CN116732196A - Primer pair, reagent and/or kit and method for rapid identification or auxiliary identification of sheep hornless character - Google Patents
Primer pair, reagent and/or kit and method for rapid identification or auxiliary identification of sheep hornless character Download PDFInfo
- Publication number
- CN116732196A CN116732196A CN202310893174.4A CN202310893174A CN116732196A CN 116732196 A CN116732196 A CN 116732196A CN 202310893174 A CN202310893174 A CN 202310893174A CN 116732196 A CN116732196 A CN 116732196A
- Authority
- CN
- China
- Prior art keywords
- sheep
- primer pair
- seq
- tailed
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241001494479 Pecora Species 0.000 title claims abstract description 264
- 238000000034 method Methods 0.000 title claims abstract description 18
- 239000003153 chemical reaction reagent Substances 0.000 title claims abstract description 15
- 238000009395 breeding Methods 0.000 claims abstract description 20
- 230000001488 breeding effect Effects 0.000 claims abstract description 20
- 108020004414 DNA Proteins 0.000 claims abstract description 13
- 102000053602 DNA Human genes 0.000 claims abstract description 3
- 108020004682 Single-Stranded DNA Proteins 0.000 claims abstract description 3
- 238000012408 PCR amplification Methods 0.000 claims description 11
- 239000002773 nucleotide Substances 0.000 claims description 10
- 125000003729 nucleotide group Chemical group 0.000 claims description 10
- 210000002268 wool Anatomy 0.000 claims description 10
- 238000001514 detection method Methods 0.000 claims description 7
- 239000003550 marker Substances 0.000 claims description 6
- 238000002360 preparation method Methods 0.000 claims description 4
- 238000004519 manufacturing process Methods 0.000 abstract description 5
- 238000011160 research Methods 0.000 abstract description 4
- 244000144972 livestock Species 0.000 abstract description 3
- 230000002068 genetic effect Effects 0.000 abstract description 2
- 238000012216 screening Methods 0.000 abstract description 2
- 238000012217 deletion Methods 0.000 description 63
- 230000037430 deletion Effects 0.000 description 63
- 238000003780 insertion Methods 0.000 description 60
- 230000037431 insertion Effects 0.000 description 60
- 238000003752 polymerase chain reaction Methods 0.000 description 35
- 239000011543 agarose gel Substances 0.000 description 18
- 108090000623 proteins and genes Proteins 0.000 description 6
- 238000000246 agarose gel electrophoresis Methods 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 239000012807 PCR reagent Substances 0.000 description 2
- 108010006785 Taq Polymerase Proteins 0.000 description 2
- 238000009826 distribution Methods 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 101150028074 2 gene Proteins 0.000 description 1
- 229920000936 Agarose Polymers 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 230000006978 adaptation Effects 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 239000008367 deionised water Substances 0.000 description 1
- 229910021641 deionized water Inorganic materials 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 238000003384 imaging method Methods 0.000 description 1
- 210000004731 jugular vein Anatomy 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 230000008844 regulatory mechanism Effects 0.000 description 1
- 238000003860 storage Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application discloses a primer pair, a reagent and/or a kit and a method for rapid identification or auxiliary identification of sheep non-angular character. One technical scheme to be protected by the application is a primer pair for identifying or assisting in identifying whether sheep is a hornless sheep, wherein the primer pair consists of single-stranded DNA of SEQ ID No.2 in a sequence table and SEQ ID No.3 in the sequence table. The primer pair or the reagent and/or the kit containing the primer pair can be used for rapidly detecting the angular character of sheep in early stage, and can be used for screening even when the sheep is born, so that the breeding process of the non-angular sheep is accelerated, and the livestock production is guided; meanwhile, the locus has important scientific research value and can provide a theoretical basis for researching sheep horn character related genetic evolution rules.
Description
Technical Field
The application relates to the technical field of biology, in particular to a primer pair, a reagent and/or a kit and a method for rapidly or auxiliarily identifying sheep non-horn traits.
Background
Sheep are easy to domesticate and raise due to their mild characters, and are widely popularized and bred worldwide. The sheep horn can be used as a tool for resisting enemy and can play an important role as a weapon in puppet fight. It follows that studies of the genes related to the angular traits of sheep are necessary both from the point of view of animal reproduction and from the point of view of evolution.
Sheep generally have three types of angular traits: 1. both male and female sheep are horned, typically male sheep have two relatively male horns and female sheep have only a small horn; 2. male sheep horn character is developed, female sheep has no horn; 3. both male and female sheep were non-angular. The non-horned and the horned phenotypes are common phenotypes in sheep breeding.
The breeding management is inconvenient because the events of damaging the colony house and injuring the breeding personnel occur in the breeding production process of the horned sheep, so that the breeding of the new horned sheep strain easy to manage is very important.
Disclosure of Invention
The technical problem to be solved by the application is how to identify the angular character of sheep in early stage and/or how to breed the non-angular sheep in early stage.
In order to solve the above technical problems, the present application firstly provides a primer pair for identifying or assisting in identifying whether sheep is a non-horned sheep, which is characterized in that: the primer pair consists of single-stranded DNA of SEQ ID No.2 in the sequence table and SEQ ID No.3 in the sequence table.
The sheep can be at least one of small-tailed han sheep, aletai sheep, large-tailed han sheep, chinese merino fine wool sheep, arwang sheep, color tile sheep, polymma sheep, hoba sheep, dulang sheep, safuke sheep, hu sheep, tekesaier sheep or Dupoff sheep.
In order to solve the technical problems, the application also provides a reagent and/or a kit containing the primer pair.
In order to solve the technical problems, the application also provides a method for identifying or assisting in identifying sheep horn traits, which comprises the steps of taking genomic DNA of sheep to be detected as a template, and performing PCR (polymerase chain reaction) amplification detection by using the primer pair and/or the reagent and/or the kit, wherein the sheep to be detected containing 94 th-1873 th nucleotide of SEQ ID No.1 in a sequence table in a PCR amplification product is a non-horned sheep or a candidate non-horned sheep; the PCR amplification product does not contain 94 th-1873 th nucleotide of SEQ ID No.1 in the sequence table, and the sheep to be detected is horned sheep or candidate horned sheep.
In the above method, the sheep may be at least one of small tailed sheep, aletai sheep, large tailed sheep, merino fine wool sheep in china, awang sheep, color tile sheep, polymma sheep, holba sheep, dorame sheep, safuck sheep, hu sheep, texel sheep or dupoise sheep.
In order to solve the technical problems, the application also provides a method for breeding the hornless sheep, which comprises the following steps: and (3) taking genome DNA of sheep to be detected as a template, performing PCR amplification detection by using the primer pair and/or the reagent and/or the kit, and selecting sheep containing 94 th-1873 th nucleotides of SEQ ID No.1 in a sequence table in the PCR amplification product as a parent or a candidate as a parent for breeding.
In the above method, the sheep may be at least one of small tailed sheep, aletai sheep, large tailed sheep, merino fine wool sheep in china, awang sheep, color tile sheep, polymma sheep, holba sheep, dorame sheep, safuck sheep, hu sheep, texel sheep or dupoise sheep.
Any of the following applications of the primer pairs described above is also within the scope of the present application:
c1 Use of a marker for identifying or aiding in the identification of a sheep non-angular trait product;
c2 Use in the breeding of polled sheep;
c3 For the preparation of a product for detecting or assisting in detecting breeding of a non-horned sheep.
Any of the following uses of the above-described reagents and/or kits are also within the scope of the application:
d1 Use in the identification or assisted identification of the non-angular character of sheep;
d2 Use of a marker for identifying or aiding in the identification of a sheep non-angular trait product;
d3 Use in the breeding of polled sheep;
d4 Use in the preparation of a pollenless sheep breeding product.
In the above application, the sheep may be at least one of small tailed sheep, aletai sheep, large tailed sheep, merino fine wool sheep in china, awang sheep, color tile sheep, polymma sheep, holba sheep, dorame sheep, safuck sheep, hu sheep, texel sheep, or dupoise sheep.
The primer pair, the kit or the method provided by the application is not limited by the age of sheep to be identified, can be used for rapidly detecting sheep horn characters in early stage, can be used for screening sheep immediately after birth, and quickens the breeding process of the hornless sheep, so that the livestock production is guided, and meanwhile, the locus has important scientific research value, and can provide theoretical basis for the research of sheep horn character related genetic evolution rules and the research of regulation mechanism.
Drawings
FIG. 1 is an agarose gel electrophoresis pattern of PCR amplification results of sheep genome. The leftmost is DNA standard 1kb marker, which is 1000bp, 2000bp, 3000bp, 4000bp, 5000bp, 6000bp, 7000bp, 8000bp, 9000bp and 10000bp from bottom to top. The rightmost marker is DNA standard 100bp, which is 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp and 1500bp from bottom to top. The second lane to the seventh lane are, from left to right, a sakura sheep with an insertion/insertion genotype, a hu sheep with an insertion/insertion genotype, a dupoise sheep with an insertion/deletion genotype, an aletai sheep with an insertion/deletion genotype, a large tailed han sheep with a deletion/deletion genotype, and a small tailed han sheep with a deletion/deletion genotype.
Detailed Description
The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.
The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
The small tailed sheep, the aletai sheep, the dormer sheep, the hu sheep, the safuke sheep, the merino fine wool sheep in China, the large tailed sheep, the awang sheep, the colored-tile sheep, the doma sheep, the Hollaba sheep, the texel sheep and the Dupox sheep in the following implementation can be obtained from commercial sources.
Example 1 detection of sheep angular Property
1. PCR reagent for detecting sheep horn character
The PCR reagent for identifying or assisting in identifying the hornsheep of this example consists of PCR primer pair F and R, 10×Taq buffer, taq DNA polymerase, dNTP mix, sterilized deionized water (ddH) 2 O) composition.
The primer pair is provided by Beijing Liuhua big gene technology Co., ltd, and has the following sequence:
F:5’-GACATTGGAAAAGCAAGGAAAGCGA-3’(SEQ ID No.2)
R:5’-GGGAGCATAGTAGGAGGGTGTCAGG-3’(SEQ ID No.3)。
10 XTaq buffer, taq DNA polymerase, dNTP mix were all supplied by the division of biological engineering (Shanghai) Inc. (accession numbers B600001 and B110047).
PCR product analysis and genotyping
Blood samples of 386 sheep in total were collected from 13 sheep breeds, including 30 small tailed han sheep, 30 aletai sheep, 30 large tailed han sheep, 30 merino fine wool sheep, 30 awang sheep, 30 colored-tile sheep, 30 polymma sheep, 30 holba sheep, 24 dorame sheep, 30 safuck sheep, 30 hu sheep, 30 texel sheep, and 32 dupoise sheep. Each sheep was bled by jugular vein, ACD anticoagulated, and stored at-20deg.C. Sheep genomic DNA was extracted using a genome extraction kit (Tiangen Biochemical technology, DP 304) and tested for use.
Each sheep was subjected to PCR amplification using the following PCR system and PCR conditions, respectively, with the genomic DNA of each sheep as a template. The PCR system is shown in Table 1 below.
TABLE 1.25. Mu.L PCR reaction System
PCR reaction conditions: pre-denaturation at 94℃for 5min; PCR cycles, denaturation at 94℃for 30s, annealing at 60℃for 30s, extension at 72℃for 30s, total of 35 cycles, termination of extension at 72℃for 5min, and storage at 4 ℃.
5 mu L of PCR amplified product of each sheep is taken for 1.5% agarose gel electrophoresis detection, and gel imaging results show that: the detected PCR products of 386 sheep genomes showed 3 different banding patterns in 1.5% agarose gel electrophoresis, i.e., three genotypes were present in total in the detected sheep. Defining genotypes corresponding to different band types as an insertion/insertion genotype, an insertion/deletion genotype and a deletion/deletion genotype, wherein the insertion/deletion genotype is shown as two bands (2097 bp and 317bp, corresponding to SEQ ID No.1 and SEQ ID No.4 in the sequence Listing) located between 300-3000 bp; the insertion/insertion genotype is shown as a band (2097 bp, SEQ ID No.1 of the sequence Listing) at a position corresponding to a band located close to 3000bp between the two bands of the insertion/deletion genotype; the deletion/deletion genotype is shown as a band (317 bp, SEQ ID No.4 of the sequence Listing) at a position corresponding to a band located near 300bp of the two bands of the insertion/deletion genotype (FIG. 1).
SEQ ID No.1：
5’-GACATTGGAAAAGCAAGGAAAGCGATTTAGGCTCCATGTGATTATGGCCACGCTAGAATTAGATGTCATGARTGTTTTTATTTAATGACAGTGCAGCTTTTTCGCAACGGGTTTGCCGCCAGGACACAGGTGTCGTGAAAACCACCGTTAAACCTAAGCCAAAATGGGAAAGGAGAAGACCCACATCAACATCGTTGTCATTGGGCACGTAGATTCAGGGAAGTCTACCACGACTGGCCATCTGATCTACAAATGTGGCGGGATCGACAAGAGAACAATTGAAAAGTTCGAGAAGGAGGCAGCCGAGATGGGAAAGGGCTCCTTCAAATATGCCTGGGTCTTGGACAAACTGAAAGCTGAACGTGAGCGTGGTATTACCATTGATATCTCCCTGTGGAAGTTTGAGACCAGCAAGTACTATGTTACCATCATTGATGCCCCAGGACACAGAGACTTCATCAAAAACATGATTACAGGCACATCCCAGGCTGACTGTGCTGTCCTGATTGTTGCTGCTGGTGTTGGTGAATTTGAAGCCGGTATCTCCAAGAACGGGCAGACCCGTGAGCATGCCCTTCTGGCTTACACCCTGGGTGTGAAACAACTAATTGTTGGCGTTAACAAAATGGATTCTACTGAGCCACCCTATAGCCAGAAGAGATACGAGGAAATTGTTAAGGAAGTCAGCACCTACATTAAGAAAATTGGCTACAACCCCGACACAGTAGCATTTGTGCCAATTTCTGGCTGGAATGGTGACAACATGCTGGAGCCAAGTGCTAATATGCCATGGTTCAAGGGATGGAAAGTCACCCGTAAGGACGGCAATGCCAGTGGAACCACCCTGCTTGAAGCTCTGGATTGCATCCTGCCACCAACTCGCCCAACTGACAAACCCTTGCGTTTGCCTCTCCAGGATGTCTATAAAATTGGTGGTATTGGTACTGTACCTGTGGGTCGTGTGGAGACTGGTGTTCTCAAACCTGGCATGGTGGTCACCTTTGCTCCAGTCAATGTAACAACTGAGGTGAAGTCYGTAGAAATGCACCATGAAGCAYTGAGTGAAGCCCTTCCTGGGGACAATGTGGGCTTCAATGTCAAGAACGTGTCTGTCAAAGATGTCCGTCGTGGCAATGTGGCTGGTGACAGCAAAAATGATCCACCCATGGAAGCTGCTGGCTTCACAGCTCAGGTGATTATTTTGAACCATCCAGGCCAAATCAGTGCTGGATATGCACCTGTGCTGGATTGTCACACAGCTCACATTGCTTGCAAGTTTGCTGAGCTGAAGGAGAAGATTGATCGTCGTTCTGGGAAAAAGCTGGAAGATGGCCCTAAATTCTTGAAATCTGGTGACGCTGCCATCGTTGATATGGTTCCTGGCAAGCCTATGTGTGTCGAGAGCTTTTCTGATTATCCTCCCCTGGGCCGTTTTGCTGTGCGTGACATGAGACAGACAGTCGCTGTGGGTGTCATCAAAGCAGTGGACAAGAAGGCAGCTGGAGCTGGCAAGGTCACCAAGTCTGCCCAGAAAGCTCAGAAGGCTAAATGRATRTTATCCCCAATACCTGCCAYCCCAGTCTTAATCAGTGGTGGAAGAACGGTCTCAGAACTGTTTGTCTCAATTGGCCATTTAAGTTTAATAGTAAAAGACTGGTTAATGATAACAATGCATCGTAAAACCTTCAGAAGGAAAGGAGAATGTTTTTGTGGACCATATGTTTTGTGTGTGGCAGTTTAAGTTATTAGTTTTTAAAATCAGTACTTTTTAATGAAAACAACTTGACCAAAAATCTGTCACAGAATTTGAGACCCATTAAAAAAAGTTTAATGAGAAAAAAAAAAAAAAAAAAAAAAAAAAATAATGACAGTGCAACTCAATTTAAGAGCAGACTGTGCAGGGCCAAGGGGTGGGCATCCACTGGTAGGCTGGCCGTGCTGCAGAGATAGAGATCCACTGCCCATCAGCCTGCTGTTTATGGATCCATTAGTGCATCACAGGCATGTTGGGGTGAGGAGACCTTCAGGTACAGTCCTCAGTTAAACACCACGGCTGCCTTCGGAACGTCATGCCTGACACCCTCCTACTATGCTCCC-3’。
SEQ ID No.4：
5’-GACATTGGAAAAGCAAGGAAAGCGATTTAGGCTCCATGTGATTATGGCCACGCTAGAATTAGATGTCATGARTGTTTTTATTTAATGACAGTGCAACTCAATTTAAGAGCAGACTGTGCAGGGCCAAGGGGTGGGCATCCACTGGTAGGCTGGCCGTGCTGCAGAGATAGAGATCCACTGCCCATCAGCCTGCTGTTTATGGATCCATTAGTGCATCACAGGCATGTTGGGGTGAGGAGACCTTCAGGTACAGTCCTCAGTTAAACACCACGGCTGCCTTCGGAACGTCATGCCTGACACCCTCCTACTATGCTCCC-3’。
The gene frequencies and genotype frequencies for the different sheep breeds are shown in table 2. The PCR products of the 13 sheep breeds detected showed 3 bands (insertion/insertion genotype, insertion/deletion genotype, deletion/deletion genotype) by agarose electrophoresis. Wherein, the safucus sheep, the Hu sheep and the Texel sheep only show insertion/insertion genotypes; the large tail cold sheep, the Arwang sheep, the small tail cold sheep, the polymma sheep and the Hollana sheep only have deletion/deletion genotypes; the alentai sheep, chinese merino nap sheep, color tile sheep, duPop sheep have genotypes of not only one band but also two bands of insertion/deletion.
TABLE 2 Gene frequency and genotype frequency distribution for different sheep breeds
The method comprises the following steps: of the 30 small tailed han sheep detected, 30 PCR products showed a band (317 bp) in agarose gel, the position of which corresponds to a band near 300bp in both bands of the insertion/deletion genotype, and the genotype corresponding to the band was the deletion/deletion genotype.
Among 30 detected alemtai sheep, 7 PCR products are shown as two bands between 300-3000bp in agarose gel, and the corresponding genotype is an insertion/deletion genotype; the 23 PCR products showed a band in agarose gel, the position of which corresponds to a band near 300bp in both bands of the insertion/deletion genotype, and the genotype corresponding to the band was the deletion/deletion genotype.
The PCR products of 30 out of 30 detected large tailed han sheep showed a band in agarose gel, the positions of which correspond to bands near 300bp in both bands of insertion/deletion genotype, and the genotypes of which correspond to deletion/deletion genotype.
In 30 detected Chinese merino naps, 3 PCR products are shown as two bands between 300 and 3000bp in agarose gel, and the corresponding genotype is an insertion/deletion genotype; the 27 PCR products showed a band in agarose gel, the position of which corresponds to a band near 300bp in both bands of the insertion/deletion genotype, and the genotype corresponding to the band was the deletion/deletion genotype.
Of the 30 Arwang sheep detected, 30 PCR products showed a band in agarose gel corresponding in position to a band located near 300bp in both bands of the insertion/deletion genotype, which corresponds to the deletion/deletion genotype.
Of the detected israel sheep 30, 4 PCR products were shown in agarose gel as two bands between 300-3000bp, the corresponding genotypes were insertion/deletion genotypes; the 26 PCR products showed a band in agarose gel, the position of which corresponds to a band near 300bp in both bands of the insertion/deletion genotype, the genotype corresponding to the band was the deletion/deletion genotype.
Of the 30 polymma sheep detected, 30 PCR products were shown in agarose gel as a band at a position corresponding to a band near 300bp in both bands of the insertion/deletion genotype, the genotype corresponding to the band being the deletion/deletion genotype.
In 30 Hall sheep detected, the PCR products of 30 were all shown to be a band in agarose gel, the positions of which correspond to bands near 300bp in both bands of the insertion/deletion genotype, and the genotypes of which correspond to the deletion/deletion genotype.
Of 24 detected dormer sheep, 3 PCR products showed two bands between 300-3000bp in agarose gel, and the corresponding genotypes were insertion/deletion genotypes; the 21 PCR products showed a band in agarose gel at a position corresponding to a band near 3000bp in both bands of the insertion/deletion genotype, the genotype corresponding to the band was the insertion/insertion genotype.
Of the 30 samfic sheep detected, 30 PCR products were shown in agarose gel as a band at a position corresponding to a band near 3000bp in both bands of the insertion/deletion genotype, the genotype corresponding to the insertion/insertion genotype.
Of the 30 Hu sheep detected, 30 PCR products were shown in agarose gel as a band at a position corresponding to a band near 3000bp in both bands of the insertion/deletion genotype, the genotype corresponding to the insertion/insertion genotype.
Of the 30 detected texels, 30 PCR products were shown to be a band in agarose gel, corresponding in position to a band near 3000bp in both bands of the insertion/deletion genotype, which corresponds to the insertion/insertion genotype.
Of the 32 DuPoisson's detected, 14 PCR products showed two bands between 300-3000bp in agarose gel, the corresponding genotypes were insertion/deletion genotypes; the 18 PCR products showed a band in agarose gel at a position corresponding to a band near 3000bp in both bands of the insertion/deletion genotype, which corresponds to the insertion/insertion genotype.
PCR product sequencing analysis
The PCR products of each sheep were recovered separately for sequencing, and the results showed that: all insertion/insertion genotype and insertion/deletion genotype sheep individuals PCR products contain the 1780bp nucleotide sequence shown at positions 94-1873 of SEQ ID No. 1; the PCR products of all deletion/deletion genotype sheep individuals did not contain the 1780bp nucleotide sequence shown at positions 94-1873 of SEQ ID No. 1.
The insertion/deletion genotype is the 1780bp heterozygous gene pattern shown in the 94-1873 th position of the insertion SEQ ID No.1, the insertion/insertion genotype is the 1780bp homozygous gene pattern shown in the 94-1873 th position of the full insertion SEQ ID No.1, and the deletion/deletion genotype is the 1780bp homozygous gene pattern shown in the 94-1873 th position of the full no insertion SEQ ID No. 1.
4. Analysis of genotype versus sheep non-horn phenotype
By observing the adult sheep horn phenotype of 386 sheep in total of 13 sheep breeds in step 2, sheep with genotypes including the homozygous genotype of 1780bp DNA nucleotide sequence for insertion/insertion (2097 bp/2097 bp) and heterozygous genotype of insertion/deletion (2097 bp/317 bp) in the sheep genome were both hornless phenotypes, whereas sheep with genotypes without 1780bp DNA nucleotide sequence in the sheep genome (i.e. deletion/deletion homozygous genotype) were horny phenotypes, and the specific 386 sheep phenotype results are shown in Table 3.
TABLE 3 genotype frequencies and phenotype frequency distribution for different sheep breeds
Therefore, the reagent for detecting sheep horn shape provided by the application can be applied to early and rapid detection of sheep horn shape in actual production, is not limited by the age of sheep to be identified, can be screened even when the sheep is born, and accelerates the breeding process, thereby guiding livestock production.
The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains.
Claims (10)
1. A primer pair for identifying or assisting in identifying whether sheep is a polled sheep, characterized in that: the primer pair consists of single-stranded DNA of SEQ ID No.2 in the sequence table and SEQ ID No.3 in the sequence table.
2. The primer pair of claim 1, wherein: the sheep is at least one of small tailed sheep, arletia, large tailed sheep, chinese merino fine wool sheep, arwang sheep, color tile sheep, polymma sheep, hoba sheep, duowang sheep, safex sheep, hu sheep, texel sheep or Dupoff sheep.
3. A reagent and/or kit comprising a primer pair as claimed in claim 1 or 2.
4. A method for identifying or assisting in identifying sheep horn traits, comprising using genomic DNA of a sheep to be tested as a template, performing PCR amplification detection using the primer pair of claim 1 or 2 and/or the reagent and/or kit of claim 3 or 4, wherein the sheep to be tested containing nucleotide 94-1873 of SEQ ID No.1 in a sequence table in a PCR amplification product is a non-horned sheep or a candidate non-horned sheep; the PCR amplification product does not contain 94 th-1873 th nucleotide of SEQ ID No.1 in the sequence table, and the sheep to be detected is horned sheep or candidate horned sheep.
5. The method according to claim 4, wherein: the sheep is at least one of small tailed sheep, arletia, large tailed sheep, chinese merino fine wool sheep, arwang sheep, color tile sheep, polymma sheep, hoba sheep, duowang sheep, safex sheep, hu sheep, texel sheep or Dupoff sheep.
6. A method of breeding a non-horned sheep comprising: using genome DNA of sheep to be detected as a template, performing PCR amplification detection by using the primer pair of claim 1 or 2 and/or the reagent and/or the kit of claim 3 or 4, and selecting sheep containing 94 th-1873 th nucleotide of SEQ ID No.1 in a sequence table in PCR amplification products as parents or candidates for breeding.
7. The method according to claim 6, wherein: the sheep is at least one of small tailed sheep, arletia, large tailed sheep, chinese merino fine wool sheep, arwang sheep, color tile sheep, polymma sheep, hoba sheep, duowang sheep, safex sheep, hu sheep, texel sheep or Dupoff sheep.
8. Use of a primer pair according to claim 1 or 2 for any of the following:
c1 Use of a marker for identifying or aiding in the identification of a sheep non-angular trait product;
c2 Use in the breeding of polled sheep;
c3 For the preparation of a product for detecting or assisting in detecting breeding of a non-horned sheep.
9. Use of the reagent and/or kit of claim 3 for any of the following:
d1 Use in the identification or assisted identification of the non-angular character of sheep;
d2 Use of a marker for identifying or aiding in the identification of a sheep non-angular trait product;
d3 Use in the breeding of polled sheep;
d4 Use in the preparation of a pollenless sheep breeding product.
10. Use according to claim 8 or 9, characterized in that: the sheep is at least one of small tailed sheep, arletia, large tailed sheep, chinese merino fine wool sheep, arwang sheep, color tile sheep, polymma sheep, hoba sheep, duowang sheep, safex sheep, hu sheep, texel sheep or Dupoff sheep.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310893174.4A CN116732196A (en) | 2023-07-19 | 2023-07-19 | Primer pair, reagent and/or kit and method for rapid identification or auxiliary identification of sheep hornless character |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310893174.4A CN116732196A (en) | 2023-07-19 | 2023-07-19 | Primer pair, reagent and/or kit and method for rapid identification or auxiliary identification of sheep hornless character |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116732196A true CN116732196A (en) | 2023-09-12 |
Family
ID=87906124
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310893174.4A Pending CN116732196A (en) | 2023-07-19 | 2023-07-19 | Primer pair, reagent and/or kit and method for rapid identification or auxiliary identification of sheep hornless character |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116732196A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105483125A (en) * | 2015-12-31 | 2016-04-13 | 中国农业科学院北京畜牧兽医研究所 | RXDP2 gene SNP marking composition related to sheep horn phenotype and application thereof |
| CN113278714A (en) * | 2021-07-23 | 2021-08-20 | 中国农业大学 | Gene chip for analyzing whether sheep has horns or not, molecular probe combination, kit and application |
| WO2022151020A1 (en) * | 2021-01-13 | 2022-07-21 | 深圳华大生命科学研究院 | Nucleic acid molecule related to type of goat horn and use thereof |
| CN115747347A (en) * | 2022-12-23 | 2023-03-07 | 江苏乾宝牧业有限公司 | SNP molecular marker related to Hu sheep horn type, amplification primer and kit, application of SNP molecular marker, amplification primer and kit, and method for judging Hu sheep horn type |
| CN115820866A (en) * | 2022-07-07 | 2023-03-21 | 新疆农垦科学院 | Molecular marker, primer pair, kit and identification method related to sheep double muscle phenotype traits |
-
2023
- 2023-07-19 CN CN202310893174.4A patent/CN116732196A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105483125A (en) * | 2015-12-31 | 2016-04-13 | 中国农业科学院北京畜牧兽医研究所 | RXDP2 gene SNP marking composition related to sheep horn phenotype and application thereof |
| WO2022151020A1 (en) * | 2021-01-13 | 2022-07-21 | 深圳华大生命科学研究院 | Nucleic acid molecule related to type of goat horn and use thereof |
| CN113278714A (en) * | 2021-07-23 | 2021-08-20 | 中国农业大学 | Gene chip for analyzing whether sheep has horns or not, molecular probe combination, kit and application |
| CN115820866A (en) * | 2022-07-07 | 2023-03-21 | 新疆农垦科学院 | Molecular marker, primer pair, kit and identification method related to sheep double muscle phenotype traits |
| CN115747347A (en) * | 2022-12-23 | 2023-03-07 | 江苏乾宝牧业有限公司 | SNP molecular marker related to Hu sheep horn type, amplification primer and kit, application of SNP molecular marker, amplification primer and kit, and method for judging Hu sheep horn type |
Non-Patent Citations (4)
| Title |
|---|
| GESINE LÜHKEN 等: "The 1.78-kb insertion in the 3 ′-untranslated region of RXFP2 does not segregate with horn status in sheep breeds with variable horn status", GENET SEL EVOL, vol. 48, pages 1 - 14 * |
| LUHKEN, G.等: "OVis aries RXFP2 gene, 3\'UTR", GENE BANK, pages 084522 * |
| LUHKEN, G.等: "Ovis aries RXFP2 gene, 3UTR", GENE BANK, pages 084523 * |
| 楚康康，等: "SYNJ1基因SNPs与牛、绵羊角的关联性研究", 河南农业科学, vol. 40, no. 7, pages 158 - 160 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108410994B (en) | SNP marker influencing Hu sheep lambing traits and application thereof | |
| CN108424958B (en) | SNP (Single nucleotide polymorphism) marker related to genetic sex of large yellow croaker as well as primer and application thereof | |
| CN107475412B (en) | Molecular marker related to egg-laying traits of chickens and application of molecular marker in chicken breeding | |
| CN111996264B (en) | Application of pig SNP molecular marker in pig breeding character screening and pig breeding | |
| CN106811540B (en) | Microsatellite marker and specific primer for identifying male and female individuals of Pseudobagrus ussuriensis and application of microsatellite marker and specific primer | |
| CN109680070B (en) | SNP (Single nucleotide polymorphism) marker and molecular marker remarkably related to Australia white sheep hoof color and application | |
| CN111378731B (en) | Sex-specific molecular marker primer for Trachinotus ovatus and application of sex-specific molecular marker primer | |
| CN114317781B (en) | Molecular marker related to long and short velvet characters of pigeons and application of molecular marker | |
| CN111206082B (en) | Sex-specific molecular marker primer and kit for Trachinotus ovatus and application of sex-specific molecular marker primer and kit | |
| CN113151361A (en) | Method for cultivating crucian carp strain without muscle intermingled bones | |
| CN105441536B (en) | SNP marker for discriminating sex in paralichthys olivaceus | |
| JP2008526252A (en) | DNA markers for bovine growth | |
| CN111073983B (en) | SNP marker related to identification of northern subspecies and Florida subspecies of largemouth bass and application thereof | |
| CN110079613B (en) | Molecular marker of heat stress tolerance of Holstein cattle and detection method | |
| CN109439771B (en) | Method for identifying family of hybrid porgy by using microsatellite marker | |
| CN116732196A (en) | Primer pair, reagent and/or kit and method for rapid identification or auxiliary identification of sheep hornless character | |
| CN115820876A (en) | Molecular marker combination for determining feather color of chicken and application method thereof in breeding | |
| CN111705144B (en) | SINE transposon polymorphic molecular marker in ZNF2 gene related to pig backfat thickness and detection method thereof | |
| CN114990233A (en) | SNPs (single nucleotide polymorphisms) marker related to genetic sex of Chinese softshell turtles as well as primer and application thereof | |
| CN114317780A (en) | SNP molecular marker related to chicken prematurity and application | |
| CN113684285A (en) | Trachinotus ovatus cryptocaryon irritans disease associated SNP molecular marker, primer and application thereof | |
| US20020142315A1 (en) | DNA marker for cattle growth | |
| CN113373142B (en) | Molecular marker-assisted selection method for pig backfat thickness and application thereof | |
| CN108165640B (en) | SNP locus related to resistance or susceptibility of diarrhea of suckling piglet and molecular marker detection and application | |
| CN117925859B (en) | Molecular marker specific primer related to pigeon pale feather character and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |