CN116732067A

CN116732067A - Lysine cyclodeaminase gene and application thereof

Info

Publication number: CN116732067A
Application number: CN202310185557.6A
Authority: CN
Inventors: 吴雄龙; 徐正军; 宋祥廷; 刘文杰; 邱贵森
Original assignee: Mojia Shanghai Biotechnology Co ltd
Current assignee: Mojia Shanghai Biotechnology Co ltd
Priority date: 2023-03-01
Filing date: 2023-03-01
Publication date: 2023-09-12

Abstract

The invention provides a codon-optimized lysine cyclodeaminase gene from Actinoplanes nipponensis and application thereof, wherein the lysine cyclodeaminase gene comprises a nucleotide sequence shown as SEQ ID No. 1. The invention also provides application of the lysine cyclodeaminase in preparation of the piperidinecarboxylic acid. The preparation method of the piperidinecarboxylic acid is simple and efficient, and has value in practical production.

Description

Lysine cyclodeaminase gene and application thereof

Technical Field

The invention belongs to the field of biological enzyme catalytic synthesis and is used for efficient green preparation of L-piperidinecarboxylic acid.

Background

L-piperidinecarboxylic acid (L-Picolinic acid, L-PA for short) is a natural non-protein amino acid and is widely applied to the preparation of chiral drugs and bioactive compounds. Such as topical ropivacaine, antipsychotic thioridazine, immunosuppressant rapamycin, and antitumor antibiotics, etc., are prepared from piperidine acid or its derivatives as main materials (CN 109402099 (B)).

At present, the preparation method of the L-piperidinecarboxylic acid mainly comprises chemical asymmetric synthesis, photocatalytic synthesis, biocatalytic synthesis and other methods. Chemical asymmetric synthesis has a large amount of byproducts and has great pollution to the environment; the photocatalysis synthesis has strict requirements on the reaction condition and the device; compared with the two methods, the biocatalytic synthesis has obvious advantages of mild reaction conditions, good substrate specificity, pure chirality of the product and the like (XuX, rao Z M, xu J Z, et al, enhancement of L-Pipecolic Acid Production byDynamic Control of Substrates and Multiple Copies of the pipAGene in theEscherichia coli Genome [ J ]. ACS Synthetic Biology,2022 (2): 11.). In recent years, the synthesis of biological enzymes has been receiving more and more attention and research.

The enzymatic synthesis of piperidine formic acid is divided into two types, one of which is obtained by one-step catalysis of lysine cyclodeaminase; the other is obtained by two-step catalysis, wherein the two-step catalysis is divided into a P2C pathway and a P6C pathway according to different amino positions of lysine oxidation. The one-step method has relatively more researches due to simple process, the current maximum yield is 724mM/L, the reaction is needed for 6 days, and the space-time yield is 0.78g/L/H (Han Y H, choi T R, park Y L, et al. Enhancement of pipecolic acid production by the expression of multiple lysinecyclodeaminase in the Escherichia coli whole-cell system [ J ]. Enzyme and MicrobialTechnology,2020,140:109643 ]); after modification of the lysine cyclodeaminase from Streptomyces pristinaispiralis by means of the university of Nanjing Industrial, et al Chen Kequan, the maximum yield of the reaction for 4 days was only 73.4g/L and the space-time yield was 0.83g/L/H (YING H, jing W, shi T, et al engineering oflysine cyclodeaminase conformational dynamics for relieving substrate and productinhibitions in the biosynthesis of L-picolic acid [ J ]. Catalysis Science & Technology,2019,9 (2): 398-405). The two-step synthesis method mainly comprises the steps of forming tetrahydropyridine formic acid by oxidase or transaminase and then reducing by reductase to obtain the piperidine formic acid, wherein the maximum yield reported in the current research is 46.7g/L and the maximum space-time yield is 2.41g/L/h (J.Cheng, Y.Huang, L.Mi, W.Chen, D.Wang, Q.Wang, an economically and environmentally acceptable synthesis of chiral drugintermediate L-pipecolic acid from biomass-derived lysine via artificially engineeredmicrobes, journal of industrial microbiology and biotechnology 45 (6) (2018) -415). From the industrial point of view, the catalytic efficiency of synthesizing the piperidine formic acid by the enzymatic method needs to be improved.

The main synthesis mode of the current piperidine formic acid is a chemical synthesis method, and the chemical synthesis method has a large amount of byproducts and serious environmental pollution; biocatalysis methods suffer from low catalytic efficiency, long reaction time, and difficulty in industrial application.

Disclosure of Invention

Aiming at the defects and actual demands of the prior art, the invention provides a high-efficiency lysine cyclodeaminase gene which is derived from Actinopanese Nipponensis and is subjected to codon optimization and application thereof. By codon optimization of the lysine cyclodeaminase gene derived from Actinoplanes nipponensis, efficient and high-yield preparation of the piperidinecarboxylic acid is realized.

The inventor of the patent obtains a high-efficiency lysine cyclodeaminase by codon optimization based on an ornithine cyclodeaminase family protein gene sequence (NCBI Reference Sequence:WP_ 203776928.1) which is disclosed by NCBI and is derived from Actinoplanes nipponensis, the catalytic efficiency capability of the high-efficiency lysine cyclodeaminase is far higher than the yield level of the enzymatic synthesis of the piperidine formic acid, and the gene is not reported in related researches.

To achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a codon-optimised lysine cyclodeaminase gene derived from Actinoplanes nipponensis, said codon-optimised lysine cyclodeaminase gene comprising the nucleotide sequence shown in SEQ ID No. 1.

SEQ ID No.1：

ATGGATACCCTGCTGCTGACCCGCCAGCATGTGGCGAAACTGGTGGAAACCAACGGCCGCGATCATTTTATGGATCTGCTGATTCGCAACCTGCGCACCGCGTTTAGCGCGGATGCGAAAGGCCATACCCCGCCGCGCGGCGGCTTTCTGCGCGGCGCGGGCGATACCGGCGTGATTGAATGGATGCCGCATCATCGCGCGGGCGAAAGCATGACCATGAAAATGGTGGCGTATACCCCGAGCAACCCGGCGCGCCTGAACCTGCCGACCATTATTGGCACCCTGACCCGCTATGATGATGTGACCGGCCATCTGCAGGCGGTGAGCGATGGCGTGCTGCTGACCGCGTTTCGCACCGGCGCGGCGAGCGCGGTGGCGAGCAGCCTGCTGGCGCGCCCGGGCAGCCGCACCCTGGGCCTGGTGGGCGCGGGCGCGCAGGCGGTGACCCAGGCGCATGCGCTGAGCCGCGTGTTTCCGCTGGAACGCATTCTGGTGGCGGATGCGGATCCGGCGCATGCGCGCAGCTATCCGGATCGCGTGGATTTTCTGGGCCTGGATGTGCGCGTGGCGGGCGTGGAAGAAATTGAACGCGAAAGCGATATTATTTGCACCGCGACCACCGTGGGCGTGGGCGCGGGCCCGGTGCTGCCGGGCGCGGGCCTGCGCCCGGATGTGCATATTAACGCGGTGGGCGCGGATCTGGTGGGCAAATTTGAACTGCCGCTGGCGGTGCTGCGCGGCGCGACCGTGGTGCCGGATCATTTTGCGCAGGCGCGCGCGGAAGGCGAATGCCAGCAGCTGACCGATGAAGAAGTGGGCCCGGATCTGATGACCCTGTGCGCGCGCCCGCAGGATGCGGTGCCGCTGCGCACCCGCCGCACCGTGTTTGATAGCACCGGCTTTGCGCTGGAAGATCATGTGGCGTTTAGCACCCTGATTGAACTGGCGGCGGAAGCGGGCGTGGGCGATCGCGTGAGCCTGGAACATCTGCCGGAAGATGCGCTGAACCCGTATAGCTAG

In the invention, ornithine cyclodeaminase family protein gene sequences derived from Actinoplanes nipponensis are optimized, and creatively applied to efficient and high-yield preparation of piperidinecarboxylic acid as lysine cyclodeaminase.

In a second aspect, the present invention provides a recombinant vector comprising the gene according to the first aspect.

Preferably, the recombinant vector is a recombinant pET28a, pCDFDuet1, pACYCDuet-1, pETDuet-1, pRSFDuet-1 vector or a combination thereof containing the gene of the first aspect.

Preferably, the recombinant vector is a recombinant pET28a vector comprising the gene of the first aspect.

In a third aspect, the present invention provides a recombinant cell comprising a gene according to the first aspect.

Preferably, the recombinant cell contains the recombinant vector of the second aspect.

Preferably, the recombinant cell is an E.coli, bacillus subtilis, yeast or Aspergillus cell containing the recombinant vector of the second aspect.

Preferably, the E.coli cells comprise BL21.

In a fourth aspect, the present invention provides a lysine cyclodeaminase expressed by the recombinant cell of the third aspect.

In a fifth aspect, the present invention provides the use of a lysine cyclodeaminase as described in the fourth aspect for the preparation of piperidine carboxylic acid.

Wherein the pH during the preparation is 6.0-8.0, preferably 6.0, 6.5, 7.0, 7.5 or 8.0, more preferably 6.0 or 6.5. The pH buffer is preferably PBS.

The preparation temperature is 20-60 ℃, preferably 20, 30, 35, 40, 50 or 60 ℃, more preferably 40, 50 or 60 ℃.

The lysine substrate concentration is 5 to 100g/L, preferably 5, 10, 20, 30, 40, 50, 60, 80 or 100g/L, more preferably 5, 10, 20 or 30.

The cell addition amount is 10-100g/L, preferably 40, 50, 60, 80 or 100g/L.

Preferably, the lysine cyclodeaminase of the fourth aspect is reacted for 24 hours under conditions of initial 30g/L of lysine and fed-batch, 2.5mM FeSO4,0.1%Triton, final concentration of 50g/L of wet cells, pH6.5, 37℃and the like to prepare piperidine formic acid.

Compared with the prior art, the invention has the following beneficial effects:

the invention optimizes the codon of ornithine cyclodeaminase family protein gene sequence from Actinoplanes nipponensis and is used as lysine cyclodeaminase (AcnLcd) to efficiently prepare the piperidinecarboxylic acid;

for AcnLcd, in the case of fed-batch lysine, the space-time yield can reach the level of 4.5g/L/h within 10h before the reaction, the yield of the pipecolic acid can be accumulated to 63g/L (2.63 g/L/h) after the reaction is finished for 24h, and the catalytic efficiency of the lysine cyclodeaminase is highest in the literature of the currently available one-step synthesis of the pipecolic acid; even the highest space-time yield of 2.41g/L/h compared with the literature for the synthesis of piperidine carboxylic acid in two steps is improved by 9%.

The preparation method is simple, efficient, scientific and reasonable, and has value applied to production practice.

Drawings

Fig. 1A: acnLcd SDS-PAGE electrophoresis pattern; m: marker, T total protein, S supernatant.

Fig. 1B: stpLcd SDS-PAGE electrophoresis; m: marker, S, supernatant, P, precipitate.

Fig. 2: HPLC profile; and (3) injection: acnLcd is a target enzyme catalytic product, lys is Lysine; L-PA, piperidine formic acid.

Fig. 3: an NMR spectrum; L-PA: a piperidine formic acid standard; acnLcd, the product of the catalytic reaction of AcnLcd.

Fig. 4: a plot of pH versus yield of piperidine carboxylic acid was prepared.

Fig. 5: preparation temperature versus yield of piperidine carboxylic acid.

Fig. 6: lysine concentration versus yield of piperidine carboxylic acid.

Fig. 7: cell addition versus yield of piperidine formate.

Fig. 8: lysine consumption and piperidine formic acid yield.

Detailed Description

The technical means adopted by the invention and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.

The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.

Example 1: preparation and characterization of AcnLcd

The lysine cyclodeaminase gene shown in SEQ ID No.1, abbreviated as AcnLcd, was obtained by codon optimization based on the ornithine cyclodeaminase family protein sequence derived from Actinoplanes nipponensis (NCBI Reference Sequence:WP_ 203776928.1) disclosed by NCBI.

SEQ ID No.1：

In addition, the lysine cyclodeaminase gene StpLcd (CN 109402099B) characterized by the university of Nanjing Industrial science Chen Kequan teaches a laboratory is the prior art with higher yield of the piperidine formic acid prepared by the currently known enzymatic method, and the nucleic acid sequence of the lysine cyclodeaminase gene StpLcd is shown as SEQ ID No. 2.

SEQ ID No.2：

ATGGAAACTTGGGTTTTAGGTCGTCGTGATGTTGCAGAAGTTGTTGCAGCAGTTGGTCGTGATGAATTAATGCGTCGTATTATCGATCGTTTAACTGGTGGTTTAGCAGAAATTGGTCGTGGTGAACGTCATTTATCTCCATTACGTGGTGGTTTAGAACGTTCTGAACCAGTTCCAGGTGTGTGGGAATGGATGCCACATCGTGAACCAGGTGATCATATTACTTTAAAAACTGTTGGTTATTCTCCAGCAAATCCAGGTCGTTTTGGTTTACCAACTGTGTTAGGTACCGTTGCACGTTATGATGATACTACTGGTGCATTAACTGCATTAATGGATGGTGTTTTATTAACTGCATTACGTACTGGTGCAGCATCTGCTGTTGCATCTCGTTTATTAGCACGTCCAGATTCTCATACTTTAGGTTTAATTGGTACTGGTGCACAAGCAGTTACTCAATTGCATGCATTATCTTTAGTTTTACCATTACAACGTGCATTAGTTTGGGATACTGATCCAGCACATCGTGAATCTTTTGCACGTCGTGCAGCATTTACTGGTGTTTCTGTTGAAATTGCAGAACCAGCACGTATTGCAGCAGAAGCAGATGTTATTTCTACTGCAACTTCTGTTGCAGTTGGTCAAGGTCCAGTTTTACCAGATACTGGTGTTCGTGAACATTTACATATTAATGCAGTTGGTGCAGATTTAGTTGGTAAAACTGAATTACCATTAGGTTTATTAGAACGTGCATTTGTTACTGCAGATCATCCAGAACAAGCATTACGTGAAGGTGAATGTCAACAATTATCTGCTGATCGTTTAGGTCCACAATTAGCACATTTATGTGCAGATCCAGCAGCAGCAGCAGGTCGTCAAGATACTTTATCTGTTTTTGATTCTACTGGTTTTGCATTTGAAGATGCATTAGCAATGGAAGTTTTTTTAGAAGCAGCAGCAGAACGTGATTTAGGTATTCGTGTTGGTATTGAACATCATCCAGGTGATGCATTAGATCCATATGCATTACAACCATTACCATTACCATTAGCAGCACCAGCACAT

The nucleic acid sequences of the AcnLcd (SEQ ID No. 1) and the StpLcd (SEQ ID No. 2) are respectively synthesized on a pET28a vector to obtain recombinant vectors pET28a-AcnLcd and pET28a-StpLcd.

Transforming pET28a-AcnLcd and pET28a-StpLcd into BL21 host, culturing overnight at 37 ℃, selecting 3-4 single colonies for PCR verification, inoculating the single colonies after PCR verification into 5mL kanamycin LB liquid seed culture medium containing 50ug/mL (the same applies below), and culturing at 37 ℃ and 200rpm until turbidity; 2% seed solution was inoculated into 50ml kanamycin LB liquid medium, OD600 was cultured to 0.6-0.8, 0.1mM IPTG was added to the medium, and the medium was induced at 25℃for 20 hours at 200 rpm. Centrifugation at 8000rpm at 4℃for 10min, and the supernatant was discarded; adding appropriate amount of buffer, resuspension and washing for two times, centrifuging at 5000 rpm and 4 ℃ for 10min, discarding supernatant, taking part of precipitate, resuspension and crushing, and preserving the rest for later use. The disrupted bacterial solution was centrifuged, and the supernatant and pellet were subjected to SDS-PAGE gel running verification, respectively, and the results are shown in FIG. 1.

Characterization of the activity of AcnLcd in preparation of piperidine carboxylic acid:

reaction conditions: PBS pH7.0, 30g/L Lys,50g/L wet cell, 2.5mM FeSO4,0.1%Triton, with no cell added as control, at 37℃at 200 rpm. 8000rpm after the reaction is finished, centrifuging for 10min, taking supernatant, sending a part of the supernatant to a nuclear magnetism device, sending a part of the supernatant to a liquid phase device to detect the content of L-piperidine carboxylic acid, and carrying out derivatization on the piperidine carboxylic acid before detection, wherein the specific derivatization process is as follows:

derivatization procedure:

1) Standard control, sample solution, blank (distilled water) were each accurately removed by 100 μl into a different 15mL plastic-tipped centrifuge tube, 100 μl sodium bicarbonate solution, 100 μl derivatizing reagent, 200 μl acetonitrile (note that no residue on the tube wall, if any, was added, and the tube wall was rinsed with the final 200 μl methanol). The cap was screwed on and vortexed for 10s.

2) The mixed solution is placed in a water bath at 60 ℃ and is derivative for 20min in a dark place. Then, the reaction was terminated by adding 1mL of a potassium dihydrogen phosphate solution, followed by adding 1mL of methanol and 7.5mL of distilled water. Covering the cover, and mixing.

3) The solution was filtered through a filter membrane and used for HPLC detection.

Chromatographic detection conditions:

chromatographic column: thermo BDS Hypersil C18, 100mm by 2.1mm by 2.4um

Mobile phase a: water +0.1% acetic acid +0.1% triethylamine

Mobile phase B: acetonitrile

Flow rate: 0.5ml/minute

Detection wavelength: 360nm of

Column temperature: 40 DEG C

Sample injection amount: 2 mu L

Run time: 5min

Elution gradient:

and (3) calculating results:

the peak areas of the spectra of the control and the sample were recorded.

Wherein:

sample a: sample solution peak area;

a is as follows: standard solution peak area;

c sample: sample solution concentration, mg/mL;

c, marking: standard solution concentration, mg/mL.

The relative deviation of the two parallel measurement results is less than or equal to 2.0 percent after the two parallel measurement results are reserved to 1 position after the decimal point.

Characterization of enzymatic properties of AcnLcd for the preparation of piperidine carboxylic acid:

1) And (5) testing pH stability. Changing the reaction pH, and reacting at 37 ℃ for 12 hours in 10g/L lysine, 2.5mM FeSO4,0.1%Triton and 10g/L final concentration wet cells under other conditions;

2) And (5) testing temperature stability. The reaction temperature was changed, and other conditions were unchanged, and the reaction was carried out at 10g/L lysine, 2.5mM FeSO4,0.1%Triton, a final concentration of 10g/L wet cells, pH7.0 for 12 hours;

3) Substrate concentration affects the assay on AcnLcd activity. Changing the substrate lysine concentration, keeping other conditions unchanged, and reacting at 2.5mM FeSO4,0.1%Triton, pH7.0 and 37 ℃ for 12 hours on wet cells with a final concentration of 10 g/L;

4) Cell addition was tested for relation to yield of piperidine formate. The amount of cells was changed, and other conditions were not changed, and the reaction was carried out at 37℃for 12 hours with 20g/L of lysine, 2.5mM FeSO4,0.1%Triton,pH7.0.

Analysis of results:

expression and identification

SDS-PAGE results are shown in FIG. 1A and FIG. 1B, and AcnLcd, stpLcd successfully achieved expression in BL21 E.coli hosts. Activity characterization HPLC of AcnLcd for preparing the piperidinecarboxylic acid is shown in figure 2, and a corresponding product peak appears at the peak position of the standard product piperidinecarboxylic acid; the nuclear magnetic resonance identification is shown in figure 3, and compared with the standard piperidine formic acid, the corresponding peak position of the corresponding characteristic peak appears, and the generated product is further verified to be piperidine formic acid.

Enzymatic Properties

PBS buffer at pH6.5 (FIG. 4), which is most suitable for long-term reactions; the most suitable temperature for long-term reaction is 50 ℃ (figure 5); the substrate inhibition experiment shows (figure 6) that when the concentration of the substrate Lysine exceeds 30g/L, the whole reaction process is obviously slowed down, and in order to improve the reaction efficiency, the substrate Lysine is taken as the initial substrate concentration, and fed in batches; the relationship between the cell amount and the yield of the piperidinecarboxylic acid revealed that the yield of the piperidinecarboxylic acid and the cell amount were positively correlated, and that the wet cell amount of 50g/L was used as the reaction cell amount in the following steps, in terms of the overall efficiency and cost.

Example 2: comparison of catalytic efficiency of AcnLcd and StpLcd

StpLcd activity determination conditions reference and patent (YerH, jing W, shi T, et al engineering of lysine cyclodeaminase conformational dynamics for relievingsubstrate and product inhibitions in the biosynthesis of L-picolinic acid [ J ]. Catalysis science & Technology,2019,9 (2): 398-405;CN109402099B) optimal reaction conditions were determined, and the reaction was performed at 37℃for 96 hours in 2.5mM FeSO4,0.1%TritonX100,100mM pH7.0 HEPES-NaOH buffer, 50g/L lysine and fed twice, 50g/L cell addition.

Reaction conditions for AcnLcd according to the optimized parameters characterized by the enzymatic properties of AcnLcd in example 1, the reaction was performed at 50g/L cell addition, 30g/L lysine, 2.5mM FeSO4,0.1%TritonX100,100mM PBS buffer pH6.5,50 ℃. And sampling and monitoring consumption of lysine every 1h, and determining feeding time of substrate lysine.

Comparison of results:

for Stplcd, reference (YING H, jing W, shi T, et al engineering of lysinecyclodeaminase conformational dynamics for relieving substrate and productinhibitions in the biosynthesis of L-picolinic acid [ J ]. Catalysis Science & Technology,2019,9 (2): 398-405.) reacted for 96 hours with a yield of 42.6g/L (0.443 g/L/H) of picolinic acid, reaching a level of 73.4g/L (0.83 g/L/H) below the 96 hours reported in the literature.

For AcnLcd, in the case of two feeds (FIG. 8), the space-time yield can reach a level of 4.5g/L/h within 10h before the reaction. At relatively high temperatures, the activity gradually decreases with increasing reaction time, the reaction ends up at 24 hours, and the yield of piperidinecarboxylic acid can accumulate to 63g/L (2.63 g/L/h). In comparison, the catalytic efficiency of this lysine cyclodeaminase is highest in the literature on the synthesis of piperidine formic acid by the currently available one-step method.

The Han Y H et al optimized the PipA (StpLcd) lysine cyclodeaminase in each direction, reacted for 144H with a final yield of 93.5g/L, which is the highest yield reported so far, but the cell usage was 4 times that of AcnLcd, and there were problems of too long reaction time, low space-time yield, etc. (Han Y H, choi T R, park Y L, et al, enhancement of pipecolic acid production by the expression of multiple lysinecyclodeaminase in the Escherichia coli whole-cell system [ J ]. Enzyme and microbialtechnology,2020, 140:109643.). In the two-stage synthesis, J.Cheng et al achieved a maximum yield of 46.7g/L and a space-time yield of 2.41g/L/h, which was also slightly lower than the catalytic level of AcnLcd (J.Cheng, Y.Huang, L.Mi, W.Chen, D.Wang, Q.Wang, an economically and environmentallyacceptable synthesis of chiral drug intermediate L-pipecolic acid frombiomass-derived lysine via artificially engineered microbes, journal of industrialmicrobiology & biotechnology 45 (6) (2018) -415).

In summary, acnLcd (SEQ ID No. 1) is obtained by codon optimization of ornithine cyclodeaminase family protein gene sequence derived from Actinoplanes nipponensis and is used as lysine cyclodeaminase for preparing piperidine formic acid. The lysine cyclodeaminase can be used for efficiently preparing the piperidinecarboxylic acid by a one-step method, the space-time yield can reach 2.63g/L/h, and the application prospect is wide.

The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.

Claims

1. A lysine cyclodeaminase gene, characterized in that the lysine cyclodeaminase gene comprises a nucleotide sequence shown in SEQ ID No. 1.

2. A recombinant vector comprising the lysine cyclodeaminase gene of claim 1;

preferably, the recombinant vector is a recombinant pET28a vector containing the lysine cyclodeaminase gene of claim 1.

3. A recombinant cell comprising the lysine cyclodeaminase gene of claim 1;

preferably, the recombinant cell contains the recombinant vector of claim 2;

preferably, the recombinant cell is an E.coli cell comprising the recombinant vector of claim 2;

preferably, the E.coli cells comprise BL21.

4. A lysine cyclodeaminase, characterized in that it is expressed by the recombinant cell of claim 3.

5. Use of a lysine cyclodeaminase as claimed in claim 4 for the preparation of L-piperidinecarboxylic acid.

6. Use according to claim 5, wherein a pH of 6.0-8.0, preferably 6.0, 6.5, 7.0, 7.5 or 8.0, more preferably 6.0 or 6.5, is prepared, the pH buffer preferably being a PBS buffer.

7. Use according to claim 5, wherein the preparation temperature is 20-60 ℃, preferably 20, 30, 35, 40, 50 or 60 ℃, more preferably 40, 50 or 60 ℃.

8. Use according to claim 5, wherein the lysine substrate concentration is 5-100g/L, preferably 5, 10, 20, 30, 40, 50, 60, 80 or 100g/L, more preferably 5, 10, 20 or 30.

9. Use according to claim 5, wherein the amount of cells added is 10-100g/L, preferably 40, 50, 60, 80 or 100g/L.

10. The use according to claim 5, wherein the lysine cyclodeaminase of claim 4 is reacted for 24 hours under conditions of initial 30g/L lysine and fed-batch, 2.5mM FeSO4,0.1%Triton, wet cells with final concentration of 50g/L, ph6.5, 37 ℃ and the like to prepare piperidine formic acid.