about 0.1g of tissue sample in a 2.0mL centrifuge tube, rapidly placing the tissue sample in liquid nitrogen for freezing, and beating the tissue sample into powder by a proofing machine;
(2) Adding 1mL of plant lysate R into a centrifuge tube rapidly, and uniformly mixing by vortex oscillation to form uniform and transparent solution;
(3) 200 mu L of chloroform is added into a centrifuge tube, mixed evenly by intense shaking, and centrifuged at 13000rpm at 4 ℃ for 1min;
(4) Absorbing 600 mu L of upper colorless water phase into a new 1.5mL centrifuge tube, adding 300 mu L of absolute ethyl alcohol, shaking uniformly, transferring the solution into an RNase-free adsorption column, and sleeving the RNase-free adsorption column on an RNase-free collecting pipe;
(5) Centrifuging at 12000rpm at 4deg.C for 30s, discarding filtrate, and re-sleeving RNase-free adsorption column on RNase-free collecting tube;
(6) Adding 500 μl of rinse liquid RW into RNase-free adsorption column, centrifuging at 12000rpm at 4deg.C for 30s, and discarding the filtrate;
(7) Repeating the step (6), sleeving the RNase-free adsorption column on the RNase-free collecting pipe again, and centrifuging at 12000rpm for 2min at 4 ℃;
(8) Placing the RNase-free adsorption column in a new 1.5mL RNase-free centrifuge tube, and standing for 2min;
(9) Adding 60 mu LRNase-free water into the middle of the RNase-free adsorption column membrane, standing for 2min, and centrifuging at 12000rpm at 4 ℃ for 1min to obtain an RNA solution;
(10) Detecting the integrity of RNA by adopting 1% agarose gel electrophoresis, and storing in a refrigerator at-80 ℃;
synthesis of cDNA
cDNA was synthesized using HiScript III 1st Strand cDNA Synthesis Kit (+gDNAwind) (cat# R312) kit from Nanjinouzan Biotechnology Co., ltd, and the cDNA synthesis reaction steps were as follows: add to 200. Mu.L centrifuge tubeRNA of 1. Mu.L tissue sample and 7. Mu.LRNase-free ddH 2 O, the PCR amplification instrument is immediately placed on ice for 2min after the temperature is controlled at 65 ℃ for 5min; 2 mu L of 5 XgDNAwiter Mix is added into a centrifuge tube, and the mixture is gently mixed, and the temperature of a PCR amplification instrument is controlled at 42 ℃ for 2min; into a centrifuge tube, 2. Mu.L of 10 XRT Mix, 2. Mu. LHiScript III Enzyme Mix, 1. Mu.L of Oligo (dT) was added 20 VN，5μL RNase-free ddH 2 O, lightly mixing, controlling the temperature of a PCR amplification instrument at 50 ℃ for 45min and then controlling the temperature at 85 ℃ for 5s, thus completing the synthesis of cDNA, and storing in a refrigerator at-80 ℃.
5. Real-time fluorescent quantitative PCR
And designing specific primers for distinguishing the sequence of the AcLRR2P-1 gene in the wheat homologous gene according to the CDS sequence of the AcLRR2P-1, and analyzing the space-time expression specificity and the tissue expression specificity of the AcLRR2P-1 gene by adopting a real-time fluorescence quantification method.
The method comprises the following specific steps: the reaction was carried out using a 2X RealStar Fast SYBR qPCR Mix (High ROX) (GenStar, cat. A303) kit, and the reaction system was as follows:
table 1 real-time fluorescent quantitative PCR reaction System
The reaction process comprises the following steps: 94 ℃ for 30s;94 ℃,5s,59 ℃,15s,72 ℃ and 34s, 40 cycles are taken as internal references, and the calculation method adopts 2 -ΔΔCT A method of manufacturing the same. Detection was performed using a Step one plus real-time fluorescent quantitative PCR instrument from ABI, USA.
The space-time expression specificity analysis result shows that the expression quantity of the AcLRR2P-1 gene is highest 24 hours after the AclrR2P-1 gene is inoculated with the physiological micro-strain THT of the leaf rust bacteria; the tissue expression specificity results show that the AcLRR2P-1 gene has the highest expression level in leaf tissues (figure 1).
EXAMPLE 3 cloning of AcLRR2P-1 Gene
1. Treatment of plant material
The leaves of Ebena glabra Z559, wheat-Ebena glabra disease-resistant translocation line 2PT5 and parent wheat Fukuho were quickly frozen with liquid nitrogen and stored at-80℃for later use.
2. Extraction of genomic DNA
The genomic DNA was extracted from leaves of the above-mentioned agropyron Z559, wheat-agropyron translocated line 2PT5 and parent wheat Fukuho by CTAB method. The method comprises the following specific steps:
(1) About 1g of sample is taken and placed into a 2.0mL centrifuge tube provided with steel balls, and is frozen by liquid nitrogen and is made into powder by a proofing machine;
(2) Adding 800 mu L of preheated CTAB solution into a centrifuge tube, quickly and uniformly mixing, putting into a water bath kettle at 65 ℃ for about 1 hour, and shaking once every 15 minutes;
(3) Adding 800 mu L of phenol-chloroform (V: V=1:1) into a centrifuge tube, uniformly mixing, and centrifuging at 8000rpm for 10min;
(4) Sucking 750 mu L of the upper water phase in the step (3) into a new centrifuge tube, adding 750 mu L of chloroform, gently mixing, and centrifuging at 12000rpm for 10min;
(5) Sucking 600 mu L of the upper water phase in the step (4) into a new 2.0mL centrifuge tube, adding 400 mu L of isopropanol, gently mixing, placing in a refrigerator at 4 ℃ for 30min, centrifuging at 12000rpm for 10min, and pouring out the supernatant to leave white flocculent DNA precipitate;
(6) Adding 800 mu L of 70% ethanol solution into a centrifuge tube, reversing the solution upside down to float white flocculent DNA precipitate in the solution, centrifuging at 12000rpm for 10min by a centrifuge, and pouring out the supernatant to leave white flocculent DNA precipitate;
(7) Repeating step (6);
(8) The centrifuge tube was placed in a fume hood, and after drying the white flocculent DNA precipitate, 200. Mu.L of 1 XTE was added to dissolve the DNA sufficiently, and the mixture was stored at-20 ℃.
Amplification of AcLRR2P-1
The full-length specific primer AcLRR2P-1-1F of the gene was designed using the high fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme, cat. Number P505): 5'-ATGTCTCCTGTGCAGTCACTGCCTCTA-3'; acLR R2P-1-1R:5'-TCAGCCGTGCAGTGCTGCAAATG-3' the genomic DNA of the above extracted wheatgrass Z559, wheat-wheatgrass disease-resistant translocation line 2PT5 and parent wheat Fukuho are used as templates for amplification, and the amplification system is as follows:
TABLE 2PCR amplification reaction System
The amplification procedure was: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s, renaturation at 64℃for 30s, extension at 72℃for 3min for 30s, 35 cycles total; extending at 72deg.C for 10min, and preserving at 4deg.C.
The PCR products were separated by electrophoresis on a 1% agarose gel, which showed that the wheatgrass Z559 and 2PT5 gave a band of about 3.5kb for the wheat-wheatgrass disease resistance translocation line, and the band of about 3.5kb was excised for gel recovery, and the parental wheat Fukuho had no amplified band (FIG. 2). In fig. 2, Z559 is agropyron Z559,2PT5 is wheat-agropyron disease-resistant translocation line, fu is parent wheat Fukuho. The glue was recovered using a kit Agarose Gel DNA Extraction Kit Ver.4.0 (Takara, cat. 9762) for use.
Cloning of AcLRR2P-1
The gel recovery product obtained by amplifying the wheat-agropyron-de disease-resistant translocation line 2PT5 is connected to a zero background cloning vector EZ-Blunt zero background pTOPO II vector (GenStar, cat# T186-20), and the connection reaction system and the steps are as follows:
table 3 connects zero background carrier reaction system
Adding the carrier reaction system connected with the zero background into a 200 mu L centrifuge tube, and carrying out water bath at 37 ℃ for 5min; transferring the reaction system into a 1.5mL centrifuge tube with 100 mu L of slightly melted Trans1-T1 competence (TRAN, cat# CT 501) for conversion, carrying out heat shock at 42 ℃ for 40s after ice bath for 30min, and standing on ice for 2min; 800 mu L of LB culture solution without antibiotics is added into a 1.5mL centrifuge tube, and the mixture is placed at 37 ℃ for shake cultivation for 1h; centrifuge the tube in a centrifuge at 3000rpm for 30s, pour 700. Mu.L of LB culture solution in the tube, smear the rest culture solution on LB solid medium containing kana resistance for overnight culture (37 ℃); monoclonal was picked and the AcLRR2P-1-2F was detected with primers on the gene: 5'-GTTGTTCACTCCTAGGTTC-3'; acLRR2P-1-2R:5'-CATCTCAGCATTTCTTCATC-3' positive monoclonal was sequenced. The Vector with correct sequencing was named pTOPO TA/Blunt Vector-AcLRR2P-1.
Example 4 obtaining of wheat overexpressing AcLRR2P-1 Gene
1. Construction of recombinant expression vectors
(1) Introduction of the sticky Ends of AcLRR2P-1 Gene fragments
The full length of the AcLRR2P-1 gene was amplified using a pair of primers AcLRR2P-1-Sac I-F and AcLRR2P-1-Sac I-R containing Sac I restriction sites as templates with the wheat-agropyron translocation line 2PT5 genome, and the PC R product was isolated and recovered by 1% agarose gel to give a gene fragment into which the viscous end of Sac I was introduced, thus obtaining a viscous end amplification product. The primer sequences were as follows: acLRR2P-1-Sac I-F:5'-TCCCCGGGTACCGAGCTCATGTCTCCTGTGCAGTCACT GCCTCTA-3'; acLRR2P-1-Sac I-R:5'-ACGATCGGGGAAATTCGAGCTCTCAGCCGTGCA GTGCTGCAAATG-3'.
(2) Expression vector linearization
The expression vector pWMB110 (provided by The institute of crop science She Xingguo, national academy of agricultural sciences, described in The following literature: the gene TaWOX5overco mes genotype dependency in wheat genetic transformation.) was digested with restriction enzyme SacI (Thermo Fisher, cat. No. ER 1131), the digestion system was as follows:
TABLE 4pWMB110 cleavage System
Adding 5 μL of 10×loading Buffer in water bath at 37deg.C for 1 hr, mixing, separating enzyme-cut product by 2% agarose gel electrophoresis, and recovering carrier skeleton (recovery method is the same as above) to obtain linearization carrier;
(3) Ligation and transformation
The viscous terminal amplification product obtained in the step (1) and the linearization vector obtained in the step (2) are connected by adopting a Uniclone One Step Seamless Cloning Kit seamless cloning kit (product number SC 612) of Beijing Jinsha biotechnology limited company, and the connection system is as follows:
table 5 seamless cloning ligation System
The components in the system are gently mixed, the temperature is controlled for 30min at 50 ℃ by a PCR amplification instrument, the connection product is converted into Trans1-T1 competence (TRAN) by a heat shock method (the conversion method is the same as above), and monoclonal is selected for sequencing. The correct sequencing vector was designated as recombinant vector pWMB110-AcLRR2P-1. The recombinant vector pWMB110-AcLRR2P-1 is obtained by replacing the SacI enzyme recognition site sequence (GAGCTC) of the pWMB110 vector with the GAGCTC-sequence 3-GAGCTC sequence and keeping the other sequences of the vector pWMB110 vector unchanged, and is named as recombinant vector pWMB110-AcLRR2P-1 (hereinafter also called as pWMB110-AcLRR 2P-1).
The GAGCTC-sequence 3-GAGCTC sequence is specifically as follows:
GAGCTCATGTCTCCTGTGCAGTCACTGCCTCTAATAATCCTTGTCCTATCTTCTCTCTTGACATGTTCATTACTAGGTGCCGCCGCACTCCACGGTGATGCTAGCACTGACTTCCAAGCCCTCCGTTGCCTTAAACTCCATCTCAGCATTTCTTCATCTGGAATCCCAGCCTCATGGAAGATTGATGATTCCCTCCAACAGTTCTGCACTTGGTCCGGTGTTACTTGCAGCAAGAGG
CACACATCTCGTGTTGTTGCACTGGACCTCGAGTCGCTCCACCTTAATGGCCAAATACCG
CCTTGCATTGCAAACCTCACTCTCCTCACAAGAATCCACCTCCCAGACAATCAGCTTTG
GGGTCCAATCCCAGCTGAACTTGGGCAACTGAATAGGTTGAGGTATCTTAACCTCAGCT
CAAACAATCTTAGTGGCATCATCCCAAGCAATCTATCCTCATGCTCTCAGCTTCAATTCAT
TGATCTTGGGAGGAACTTCATCAATGGTGAGATCCCACCAAACCTAAGCCAATGTTCAA
ATATGCAGCAGCTCAACTTAGATCACAACAAGCTCACTGGAGGCATCCCAGAAGGGTTA
GGGACACTCCGCGACCTTTCAGTTCTGCGTCTTGCTGGAAATGGTCTAACAGGAAATAT
TCCTCTCTCACTTGGAAGCAACTCTATTCTCCACTCTGTTTATCTCACTAACAATAGCCTC
ACAGGACCCATCCCTTCTCTCCTAGCCAATAGTTCATCACTTCGATCATTGGTCTTGACC
AACAATCACCTTAGTGGAGAGATTCCACGTGCACTATTTAATAGCACATCAGTTCAAGTC
TTGAACCTAGGAGTGAACAACTTTGTTGGGTCCATACCTGTTGTTTTCCCGAATATTGCT
GACTTACCCTTGCAGTGTCTTATCTTGACATCAAATAATCTTGCAGGTGTGATACCTTCTA
CTCTAGGGAATTTTTCTTCCCTTAGCGTGCTCTTACTTGGAGATAACAGTTTTCAAGGTA
GCATCCCAGTGAGTATTGGTAAGCTTCCCAACCTGCAAGTACTAGACCTGAGTTACAAC
ATTTTGTCAGGGAGTGTCCCAGCCTCTATTTACAACATATCTACACTCACATACCTAGGCA
TGGGTGTGAATATTCTTGAAGGGGAAGTTCCATTTAACATTGGATTTACCCTTCCAAGCA
TCCAAACATTGATTATGGGAGTGAACAAATTCCACGGCCAAATCCCCACTTCACTAGCC
AACACAATCATCTTCGAGAGATTGATCTCAGCAACAATTCATTCCATGGTATTGTGCCTTC
TTTTGGTACTCTTCCCAACTTAATCTACCTGACTCTTGGCAAGAATCGCCTTGAAGCAGG
AGATTGGTCTTTCTTAACCTCATTGACCAATTGCACCCAACTGTTAGAATTATCCTTGAAT
GCAAACACCCTTCAAGGAGATTTGCCGAGTTCCATTGGAGGACTTTCAAAGAGGTTAGA
GGTATTGCTATTAAGAGAAAATAAAATATCAGGCACTATACCACAGGAGATAGAGCATCT
CACAAACATCAAACGTCTTTACATGGACAAAAACTTGCTTAGTGGAAGTATCCCCAACT
CACTTGGAAATCTTCAAAAATTGGGTGGCCTAGGCTTATCCCAAAACAAACTTTCCGGA
CAAATTCCGCTGTCAATTGGCAACCTAAGTCAATTGACTAAGCTATATTTACAAGAAAAT
AAGTTGAGCGGCCCAATCCCAATAACTCTAGGGGACTGCAAAAGTTTGGAAACATTAAA
CCTCTCTAGTAACAGATTTGATGATAGTATACCAAAAGAGCTCTTTATTCTTTCCTCCCTT
TCAGTAGGTTTGGACTTATCTCATAACAAACTTTCAGGACAAATACCACTAGAGATTGGC
AGCTTGGTCAATCTTGGCTCATTGAATATTTCCAATAACCAGTTGTCTGGACAAATACCCT
CCACTCTCGGTGAGTGCCTCCACTTGGAGTCGCTGCACATGGAGGGGAACAATTTTCAT
GGGCGAATTCCTAAATCTTTCATGAACTTGAGAGGCATCATTGTGATGGATCTATCTAAA
AACAACTTATCCGGTGAAATCCCTGACTTCTTTGAGTCCTTTGGTTCCATGAAGCATCTC
AATTTGTCGTTCAACAACCTCGAGGGGCCAGTACCACTAGGTGGAATGTTTCAGAATGGAAGTGAGGTGTTCATACAAGGAAACAATAAATTATGTGCGAGCACCGCATTGCTAGAGTTGCCACTTTGCAATGCCGTGATACACAAAAAAAAGTTGTACACCTCCAAGATTCTGAAGATAGTAGCAATTACTGCTCTTTCTTTGGTTCTGTTATCAGGCTTTGGAGTCATTATTTGTAAGAAGAAAAAGAAAGGCAAACAAGCAGCACATCCATCTGTCAAGGAGTTAAAGAAGTTCACATATGTCGATTTAGTGAAAGCAACAAATGGTTTTTCTTTGGCCAACTTGGTTGGTTCAGGAACATATGGGTCTGTATACAAAGCTAGAACTGAGTCTGAAGAGCATCATACAGTTGCTATCAAAGTTTTCAAACTCGATCAACTTGGAGCAACAAAGAGTTTCATTGCTGAATGTGAGGCACTGAGAAACACTCGTCGTCGTAATCTTGTAAGGGTGATCACCGTATGCTCAACAAGTGACCTGACGGGAAATGAGTTCAAAGCTCTTGTTCTTGAGTTTATGGTAAATGGCGACCTAGAGAGTTGGCTCCATCCAACACTGCTCCACGAGCATCATCCAAAAAGGCCGTTGTGTTTGGGTTCAAGAATAACAATATCAGTGGGCATAGCTGCTGCTTTGGATTACCTCCATAACCAATGCATGCCTCCTATGGTCCACTGTGATCTGAAGCCTAGCAATGTCCTTCTAGATGATGTCATGGACGCACGTGTTGGTGACTTTGGGTTGGCTAAGTTTCTACATGGTTGTTCTTCTTCTTCGGGGATTGATTCTTCTACAAGCTTAGTGGGGCCAAGAGGATCAGTTGGATACATTGCACCAGGTAAAAATTTCATAATACAAGATATTGTACTTTTGGAATATATCTTATATGCTCTTCTTCTGGATATGTAAGTAGTATATTTTTTTTAATTTTTTACAGAAAATCTTCTGATTCTTCTGCTCCAATCCTTCTGTGCTAATTAATTGTTTGAATAACTTTACCTATTGCAGAATATGGATTTGGGAGCAAAATCTCCACGGATGGTGATGTTTACAGCTATGGAGTCATTATCTTAGAGATGCTCACAGGGAAGCGTCCAACTGATGAGATGTTTAAAGATGGCCTGAGCCTTTACAAATTTGTCGAAGACTCATTTCCTGAGAAGATCTACAAGATTCTAGATCCTAGAATCATCATTCCCTATTATGGGAACCGAGATGAAGAAGAAGCAGGGAGTTCCTCAGGCCAGGAAAATCATCAAATGGCTGCAGGAATAGTGAGCTGCATCACTGCTCTCACTAAGCTTGGCCTGCAATGCGCCGCGGAGACACCGAAAGATCGCCCAGCGATGCAGGACGTTTACGCTGATGCCACCGCAATCAAAGAAGCATTTGCAGCACTGCACGGCTGAGAGCTC。
2. construction of recombinant bacteria and obtaining of transgenic wheat
The recombinant vector pWMB110-AcLRR2P-1 obtained in The step 1 is introduced into Agrobacterium rhizogenes C58C1 strain (provided by The institute of crop science She Xingguo, national academy of agricultural sciences, described in The following literature: the gene TaW OX5overcomes genotype dependency in wheat genetic transformation.) to obtain recombinant Agrobacterium, the recombinant bacterium is positively detected by using vector universal primers and gene specific primers AcLRR2P-1-2F and AcLRR2P-1-2R, the detection result shows that The recombinant bacterium is positive recombinant Agrobacterium, and The recombinant bacterium is named as C58C1/pWMB110-AcLRR2P-1 (also called recombinant Agrobacterium C58C1/pWMB110-AcLRR 2P-1).
Recombinant Agrobacterium C58C1/pWMB110-AcLRR2P-1 was spread on a YEP solid medium containing 50. Mu.g/mL rifampicin and kana, cultured at 28℃for 2 days, and then the cells were picked up from the YEP solid medium and placed in 5mL of a YEP liquid medium containing 50. Mu.g/mL rifampicin and kana, cultured overnight at 28℃and 1mL of a bacterial liquid was taken up in 50mL of a YEP liquid medium containing 50. Mu.g/mL rifampicin and kana, and cultured continuously to a bacterial liquid OD 600 Centrifuging at 3500rpm for 10min 0.5, collecting supernatant, collecting thallus, and collecting 10% sucrose (containing 0.02% Silwet L-77, beijing Biotechnology Co., ltd., product No. CS 9791) as solvent]Re-suspending the thallus; adding the receptor wheat field embryo into a centrifuge tube containing 5mL of re-suspension bacterial liquid, infecting for 30min, transferring the embryo, performing tissue culture under aseptic and high humidity conditions until wheat seedling grows out, transplanting into a flowerpot to obtain T 0 Transgenic wheat is substituted.
3. Transgenic wheat positive detection
The T is set 0 Transplanting the transgenic wheat into a flowerpot in a greenhouse for cultivation, wherein the cultivation temperature is 18-22 ℃, the illumination is 16 hours, the darkness is 8 hours, and the humidity is 40-60%. Taking T 0 The transgenic wheat leaf is replaced, genome DNA is extracted by adopting a CTAB method (the method is as above), and a specific primer AcLRR2P-1-3F is designed according to the sequences at two ends of a polyclonal site of a pWMB110 vector and an AcLRR2P-1 gene sequence: 5'-TTTAGCCCTGCCTTCATACGCT-3'; acLRR2P-1-3R:5'-GAGGATAGATTGCTTGGGATG-3' and primer AcLRR2P-1-2F, acLRR2P-1-2R, PCR amplification is performed, positive target bands are detected through electrophoresis, a receptor wheat field is set as a negative control, and 2PT5 is set as a positive control for each detection, so that false positive bands are avoided. Finally obtaining 6 transgenic positive strains respectively named as T 0 -1、T 0 -2、T 0 -3、T 0 -4、T 0 -5、T 0 6, obtaining a transgenic negative strain 1, designated as T 0 7, the results are shown in FIG. 3 (2 PT5 is wheat-agropyron de translocation line 2PT5, fielder is common wheat (Triticum aestivum L.) variety Fielder, T) 0 -1-T 0 -7 is T 0 Transgenic plants, M is DNAmarker).
Example 5 identification of transgenic plants and leaf rust resistance
1. Preparation and inoculation method of rust fungus
A spore suspension was prepared by adding 800. Mu.L of a light mineral oil (Chenopodium styrofoam chemical Co., ltd.) per 10mg of the physiological micro-seed THT summer spore powder of Rumex patiens. And (3) uniformly spraying 300 mu L of the prepared physiological micro-strain THT spore suspension of the rust fungus on plant leaves until the surfaces of the leaves are completely covered, moisturizing the plant leaves by using 0.05% Tween-20 (Sigma-Aldrich Sigma Aldrich trade company, shanghai) aqueous solution, keeping the plant leaves moist for 20 hours in a dark place, and then placing the plant leaves in a greenhouse at 18-22 ℃ for 16 hours in the dark for 8 hours with the humidity of 40% -60%, and continuously culturing.
2. Wheat leaf rust investigation method
When the negative control field fully attacks to 3-4 grades, carrying out resistance investigation on other wheat inoculated with the physiological micro-strain THT summer spore powder of the leaf rust bacteria, wherein the disease spot infection type is 0; six grades of investigation of 1, 2, 3 and 4 show that the infection type is 0-1 and shows high resistance, the infection type is 2 and shows medium resistance, and the infection type is 3-4 and shows infectious disease. The symptoms of the infection are specifically described as follows:
TABLE 6 symptomatic description of wheat leaf rust infection
AcLRR2P-1 transgenic plant expression level detection
And detecting the expression quantity of the AcLRR2P-1 gene in the AcLRR2P-1 transgenic plant by adopting a semi-quantitative PCR and a real-time fluorescent quantitative PCR method. By Fielder and transgenic negative strain T 0 -7 as negative control by primer acrrr 2P-1-4F:5'-AGAAGAAGCAGGGAGTTCC-3'; acLRR2P-1-4R:5'-ATCGCTGGGCGATCTTTC-3' transgenic plants T 0 -1、T 0 -2、T 0 -3、T 0 -4、T 0 -5、T 0 -6 performing AcLRR2P-1 gene expression level detection.
The method for extracting RNA from leaf tissue of transgenic plant and reverse transcription is the same as that for extracting total RNA in step 3 in example 2 and for synthesizing cDNA in step 4 in example 2, and the real-time fluorescence quantitative PCR method is the same as that for synthesizing cDNA in example 2, and the fluorescence quantitative result is shown as B in FIG. 4 and is consistent with the semi-quantitative result of A in FIG. 4.
The semi-quantitative PCR comprises the following specific steps: the cDNA obtained by reverse transcription was diluted to the same concentration (100 ng/. Mu.L), amplified using 2X Rapid Taq Master Mix (Vazyme, cat. P222), and Actin was used as an internal reference, and the system and procedure were:
TABLE 7 semi-quantitative PCR reaction System
/>
1% agarose gel electrophoresis detection.
Semi-quantitative PCR results showed (as in FIG. 4A) that AcLRR2P-1 gene was found in Fielder and transgenic negative strain T 0 No expression was detected in 7, there was a different amount of expression in positive transgenic plants; the fluorescent quantitative PCR results are shown (as B in FIG. 4) at T 0 -1、T 0 -4、T 0 The highest expression level of AcLRR2P-1 gene in-5 plants (FIG. 4,2PT5 is wheat-agrocybe disease-resistant translocation line 2PT5, fielder is the Fielder, type T of common wheat (Triticum aestivum L.) 0 -1-T 0 -7 is T 0 Transgenic plants are generated, M is a DNA marker).
4.T 0 Leaf rust resistance identification of transgenic plants
T in step 2 of example 4 0 Transgenic wheat (T) 0 -1、T 0 -2、T 0 -3、T 0 -4、T 0 -5、T 0 -6 and T 0 And 7) transplanting the plants into a flowerpot of a greenhouse for cultivation, wherein the cultivation temperature is 18-22 ℃, the illumination is 16h, the darkness is 8h, and the humidity is 40-60%. Transgenic plants were grown to tillering stage, wheat-agrocybe translocation line 2PT5 and Fielder plants of the same growth state were used as controls, inoculated according to the method of preparation and inoculation of Puccinia striolata of step 1 in example 5, after 14 days of inoculation, fielder developed fully (developed to 3-4 levels), and plant developed according to the method of investigation of wheat leaf rust of step 2 in example 5 (the results are shown in FIG. 5, 2PT5 is wheat-agrocybe translocation line 2PT5, fielder is common wheat (Triticum aestivum L.) variety Fielder, T 0 -1-T 0 -7 is T 0 The transgenic plants were generated, (+) represents positive transgenic plants, and (-) represents negative transgenic plants), and exogenous fragment-specific amplification detection was performed by the transgenic wheat positive detection method of step 3 in example 4.
The results show that, according to the method of the step 2 Rumex patiens investigation in example 5, under the condition of inoculating physiological micro-strain THT of Rumex patiens, there is no dead or chlorosis reaction on leaves of wheat-agrocybe aegerita translocation line 2PT5, the infection type can be recorded as 0, the transgenic wheat positive strain (T 0 -1、T 0 -2、T 0 -3、T 0 -4、T 0 -5、T 0 The summer spores on the leaves of 6) are small and the surrounding tissue has necrosis or chlorosis, the type of infection can be marked as 1, the transgenic wheat negative strain (T) 0 -7) and the number of summer spores on leaves of the recipient wheat field are large and numerous, the type of infestation can be noted as 3-4. It was demonstrated that the transgenic wheat positive strain had high resistance to the phaeorust physiological race THT, while the transgenic wheat negative strain and the recipient wheat Fielder exhibited pathogenicity to phaeorust physiological race THT (fig. 5).
5.T 1 Leaf rust resistance identification of transgenic plants
Based on the results of the expression level detection in step 3 of example 5, three transgenic lines T with the highest expression level were selected 0 -1、T 0 -4、T 0 Selfing 5 to obtain filial generation, randomly selecting 5 strains, and mixing T 0 -1 offspring designated T 1 1-1、T 1 1-2、T 1 1-3、T 1 1-4、T 1 1-5, T 0 -4 offspring designated T 1 4-1、T 1 4-2、T 1 4-3、T 1 4-4、T 1 4-5, T 0 -5 offspring designated T 1 5-1、T 1 5-2、T 1 5-3、T 1 5-4、T 1 5-5. Exogenous fragment-specific amplification, T, using the transgenic wheat positive detection method of step 3 of example 4 0 The results of the-1 offspring are shown in FIG. 6, T 1 1-1、T 1 1-2 and T 1 1-3 has AcLRR2P-1 exogenous gene, while T 1 1-4 and T 1 1-5 does not have AcLRR2P-1 exogenous gene.
T was identified using the leaf rust resistance identification method of step 2 in example 5 using translocation line 2PT5 and Fielder as controls 1 1-1、T 1 1-2、T 1 1-3、T 1 1-4 and T 1 1-5 identification of leaf rust resistance, T 0 The results of the-1 progeny are shown in FIG. 7 (2 PT5 is wheat-wheatgrass disease-resistant translocation line 2PT5, fielder is common wheat (Triticum aestivum L.) variety Fielder, T 1 -1-T 1 -5 is T 0 -1 progeny plants, (+) represents positive transgenic plants, (-) represents negative transgenic plants.
The results show that the invasion type of the wheat-wheatgrass translocation line 2PT5 can be marked as 0, and the transgenic wheat positive strain T 1 1-1、T 1 1-2 and T 1 1-3 with small summer spore pile and necrotic or chlorosis surrounding tissue, the infection type can be marked as 1, and the transgenic wheat negative strain T 1 1-4、T 1 1-5 and the invasiveness of the recipient wheat field can be noted as 3-4. The transgenic wheat positive strain has high resistance to the physiological race THT of the rust fungus, and the exogenous gene can be stably inherited to the next generation.
The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims (10)

1. Use of a protein, a substance that increases expression of a gene encoding the protein, or a substance that increases activity or content of the protein in any of the following;
a1 Use in improving leaf rust resistance of a plant and/or use in the manufacture of a product for improving leaf rust resistance of a plant;
a2 Use in plant breeding and/or use in the preparation of products for plant breeding;
the protein is any one of the following:
b1 Amino acid sequence is a protein shown in sequence 2;
b2 A protein which has 80% or more identity with the protein represented by B1) and has the same function as the protein represented by B1) and is obtained by substitution and/or deletion and/or addition of an amino acid residue of the protein described by B1);
b3 Fusion proteins obtained by ligating the N-terminal or/and C-terminal of B1) or B2) with a protein tag.
2. The use according to claim 1, wherein the protein is derived from agronomic crop Z559 or the wheat-agronomic crop disease resistance translocation line 2PT5.
3. The use according to claim 1 or 2, wherein the substance regulating the expression of the gene encoding the protein is any of the following:
d1 A nucleic acid molecule encoding a protein as claimed in claim 1 or 2;
d2 An expression cassette comprising D1) said nucleic acid molecule;
d3 A recombinant vector comprising D1) said nucleic acid molecule, or a recombinant vector comprising D2) said expression cassette;
d4 A recombinant microorganism comprising D1) said nucleic acid molecule, or a recombinant microorganism comprising D2) said expression cassette, or a recombinant microorganism comprising D3) said recombinant vector;
d5 A transgenic plant cell line comprising D1) said nucleic acid molecule, or a transgenic plant cell line comprising D2) said expression cassette, or a transgenic plant cell line comprising D3) said recombinant vector;
d6 A transgenic plant tissue comprising D1) said nucleic acid molecule, or a transgenic plant tissue comprising D2) said expression cassette, or a transgenic plant tissue comprising D3) said recombinant vector;
d7 A transgenic plant organ comprising D1) said nucleic acid molecule, or a transgenic plant organ comprising D2) said expression cassette, or a transgenic plant organ comprising D3) said recombinant vector.
4. The use according to claim 3, wherein the nucleic acid molecule of D1) is a DNA molecule having a nucleotide sequence of sequence 1 or sequence 3.
5. The use according to any one of claims 1 to 4, wherein the plant is any one of the following:
g1 Monocotyledonous plants;
g2 A gramineous plant;
g3 Wheat genus plant;
g4 Wheat.
6. A method for breeding a high leaf rust resistance, comprising up-regulating or enhancing or increasing the expression level of a gene encoding the protein according to claim 1 or 2 in a plant of interest, and/or the activity and/or content of the protein gives a high leaf rust resistance which is higher than the plant of interest.
7. A method for increasing leaf rust resistance in a plant, comprising increasing leaf rust resistance in a plant by up-regulating or enhancing or increasing expression in a plant of a gene encoding a protein according to claim 1 or 2, and/or activity and/or amount of a protein according to claim 1 or 2.
8. The method of claim 6 or 7, wherein said up-regulating or enhancing or increasing expression in a plant of a gene encoding a protein according to claim 1 or 2 comprises introducing into said plant of interest a nucleic acid molecule, expression cassette or recombinant vector according to claim 4.
9. The method of any one of claims 6-8, wherein the plant is any one of:
j1 Monocotyledonous plants;
j2 A gramineous plant;
j3 Wheat genus plant;
j4 Wheat.
10. The protein or the substance of any one of claims 1-5.
CN202310688971.9A 2023-06-12 2023-06-12 Leaf rust resistance related protein AcLRR2P-1, biological material and application thereof Pending CN116768999A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310688971.9A CN116768999A (en) 2023-06-12 2023-06-12 Leaf rust resistance related protein AcLRR2P-1, biological material and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310688971.9A CN116768999A (en) 2023-06-12 2023-06-12 Leaf rust resistance related protein AcLRR2P-1, biological material and application thereof

Publications (1)

Publication Number Publication Date
CN116768999A true CN116768999A (en) 2023-09-19

Family

ID=88012664

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310688971.9A Pending CN116768999A (en) 2023-06-12 2023-06-12 Leaf rust resistance related protein AcLRR2P-1, biological material and application thereof

Country Status (1)

Country Link
CN (1) CN116768999A (en)

Similar Documents

Publication Publication Date Title
CN109321582B (en) Application of aegilops tauschii Yr4DS gene in stripe rust resistant breeding of wheat plants
CA2475467C (en) Gene conferring resistance to phytophthora infestans (late-blight) in solanaceae
CN109111514B (en) Method for cultivating transgenic wheat with resistance to sheath blight and root rot and related biological material thereof
RU2684719C2 (en) Protein associated with resistance to disease and encoding its genes and their application in the regulation of plant resistance to diseases
CN105753953B (en) Disease-resistant wheat albumen and encoding gene and its application in regulation disease resistance of plant
CN113563442B (en) Drought-resistant related protein IbSPB1, and coding gene and application thereof
CN114276429B (en) Method for cultivating TaLRK-R gene-transferred wheat with resistance to sheath blight and stem base rot and related biological material thereof
WO2009143155A2 (en) Delayed fruit deterioration allele in plants and methods of detection
US20080307538A1 (en) Dehydrin Gene From Avicennia Marina Responsible For Conferring Salt Tolerance in Plants
CN112457380A (en) Protein for regulating and controlling content of fruit shape and/or fruit juice of plant, related biological material and application thereof
CN109929019A (en) A kind of and plant salt tolerance alkali GAP-associated protein GAP GsERF7 and its encoding gene and application
CN111574606B (en) Wheat disease-resistant and heading regulation gene TaCOK and related biological material and application thereof
US20230054349A1 (en) Application of EMBP1 Gene or Protein Thereof
JP5591703B2 (en) Rice genes conferring broad disease resistance
CN111574604B (en) Wheat disease-resistant protein TaAFRK and related biological material and application thereof
CN114539371B (en) Wheat powdery mildew resistance related proteins MlWE18 and MlIW172 and application thereof
CN110698552B (en) Rice WD 40-rich repetitive protein OsWD40-141 as well as coding gene and application thereof
CN112391406B (en) Method for promoting growth of strawberries and biological material used by same
CN116768999A (en) Leaf rust resistance related protein AcLRR2P-1, biological material and application thereof
Di et al. Complementary DNA (cDNA) cloning and functional verification of resistance to head smut disease (Sphacelotheca reiliana) of an NBS–LRR gene ZmNL in maize (Zea mays)
CN112961230B (en) OsFLP protein related to plant salt tolerance, related biological material and application thereof
CN112125964B (en) Plant grain weight related protein GmJAZ3, and coding gene and application thereof
CN110819606B (en) Rice receptor cytoplasmic kinase OsRLCK22 and coding gene and application thereof
CN112010956B (en) Wheat booting stage root depth related gene TaVSR1-B and encoding protein and application thereof
CN114644698B (en) Application of rice gene OsREM20 in regulation of spike number and yield

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination