CN116751273A - Application of OsbHLH002 protein or encoding gene thereof in regulation and control of plant cellulose synthesis or secondary wall development - Google Patents

Application of OsbHLH002 protein or encoding gene thereof in regulation and control of plant cellulose synthesis or secondary wall development Download PDF

Info

Publication number
CN116751273A
CN116751273A CN202310735186.4A CN202310735186A CN116751273A CN 116751273 A CN116751273 A CN 116751273A CN 202310735186 A CN202310735186 A CN 202310735186A CN 116751273 A CN116751273 A CN 116751273A
Authority
CN
China
Prior art keywords
osbhlh002
gene
protein
plant
secondary wall
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310735186.4A
Other languages
Chinese (zh)
Inventor
宋士勇
吴俣
李艾蓬
陈颖
祁皓月
杨丽佳
许亮
郭佳卓
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN202310735186.4A priority Critical patent/CN116751273A/en
Publication of CN116751273A publication Critical patent/CN116751273A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C12N15/8246—Non-starch polysaccharides, e.g. cellulose, fructans, levans
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Abstract

The invention provides an application of OsbHLH002 protein or a coding gene thereof in regulating and controlling plant cellulose synthesis or secondary wall development, and relates to the technical field of plant molecular biology. The amino acid sequence of the OsbHLH002 protein is shown as SEQ ID No. 2. The invention obtains the mutant of the OsbHLH002 gene by means of genetic engineering, and the result shows that the four mutation types of the OsbHLH002 show lodging phenotype compared with wild plants, and the complementary strain can recover the phenotype of the secondary wall development defect of the mutant. The invention provides an important application direction for improving the content of plant cellulose and increasing the secondary wall thickness, and also provides an important reference for cultivating lodging-resistant good varieties.

Description

Application of OsbHLH002 protein or encoding gene thereof in regulation and control of plant cellulose synthesis or secondary wall development
Technical Field
The invention relates to the technical field of plant molecular biology, in particular to application of OsbHLH002 protein or a coding gene thereof in regulating and controlling synthesis of plant cellulose or development of secondary walls.
Background
Cell walls are a characteristic structure of plant cells that is distinguished from animal cells and play a vital role in the growth and development of plants. Depending on the component of cell wall biosynthesis and the cell location, plant cell walls are divided into primary and secondary walls (Underwood, 2012; barres et al, 2015). Secondary walls are produced by thickened specific plant cell types that are involved in many critical biological processes in plants, such as mechanical support, transport of moisture and nutrients, dehiscence of anthers and pods, and various stress responses, etc. (Zhong and Ye,2015; zhang et al, 2021). The secondary wall is mainly composed of cellulose, hemicellulose and lignin, which account for the majority of plant biomass. Cellulose in primary walls and secondary walls is the most main component, accounts for about 1/3 of dry weight of plants, is the main determinant of mechanical strength of plant tissues, is the most abundant natural organic macromolecules on the earth, and has important application prospect in aspects of agricultural production, industrial manufacturing, new energy development and utilization and the like. Therefore, the method has important theoretical value and scientific significance for researching and controlling molecular mechanisms of cellulose deposition and secondary wall formation.
In 1986, researchers observed the cellulose complex enzyme structure CSC (Cellulose synthase complex) in the cell membrane of higher plants, as a "factory" for the catalytic synthesis of cellulose, assembled from cellulose synthase subunits (cellulose synthase, CESA) (Haigler and Brown,1986; pear et al, 1996). At least 10 CESA genes are currently identified in Arabidopsis, of which AtCESA4, atCESA7, atCESA8 are key genes controlling Arabidopsis secondary wall cellulose synthesis (Han Xiao et al, 2014). 11 CESA genes have been identified in rice, and the synthesis of secondary wall cellulose requires the joint participation of OsCESA 4/7/9. OsCESA4/7/9 is a homologous gene of AtCESA4/7/8 in rice (Tanaka et al, 2003), demonstrating that secondary wall cellulose synthesis is conserved among different species.
Transcriptional regulation is a large scale control mechanism of cellulose synthesis because it affects multiple metabolic pathways at the same time and regulates the transcription of many genes involved in cellulose formation. In dicotyledonous mode plant Arabidopsis, a precise model of secondary wall cellulose synthesis regulatory networks has been established. In this transcriptional regulatory network, a range of NAC and MYB transcription factors are included, as well as small amounts of bHLH and WRKY transcription factors (Zhong et al, 2010; zhang et al, 2021). Some NAC proteins function as primary layer-one regulatory factors, including VND1-7 (VASCULAR-RELATED NACDOMAIN 1-7), NST1, and SND1/NST3 and NST2.VND1-7 is involved in the development of xylem vessel cells, where VND6 and VND7 act as the main switching genes for xylem vessel formation, and overexpression causes thickening of the metawood and native xylem, respectively (Zhou et al, 2014; kubo et al, 2005); NST1/2 and SND1 are reported to co-regulate secondary cell wall synthesis (Zhong and Ye, 2015). These secondary wall-associated NACs have been shown to regulate the expression of a range of downstream transcription factors, such as MYBs, and thus the biosynthesis of secondary wall cellulose deposition. MYB46 and MYB83 are regulated by direct transcription of the first layer main switches NST1/2, SND1 and VND6/7 in a regulation network, and are specifically expressed in stem duct cells and vascular tissue cells (Zhong et al, 2007; yamaguchi et al, 2011), and are key node genes for regulating and controlling the formation of the secondary cell walls of Arabidopsis thaliana. OsMYB61 and OsMYB103L regulate secondary wall cellulose synthesis by directly binding to the promoter of OsCesAs. Some known NAC-like transcription factors, including rice OsSND2, osNAC9, and OsNAC31, act as first layer regulators, directly mediate the expression of other MYB-like genes and promote cellulose biosynthesis.
bHLH transcription factors are a widely existing class of proteins in plants, and play an important role in plant development regulation, stress response, hormone synthesis, optical signal transduction and other pathways. Classical ICE1 (Inducer ofCBF Expression 1) encodes a bHLH transcription factor, and plants overexpressing the ICE1 gene have significantly improved cold tolerance (Chinnusamy et al, 2003). Another bHLH transcription factor, ZHOUPI (ZOU), was reported to mediate the arabidopsis seed development process (Yang et al, 2008); in addition, it regulates the seed dormancy process with ICE1 by regulating the accumulation of ABA during seed maturation (MacGregor et al, 2019). The arabidopsis thaliana PHYTOCHROME B mutant phyB deposited a thinner secondary cell wall in stem fiber cells, but a thicker cell wall was observed in PHYTOCHROME INTERACTING FACTOR (PIF) quadruple mutant PIF1PIF3PIF4PIF5 (pifq); in addition, PIF4 interacts with MYC2/4, inhibiting their transduction activity against the primary regulatory transcription factor NST1, and thus inhibiting thickening of the secondary wall of Arabidopsis stem fibroblasts (Luo et al, 2022). However, currently there are few studies on the role of bHLH-like transcription factors in secondary wall formation. Despite the tremendous advances in Arabidopsis transcriptional regulatory networks, our understanding of the regulatory mechanisms of secondary wall cellulose development in monocot rice remains quite limited. Rice is one of the most important staple food crops, which produces huge agricultural biomass residues. Thus, there is a need to discover and find a more relevant gene involved in the development of secondary walls of rice.
In view of this, the present invention has been made.
Disclosure of Invention
Aiming at the defect of research on a plant secondary wall development regulation mechanism in the prior art, the invention provides application of OsbHLH002 protein or a coding gene thereof in regulation of plant cellulose synthesis or secondary wall development.
The technical scheme provided by the invention is as follows:
in one aspect, the invention provides application of an OsbHLH002 protein or a coding gene thereof in regulating plant cellulose synthesis or secondary wall development, wherein the amino acid sequence of the OsbHLH002 protein is shown as SEQ ID No. 2.
The invention obtains the mutant of the OsbHLH002 gene by means of genetic engineering, and the result shows that the four mutation types of the OsbHLH002 show lodging phenotype compared with wild plants, and the complementary strain can recover the phenotype of the secondary wall development defect of the mutant. The OsbHLH002 protein or the encoding gene thereof can be used for regulating and controlling the development of secondary walls of plants, in particular the synthesis and deposition of cellulose of the secondary walls.
In the invention, "OsbHLH002 protein" covers fusion proteins obtained by connecting tags at the N end and/or the C end of the protein shown in SEQ ID No.2 and proteins with the same functions obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 2.
In one embodiment, the nucleotide sequence of the gene encoding the OsbHLH002 protein is shown in SEQ ID No. 1.
The present invention encompasses sequences having more than 90%, preferably more than 95%, more preferably more than 99% similarity to the nucleotide sequence shown in SEQ ID No.1 and having the same function. The invention also covers sequences having one or several base substitutions, deletions and/or additions to the nucleotide sequence shown in SEQ ID No.1 and having the same function.
In another aspect, the present invention provides the use of a biological material comprising a gene encoding an OsbHLH002 protein in modulating plant cellulose synthesis or secondary wall development, wherein the biological material comprises:
(A) An expression cassette comprising a nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID No. 1;
(B) A recombinant vector comprising the expression cassette of (a);
(C) A recombinant microorganism comprising the expression cassette of (A) or comprising the recombinant vector of (B);
(D) A recombinant cell comprising the expression cassette of (A) or comprising the recombinant vector of (B).
In one embodiment, the recombinant vector is an overexpression vector of the OsbHLH002 gene.
In one embodiment, the recombinant expression vector comprises a transcript that initiates transcription of the gene of interest. To obtain overexpression of the gene of interest, the promoters included in the recombinant expression vector include, but are not limited to: a constitutive promoter; tissue, organ and development specific promoters and inducible promoters.
In one embodiment, the overexpression vector contains a Ubiquitin promoter or a CaMV35S promoter.
In one embodiment, the recombinant vector includes binary Agrobacterium vectors and vectors useful for plant microprojectile bombardment and the like, including, for example, but not limited to, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb vectors and the like.
In one embodiment, the recombinant vector is a pENTR-3FLAG vector.
In one embodiment, the recombinant microorganism is agrobacterium, preferably the recombinant microorganism is agrobacterium EHA105.
In one embodiment, the modulation is promotion of secondary wall cellulose synthesis by increasing the expression level of an OsbHLH002 gene or the activity of an OsbHLH002 protein in the plant.
In one embodiment, the plant is a monocot or dicot.
In one embodiment, the plant comprises rice.
In a specific embodiment, the plant is wild-type rice (Nippon-Qing).
In another aspect, the invention provides a method for cultivating lodging-resistant transgenic rice, which uses a gene OsbHLH002 as a target gene, and improves the expression level of the OsbHLH002 gene or the activity of OsbHLH002 protein in the rice by a genetic engineering method to obtain transgenic rice.
In one embodiment, the method of genetic engineering comprises introducing the OsbHLH002 gene into the recipient rice.
In one embodiment, the nucleotide sequence of the OsbHLH002 gene is shown in SEQ ID No. 1.
In the present invention, the transgenic rice includes seeds, calli, whole plants and cells. The transgenic rice not only comprises first-generation transgenic rice obtained by transforming the target plant with the gene, but also comprises offspring thereof.
The invention has the beneficial effects that:
the invention clearly verifies the important role of the OsbHLH002 protein or the encoding gene thereof in regulating and controlling the synthesis of plant cellulose or the development of secondary walls for the first time. When the gene function is lost, the plant develops secondary wall development defects. This shows that the gene plays an important role in secondary wall development, and is favorable for promoting plant secondary wall biosynthesis, increasing plant cellulose content and increasing secondary wall thickness. The invention provides an important theoretical basis for researching and cultivating new lodging-resistant varieties for the development mechanism of secondary walls.
Drawings
FIG. 1 is a schematic diagram of mutation sites of four mutants of the OsbHLH002 gene provided by the invention;
FIG. 2 shows that four mutation types of Osbhlh002 provided by the invention show lodging phenotype compared with wild type plants.
FIG. 3 shows that the Osbhlh002-1gOsbhlh002 and Osbhlh002-1gOsbhlh002-3FLAG complementary strain provided by the invention can restore the phenotype of Osbhlh002-1 secondary wall development defect;
FIG. 4 is a schematic diagram showing the difference in leaf sheath secondary wall thickness between the wild type and Osbhlh002 mutant provided by the invention;
FIG. 5 shows the measurement results of the cell wall thickness and cellulose content of the wild type, osbhlh002 mutant and its complementary line.
Detailed Description
For the purpose of making the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments of the present invention. The following embodiments and features of the embodiments may be combined with each other without conflict. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
The discovery and verification of more genes involved in plant cell wall regulation are of great significance to crop breeding, yield improvement and the like. At present, genes related to plant secondary wall development are gradually discovered and functionally identified, but the research on the function of bHLH transcription factors in secondary wall formation is less, and the function mode of OsbHLH002 in the rice secondary wall development or cellulose synthesis are not reported.
The experimental result of the OsbHLH002 gene mutation shows that the OsbHLH002 function deletion mutant strain has secondary wall development defect, and is particularly expressed by the phenotype of weakened leaf sheath supporting force, obviously reduced secondary wall thickness and obviously reduced cellulose content. This indicates that the OsbHLH002 gene has important functions in the rice secondary wall synthesis process. In addition, the invention discovers that the complementary strain can restore the phenotype of the Osbhlh002-1 secondary wall development defect by constructing the complementary strain, and further verifies the effect of the gene in the plant secondary wall development. The invention provides new gene resources for synthesizing rice secondary wall cellulose and theoretical basis for crop molecular design breeding.
The full length of the OsbHLH002 gene sequence is 1575bp, the nucleotide sequence is shown as SEQ ID NO.1, and 524 amino acids are encoded.
In one example, the invention provides application of OsbHLH002 protein or a coding gene thereof in regulating plant cellulose synthesis or secondary wall development, wherein the amino acid sequence of the OsbHLH002 protein is shown in SEQ ID No. 2: MLPRFHGAMWMQDDGGGDQEHGQAAPPGQEQHHHDQHLMALAAAAAGGAGFGAAQAPAPLLDEDWYFDAAGGGGGGAHGSMMLGLSSVHGGIGAGTSGGGHGQQFSLLNMGAAAAPFDVSGFDLGIACGGVGGGGDVVSFLGGGNASNTALLPVGNAGFLGTFGGFGTAASQMPEFGGLAGFDMFDAGAVNTGGSSSSSSAAAAAASASAHVSNTAPFSGRGKAAVLRPLDIVPPVGAQPTLFQKRALRRNAGEDDDDKKRKAAAGAGAGALSADGADMVLDDGDDDGLSIDASGGLNYDSEDARGGEDSGAKKESNANSTVTGDGKGKKKGMPAKNLMAERRRRKKLNDRLYMLRSVVPKISKMDRASILGDAIEYLKELLQKINDLQNELESSPATSSLPPTPTSFHPLTPTLPTLPSRIKEEICPSALPSPTGQQPRVEVRLREGRAVNIHMFCARRPGLLLSAMRAVEGLGLDVQQAVISCFNGFTLDIFKAEQCKDGPGLLPEEIKAVLMQSAGFHTMI.
In one example, the cDNA sequence of the encoding gene of the OsbHLH002 protein is shown in SEQ ID No. 1: ATGCTGCCGCGGTTTCACGGCGCCATGTGGATGCAGGACGACGGCGGCGGCGACCAAGAACACGGGCAGGCGGCGCCGCCTGGGCAGGAGCAGCACCACCACGACCAGCATCTCATGGCGTTGGCGGCCGCGGCCGCGGGCGGCGCCGGGTTCGGCGCGGCGCAGGCGCCGGCGCCGCTGCTCGATGAGGACTGGTACTTCGACGCGGCGGGTGGTGGTGGTGGTGGCGCGCATGGGTCCATGATGCTGGGTTTGTCGTCCGTCCATGGCGGGATTGGGGCGGGGACGTCTGGTGGTGGGCATGGGCAGCAGTTCTCGCTGCTCAACATGGGCGCCGCGGCCGCGCCGTTCGACGTCTCCGGGTTCGACCTCGGGATCGCCTGCGGCGGCGTTGGCGGCGGCGGCGACGTGGTGTCGTTTCTTGGCGGCGGGAACGCGTCGAACACCGCGCTGCTCCCCGTCGGGAACGCGGGGTTCCTCGGCACGTTCGGCGGGTTCGGCACCGCGGCGTCCCAAATGCCGGAGTTCGGCGGGCTCGCCGGGTTCGACATGTTCGACGCGGGCGCCGTGAACACCGGGGGCAGCTCCTCCTCCTCGTCGGCGGCGGCGGCGGCGGCGTCCGCCTCGGCGCACGTGAGCAACACCGCGCCGTTCTCCGGGCGCGGCAAGGCGGCGGTGCTGCGGCCGCTGGATATCGTCCCGCCCGTGGGCGCGCAGCCGACGCTGTTCCAGAAGCGCGCGCTCCGCCGCAACGCCGGCGAGGACGACGACGACAAGAAGCGCAAGGCCGCCGCGGGCGCGGGCGCGGGCGCGCTGTCCGCCGACGGCGCCGACATGGTGCTCGACGACGGCGACGACGACGGCCTCAGCATCGACGCGTCGGGCGGCCTCAACTACGACTCCGAGGACGCCAGGGGCGGCGAGGACAGCGGCGCCAAGAAGGAGTCGAACGCCAACAGCACGGTCACCGGCGACGGGAAGGGGAAGAAGAAGGGGATGCCGGCCAAGAACCTCATGGCGGAGCGCCGCCGCCGGAAGAAGCTCAACGACCGCCTCTACATGCTCCGCTCCGTCGTGCCCAAGATCAGCAAGATGGACAGGGCTTCCATTCTCGGCGACGCGATTGAGTACCTGAAGGAGCTGCTGCAGAAGATCAATGATCTTCAGAATGAGCTCGAGTCGTCCCCCGCGACGTCGTCATTGCCTCCAACACCCACAAGCTTCCATCCCCTGACACCGACGCTGCCCACATTGCCGTCCCGCATCAAGGAAGAGATCTGCCCAAGTGCATTGCCAAGCCCCACTGGACAACAGCCAAGGGTTGAGGTTAGGCTGAGGGAAGGCCGGGCTGTCAATATCCACATGTTCTGTGCTCGGAGGCCCGGTCTACTGCTCTCTGCCATGAGGGCCGTCGAAGGCCTTGGTCTCGATGTCCAGCAAGCTGTAATCAGTTGCTTCAATGGCTTTACGTTGGATATTTTTAAGGCTGAGCAATGCAAGGACGGCCCTGGGCTGTTGCCTGAAGAAATCAAGGCCGTTCTGATGCAATCCGCCGGGTTCCATACCATGATCTAG.
In one embodiment, up-regulating the activity or expression level of an OsbHLH002 protein or gene encoding the same may regulate plant secondary wall development or secondary wall cellulose synthesis.
In a specific example, the expression level (increased expression level) of the OsbHLH002 gene is controlled by introducing the OsbHLH002 gene into a plant using an overexpression vector to perform overexpression, thereby promoting the deposition of secondary wall cellulose in the plant.
In a specific embodiment, increasing the expression level of the OsbHLH002 gene increases the secondary wall cellulose content, increases the secondary wall thickness, and increases leaf sheath support.
The invention defines the function of OsbHLH002 and biological material containing the same in promoting the deposition of plant secondary wall cellulose, and as the mutation of OsbHLH002 can result in lodging character of plant, lodging-resistant transgenic plant can be cultivated by increasing or improving the expression of manuscript gene.
In one embodiment, the invention provides a method for cultivating lodging-resistant transgenic rice, which improves the expression level of an OsbHLH002 gene or the activity of an OsbHLH002 protein in the rice by a genetic engineering method to obtain the lodging-resistant transgenic rice.
Definition of terms in connection with the present invention
The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof in either single-or double-stranded form.
In the present invention, the term "identity" or "similarity" refers to sequence similarity to a native nucleic acid sequence. Identity or similarity can be assessed by means of computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.
In the present invention, the term "expression" or "gene expression" means the transcription of a particular gene or genes or a particular gene construct into structural RNA (rRNA, tRNA) or mRNA, which RNA is subsequently translated or not translated into protein. This process involves transcription of DNA and processing of the resulting mRNA product.
In the present invention, the term "increased expression/overexpression" means any form of expression that is increased relative to the original wild-type expression level. Methods for increasing expression of a gene or gene product have been described in the art and include, for example, overexpression driven by a suitable promoter, the use of transcriptional enhancers or translational enhancers.
In the present invention, the terms "increase", "improvement" or "enhancement" are interchangeable and shall mean a yield and/or growth and/or variation of at least 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10%, preferably at least 15% or 20%, more preferably 25%, 30%, 35% or 40% more compared to a control plant as defined herein.
In the present invention, the term "transformation" refers to a method of introducing a heterologous DNA sequence or vector containing a DNA sequence into a host cell or organism.
In the present invention, the term "recombinant expression vector": one or more DNA vectors for effecting plant transformation; these vectors are often referred to in the art as binary vectors.
In the present invention, the term "host cell" or "recombinant host cell line" means a cell comprising a polynucleotide of the present invention, regardless of the method used to insert to produce a recombinant host cell. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.
In the present invention, the term "complementary vector" means "functional complementary vector" which is a functional complementary experiment for mutants in genetic engineering to verify whether the mutant phenotype can be restored after complementation, and the complementary vector usually contains a gene of interest and may optionally use a constitutively strong promoter or a promoter of the gene itself.
Some embodiments of the present invention are described in detail below with reference to the accompanying drawings. The following embodiments and features of the embodiments may be combined with each other without conflict.
EXAMPLE 1 cloning of the nucleotide sequence of the OsbHLH002 Gene
RNA was extracted from rice using the Omega plant extraction kit. Then, the first strand cDNA was synthesized using 1. Mu.g of RNA as a template according to the instructions of the cDNA synthesis kit (Yeasen). According to (http:// rice. Plant biology. Msu. Edu/expression. Shtml) website, the complete ORF of OsbHLH002 is obtained, and specific primers are designed: the 5' end primer is ATGCTGCCGCGGTTTCA (SEQ ID No. 3); the 3' -end primer was CTAGATCATGGTATGGAAC (SEQ ID No. 4).
PCR reaction system: 2X PhantaMax MasterMix. Mu.L, 1. Mu.L each of forward/reverse primer 10. Mu.M, 5. Mu.L of template (cDNA), and 50. Mu.L of sterilized water were filled in, and the reaction procedure was as follows: pre-denaturation at 95℃for 3min, denaturation at 95℃for 30s, tm annealing for 30s, extension at 72℃for 2kb/min, 35-40 cycles, extension at 72℃for 5min. . Finally, 1575bp full-length cDNA sequence (shown as SEQ ID No. 1) of OsbHLH002 is obtained through amplification, and 524 amino acids are encoded (shown as SEQ ID No. 2).
EXAMPLE 2 construction of OsbHLH002 Gene mutant and complementary Strain vector
The present study utilizes the CRISPR/Cas9 genome editing system to edit the OsbHLH002 gene in wild-type rice (japan) to obtain mutant plants. The exon sequence of the target gene OsbHLH002 was analyzed using the CRISPR-GE website (http:// skl. Scau. Edu. Cn /), and two specific target sequences were selected and designated as target site 2 (Cas 9-2) GGCGACCAAGAACACGGGCAGG (SEQ ID No. 5) and target site 3 (Cas 9-3) CCATGTGGATGCAGGACGACGG (SEQ ID No. 6). Synthesis of sgRNA-2 (GGCGACCAAGAACACGGC, SEQ ID No. 7) and sgRNA-3 (CCATGTGGATGCAGGACGA, SEQ ID No. 8), the vector psgR-CAS9-Os was edited by BsaI cleavage, and the primers were annealed: target site 2, 10. Mu.LF (5'-TGTGTGGGCGACCAAGAACACGGGC-3', SEQ ID No. 9) +10. Mu.LR (5'-AAACGCCCGTGTTCTTGGTCGCCCA-3', SEQ ID No. 10) +80. Mu.L ddH 2 Mixing evenly; target site 3, 10. Mu.LF (5'-TGTGTGCCATGTGGATGCAGGACGA-3', SEQ IDNo.11) +10. Mu. L R (5'-AAACTCGTCCTGCATCCACATGGCA-3', SEQ IDNo.12) +80. Mu.L ddH 2 O is evenly mixed, annealed for 10min at 95 ℃, and then connected with the digested carrier psgR-CAS 9-Os. The connection system is as follows: mu.L of annealed product (containing sgRNA) +2. Mu.L of recovered digestion vector +0.5. Mu.L of 10 xT 4 buffer +0.5. Mu.LT 4 ligase was ligated for 15min at room temperature to obtain psgR-CAS9-OsbHLH002 vector containing specific target of OsbHLH002, which was transformed into E.coli competent DH 5. Alpha. The transformation system is as follows: ligation product 5. Mu.L was added to E.coli competenceIn the process, 30min on ice, heat shock at 42 ℃ for 90s and 2min on ice, 400 mu L of antibiotic-free LB is added, recovery is carried out at 37 ℃ for 1h, centrifugation is carried out at 5000rpm for 1min, most supernatant is sucked off, 100 mu L of liquid is left to be uniformly mixed, the mixture is coated on an LB plate (50 mg/LKan) for culture, and the mixture is cultured at 37 ℃ overnight. The positive clone is sent to a company for sequencing after plasmid extraction, and the psgR-CAS9-OsbHLH002 plasmid with correct selection result is used for obtaining mutant plants by a method of infecting rice callus by agrobacterium.
To construct the gOsbHLH002-3FLAG, the amplified 4.94kb genomic sequence contained the 2.12kb 5' upstream sequence and the 2.82kb coding sequence was purified according to the Omega gel recovery kit procedure. The recovered product and the vector pENTR-3FLAG after ECORI digestion are connected by a homologous recombination method, and the reaction system is as follows: linearization of carrier 2 u L, insert 3 u L,5 x Cell buffer4 u L, exnase II 2 u L, sterilized water to 20 u L; reaction conditions: 37℃for 30min. The ligation product transformed DH 5. Alpha. Competent cells were cultured overnight at 37℃for kanamycin resistance. The positive monoclonal was picked the next day and sent for testing.
EXAMPLE 3 construction of OsbHLH002 Gene mutants and complementary plants
Obtaining of OsbHLH002 Gene mutant plants
Rice (Japanese) callus is used as an experimental material. The gene mutant vector of OsbHLH002 obtained in example 2 was transformed into agrobacterium EHA105 by freeze-thawing. Selecting agrobacterium (containing OsbHLH002 gene mutant vector) monoclonal in 2mL LB liquid medium of Rif+Spe at 28 ℃ with 200rpm shaking overnight, then taking 1mL bacterial liquid to 10mL resistant LB to culture for 5h, centrifuging at 4000rpm at room temperature for 10min, discarding the supernatant, and re-suspending the bacterial body with 50mLAAM-As suspension; selecting rice callus with a certain size, placing into agrobacterium suspension for dip-dyeing for 30min, pre-filling a layer of sterile filter paper soaked with AAM on the culture medium, spreading the callus on the culture medium with a spoon, and dark culturing at 28deg.C for 2 days. Washing the callus with sterile water after 2 days until the washing liquid is clear, oscillating with Cef sterile water containing 500mg/L for 30min, spreading the washed callus on sterile filter paper, airing for 2h, and transferring to a screening culture medium for screening for about two weeks. The newly grown resistant calli were transferred to differentiation medium containing 50mg/L hygromycin for cultivation. Transferring the green-turned rice callus to a rooting culture medium for inducing rooting after 2-3 weeks. For mutant positive plants, gDNA from T0 generation plants needs to be extracted, identified by PCR and sequenced.
Identification of Osbhlh002 mutant: extracting leaf genome DNA of T0 generation transgenic plant, taking the leaf genome DNA as a template, designing a specific primer F2 (AGGAAAAACGGCTTGTGGGA, SEQ ID No. 13) and a primer R2 (GGACGACAAACCCAGCATCA, SEQ ID No. 14) according to two target spot information of OsbHLH002, carrying out PCR amplification on the specific primer F3 (GTAGAGTGCTCTCCCCTCCA, SEQ ID No. 15) and the primer R3 (GGACGACAAACCCAGCATCA, SEQ ID No. 16), recovering a single and clear amplification product of a target band (the size of a positive plant PCR amplification product is 477bp and 369 bp), and sending to a company for sequencing, and screening mutant strains. And (5) carrying out continuous selfing on the generation T0 to obtain the generation T2. And (3) carrying out hygromycin screening and PCR identification on the T2 generation plants again, screening independent strains which do not contain vectors and have homozygous mutation, and finally obtaining four mutant strains which are named as Osbhlh002-1, osbhlh002-2, osbhlh002-3 and Osbhlhl 002-4 respectively as shown in a figure 1. Wherein two kinds of mutation are generated at the target sequence 1, the strain with 1 base (+T) added is Osbhlh002-1, and the strain with 1 base (-G) deleted is Osbhlh002-2; two mutations were also made at target sequence 2, the 1 base (+A) added strain was Osbhlh002-3, the 1 base (-A) deleted strain was Osbhlh002-4, and all four of the above mutants resulted in frame shift mutation of the encoded protein.
Obtaining of OsbHLH002 Gene complementation plant line plant
The method of Agrobacterium-mediated genetic transformation of rice is mainly referred to the method reported by Hiei et al (see Agrobacterium-mediated transformation of rice using immature embryos or calli induce from mature seed,2008,Nature protocol.Doi:10.1038/nprot.2008.46), the complementary vector gOsbHLH002 or gOsbHLH002-3FLAG is introduced into the homozygous callus of the OsbhLh002-1 mutant, and the homozygous transgenic plant is obtained by germination on a hygromycin-containing culture medium. We randomly selected four strains #5, #6, #8, #11, as examples, which were each capable of restoring the phenotype of Osbhlh2-1 secondary wall development defects (see FIG. 3).
EXAMPLE 4 phenotypic analysis of related genetic Material
Seeds of rice (wild type, mutant and complementation lines) were sown after soaking, and the phenotype of the plant material was observed for about 2-3 weeks (see FIGS. 2, 3). Transecting leaf sheaths for about 2-3 weeks, and observing changes of thick-wall cells by using methylene blue staining; determining the secondary wall thickness of the thick-walled cells using transmission electron microscopy (see fig. 4); the phenotype of the relevant genetic material was determined from a number of angles using the Solarbio kit to determine the cellulose content of the secondary wall of the leaf sheath of the relevant material (see fig. 5).
Although the present disclosure is described above, the scope of protection of the present disclosure is not limited thereto. Various changes and modifications may be made by one skilled in the art without departing from the spirit and scope of the disclosure, and these changes and modifications will fall within the scope of the invention.

Claims (10)

  1. The application of the OsbHLH002 protein or the encoding gene thereof in regulating and controlling the synthesis of plant cellulose or the development of secondary walls is characterized in that the amino acid sequence of the OsbHLH002 protein is shown as SEQ ID No. 2.
  2. 2. The use according to claim 1, wherein the nucleotide sequence of the gene encoding OsbHLH002 protein is shown in SEQ ID No. 1.
  3. 3. Use of a biological material comprising a gene encoding an OsbHLH002 protein for modulating plant cellulose synthesis or secondary wall development, wherein the biological material comprises:
    (A) An expression cassette comprising a nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID No. 1;
    (B) A recombinant vector comprising the expression cassette of (a);
    (C) A recombinant microorganism comprising the expression cassette of (A) or comprising the recombinant vector of (B);
    (D) A recombinant cell comprising the expression cassette of (A) or comprising the recombinant vector of (B).
  4. 4. The use according to claim 3, wherein the recombinant vector is an overexpression vector of the OsbHLH002 gene.
  5. 5. The use according to claim 4, wherein the overexpression vector contains a Ubiquitin promoter or a CaMV35S promoter.
  6. 6. The use according to any one of claims 1 to 5, wherein the modulation is promotion of secondary wall cellulose synthesis by increasing the expression level of an OsbHLH002 gene or the activity of an OsbHLH002 protein in the plant.
  7. 7. The use according to any one of claims 1 to 5, wherein the plant comprises rice.
  8. 8. A method for cultivating lodging-resistant transgenic rice is characterized in that a gene OsbHLH002 is used as a target gene, and the expression level of the OsbHLH002 gene or the activity of OsbHLH002 protein in the rice is improved by a genetic engineering method to obtain the transgenic rice.
  9. 9. The method of claim 8, wherein the method of genetic engineering comprises introducing the OsbHLH002 gene into the recipient rice.
  10. 10. The method according to claim 8 or 9, wherein the nucleotide sequence of the OsbHLH002 gene is shown in SEQ ID No. 1.
CN202310735186.4A 2023-06-20 2023-06-20 Application of OsbHLH002 protein or encoding gene thereof in regulation and control of plant cellulose synthesis or secondary wall development Pending CN116751273A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310735186.4A CN116751273A (en) 2023-06-20 2023-06-20 Application of OsbHLH002 protein or encoding gene thereof in regulation and control of plant cellulose synthesis or secondary wall development

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310735186.4A CN116751273A (en) 2023-06-20 2023-06-20 Application of OsbHLH002 protein or encoding gene thereof in regulation and control of plant cellulose synthesis or secondary wall development

Publications (1)

Publication Number Publication Date
CN116751273A true CN116751273A (en) 2023-09-15

Family

ID=87952879

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310735186.4A Pending CN116751273A (en) 2023-06-20 2023-06-20 Application of OsbHLH002 protein or encoding gene thereof in regulation and control of plant cellulose synthesis or secondary wall development

Country Status (1)

Country Link
CN (1) CN116751273A (en)

Similar Documents

Publication Publication Date Title
CN108949774B (en) Method for obtaining multi-leaf alfalfa material by using MsPALM1 artificial site-specific mutant
US7985890B2 (en) Transgenic sweet sorghum with altered lignin composition and process of preparation thereof
EP2020846A2 (en) Compositions for silencing the expression of gibberellin 2-oxidase and uses thereof
CN111118005A (en) MiRNA related to rice blast resistance, corresponding precursor and application
CN110760515A (en) lncRNA lnc12 and application thereof in regulation and control of adventitious root development of poplar
CN112250742B (en) Use of proteins and their related biomaterials for modulating mechanical strength in plants
CN114438114A (en) Method for improving rice blast resistance of rice
CN117106820A (en) Method for creating few lateral branches of tomatoes through genome editing and application of method
CN104911191B (en) A kind of sterility changing gene FG3 and its application
CN110777150B (en) Application of protein GmPLATZ in regulation and control of plant seed yield
CN115466747B (en) Glycosyltransferase ZmKOB1 gene and application thereof in regulation and control of maize female ear set character or development
CN115724930A (en) Tobacco NtMYB transcription factor and application thereof
CN116751273A (en) Application of OsbHLH002 protein or encoding gene thereof in regulation and control of plant cellulose synthesis or secondary wall development
CN112553203A (en) Long-chain non-coding RNA-lnc5 for regulating growth and development of poplar and application thereof
CN111206040B (en) Rice bacterial leaf blight resistance related gene OsDuf6 and application thereof
CN114181948A (en) Method for regulating differentiation of plant multicellular epidermal hair
CN108823221B (en) Larix dahurica LgUGPase gene promoter sequence and application thereof in plant genetic improvement
CN108841840B (en) Application of protein TaNADH-GoGAT in regulation and control of plant yield
CN114561387B (en) Peanut promoter and application thereof
CN116606855B (en) Rice green tissue specific promoter pOsRBBI3 and application thereof
CN116606856B (en) Rice green tissue specific promoter pOsPTHR and application thereof
CN114350675B (en) LuNAC gene for regulating and controlling synthesis of flax secondary wall and application thereof
CN112813074B (en) Method for specifically regulating and controlling rice CYP78A11 gene expression and plant transformation vector
CN110194791B (en) Application of SPL3 protein in regulation and control of plant inflorescence or carpopodium development
CN107022566B (en) A kind of expression vector and its application in plant gene function research

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination