CN116732028A - Method for inhibiting Zika virus based on CRISPR-CAS13 system intervention and application - Google Patents

Abstract

The application provides a method for inhibiting Zika virus based on CRISPR-CAS13 system intervention and application thereof. Zika virus (ZIKA) has a high degree of variability as an RNA virus, and drug design therefor is difficult in the art. The inventor aims at finding a target suitable for ZIKA virus inhibition, performs extensive and massive analysis work on ZIKA virus genome, and discloses a method for interfering or inhibiting Zika virus based on a CRISPR-Cas13 (preferably Cas13 b) system and a reagent for targeted inhibition.

Description

Method for inhibiting Zika virus based on CRISPR-CAS13 system intervention and application

Technical Field

The application belongs to the field of virology and the field of gene technology, and in particular relates to a method for inhibiting Zika virus based on CRISPR-CAS13 system intervention and application thereof.

Background

Zika virus (ZIKV) is a single-stranded positive strand RNA virus transmitted by mosquito and belongs to the genus Flaviviridae (Alam A et al: recent trends in ZikV research: 390A step away from cure.Biomed Pharmacother 2017, 91:1152-1159). Zika virus has characteristics similar to Yellow Fever Virus (YFV), dengue virus (DENV), japanese Encephalitis Virus (JEV) and West Nile Virus (WNV), and causes mild to severe life-threatening infections in humans. In the Pacific region before 2007, when the onset of Zika virus infection occurred, few cases of human infection occurred (Gouretat AC et al Detection of Zika virus in urine [ J ]. Emerg information Dis,2015, 21 (1): 84-6). However, from 2015, zika virus traversed the Pacific and caused more than 100 tens of thousands of infection cases in Brazil (Zanluca C et al First report of autochthonous transmission of Zika virus in Brazil [ J ]. Mem Inst Oswaldo Cruz,2015, 110 (4): 569-72). By month 5 of 2019, the virus rapidly spread to 84 countries and regions has become a public health problem worldwide (Hamelin ME et al, oseltamivir-resistant pandemic A/H1N1 virus is as virulent as its wild-type counterpart in mice and ferrets [ J ]. PLoS Pathog,2010,6 (7): e 1001015). Methods for ZIKV infection include vaccine development and screening for antiviral drugs that inhibit different stages of the viral life cycle (Batista MN et al: natural Products Isolated from Oriental Medicinal Herbs Inactivate Zika viruses 2019, 11). Most of the anti-ZIKV active lead compounds reported in the current literature are subjected to in-vitro antiviral activity tests, part of the compounds are also subjected to in-vivo antiviral activity tests on animal models, and only few candidate compounds enter clinical tests. Despite the laborious efforts of researchers in developing vaccines and antiviral drugs to prevent the zika virus infection in the past few years, no vaccine or drug has been approved for marketing.

Zika virus is a positive sense single stranded RNA virus, infects host cells, replicates RNA genome with host cells, assembles into mature progeny virus, and finally releases outside the cell. Zika virus is an RNA virus with high variability, so that drug design for the virus is difficult, including vaccine design, targeting agents such as gene editing agents, and the like, all suffer from the problem of unsatisfactory effects due to high denaturation.

Therefore, determining targets suitable for zika virus inhibition is a technical problem in the art, and there is a need in the art to find a reasonably suitable way to solve this problem.

Disclosure of Invention

The application aims to provide a method for inhibiting replication of Zikv virus (ZIKV) in mammalian cells based on CRISPR-Cas13 intervention by utilizing a CRISPR Cas13 (such as Cas13 b) family tool.

In a first aspect of the application there is provided the use of crRNA for the preparation of a composition for inhibiting a zika virus, the crRNA being directed against the zika virus genome comprising: (1) DR sequence; and, (2) a sequence (spacer) or combination of sequences selected from any one of SEQ ID NOS 1 to 11.

In one or more embodiments, (2) is a sequence or combination of sequences selected from any one of SEQ ID NOs 1 to 9.

In one or more embodiments, (2) is a sequence or combination of sequences selected from any one of SEQ ID NOs 1 to 5.

In one or more embodiments, the Zika virus includes any of the viruses listed in tables 1 and 2.

In one or more embodiments, the sequence of (2) is formed by primer annealing.

In one or more embodiments, the sequence of (2) is formed by annealing the primers shown in SEQ ID NOS.17-38.

In another aspect of the application, there is provided a crRNA comprising: (1) DR sequence; and (2) a sequence or combination of sequences selected from any one of SEQ ID NOs 1 to 11.

In one or more embodiments, the sequence of (2) is formed by primer annealing.

In one or more embodiments, the sequence of (2) is formed by annealing the primers shown in SEQ ID NOS.17-38.

In another aspect of the application, a recombinant plasmid is provided, said recombinant plasmid comprising said crRNA.

In another aspect of the application, a recombinant cell is provided, the recombinant cell comprising the crRNA or the recombinant plasmid.

In one or more embodiments, the recombinant cell comprises a eukaryotic cell or a prokaryotic cell.

In one or more embodiments, the eukaryotic cells include (but are not limited to): mammalian cells (non-human mammalian cells, human cells), yeast, fungal cells, insect cells.

In one or more embodiments, the eukaryotic cell comprises: 293T-DC-SIGN cells.

In another aspect of the present application, there is provided a CRISPR-CAS complex comprising: cas nuclease; and, said crRNA.

In one or more embodiments, preferably, the Cas nuclease comprises a Cas13 nuclease. Preferably, the Cas13 nuclease comprises a Cas13a nuclease or a Cas13b nuclease.

In one or more embodiments, the Cas nuclease is encoded by a plasmid system.

In one or more embodiments, the crRNA is expressed from a plasmid system.

In one or more embodiments, the plasmid system encoding the Cas nuclease takes pC0046-EF1a-PspCas13b-NES-HIV as a backbone plasmid; more preferably, a reporter gene is introduced into the backbone plasmid.

In one or more embodiments, the plasmid system expressing crRNA uses pC0043-PspCas13b-crRNA-backbone as the backbone plasmid.

In one or more embodiments, the plasmid system of the Cas nuclease or the plasmid system of the crRNA is combined in one plasmid or separately placed in different plasmids.

In another aspect of the application, there is provided a delivery system comprising: said CRISPR-CAS complex or said recombinant plasmid; and, a delivery vehicle.

In one or more embodiments, the delivery vehicle includes a delivery vehicle selected from (but not limited to): nanoparticles, liposomes, microvesicles or gene gun.

In another aspect of the present application, there is provided a method of inhibiting a Zika virus, the method comprising: the crRNA is used as a guide, matched with the Cas nuclease, and used for targeted cleavage of the target site region of the Zika virus to inhibit the Zika virus.

In one or more embodiments, the virus-carrying object is treated with the CRISPR-CAS complex or the delivery system; preferably, the CRISPR-CAS complex is adjacent to or in contact with a target site region of a viral genome, and the CAS nuclease cleaves the target site region, thereby disrupting the zika virus genome and inhibiting the zika virus.

In one or more embodiments, the method of inhibiting the zika virus is a method that is not directly aimed at the treatment of a disease.

In one or more embodiments, the virus-carrying object comprises: in vitro cells, cell cultures, isolated cells, substances (e.g., containers, sites, etc.) to which the virus or virus-carrying cells are attached, human, non-human mammals.

In another aspect of the application, there is provided a method of detecting the presence of a target site region of a Zika virus in a sample to be tested, comprising introducing into the sample to be tested said CRISPR-CAS complex carrying a detectable label or said delivery system; wherein when the CRISPR-CAS complex binds to the target site region, the CAS nuclease cleaves the target site region and the presence of the target site region in the sample to be tested is analyzed by observing the presence of the detectable label; preferably, the detectable label is a reporter gene, a fluorescent group, a chromogenic agent, a developing agent or a radioisotope.

In another aspect of the application, there is provided a composition comprising: said CRISPR-CAS complex or said delivery system; preferably, the composition is a pharmaceutical composition, preferably the composition further comprises: a physiologically or pharmaceutically acceptable pharmaceutical carrier.

In another aspect of the application, a kit or kit is provided comprising the CRISPR-CAS complex, the delivery system, or the composition.

The foregoing is a general description of the application, and individual components will be described in more detail below. However, the description of the present application should be understood as follows: to simplify and reduce redundancy, certain embodiments of the application are described in only one section, or in only the claims or examples. Therefore, the following should also be understood: any one embodiment of the application, including embodiments described in only one aspect, part, or only in the claims or examples, can be combined with any other embodiment described in this application unless specifically stated to the contrary or otherwise not to the contrary.

Drawings

FIG. 1, pC0046-PspCas13b-GFP-NES plasmid construction scheme.

FIG. 2, pC0043- (PspCas 13 b) -crRNA-ZIKV plasmid construction scheme.

FIG. 3 design of crRNA for specific regions of ZIKV genome obtained after screening.

FIG. 4, a flow chart of an experimental method for detecting CRISPR-Cas13b targeted inhibition of ZIKV infection.

FIG. 5, a technique for targeting ZIKV RNA based on CRISPR-Cas13b, suppressing efficiency flow statistics.

Detailed Description

Zika virus (ZIKA) is an RNA virus that has a high degree of variability, and therefore drug design for it is difficult. The inventor aims at finding a target suitable for inhibiting ZIKA viruses, performs extensive and massive analysis work on ZIKA virus genomes (1137 ZIKV genome sequences), and discloses a method for interfering or inhibiting Zika viruses based on a CRISPR-Cas13 (preferably Cas13 b) system and a reagent for targeted inhibition.

CRISPR-CAS system

CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a regularly clustered, intermittent short palindromic repeat, an adaptive immunization modality in most bacteria and archaea. Discovery and research of type VI CRISPR systems provides great potential for the development of RNA manipulation tools. CRISPR-Cas13 is a recently discovered class II type VI CRISPR-Cas system with RNA-guided and RNA-targeted RNase proteins, including Cas13a, cas13b, cas13c and Cas13d. CRISPR-Cas13 has an innate ability to bind to RNA and has the ability to mediate RNA cleavage under guidance of crRNA (CRISPR RNA).

Although the CRISPR-CAS system has been used in a wide variety of applications by those skilled in the art, this system presents a technical bottleneck in finding suitable target editing targets for highly variable RNA viruses.

The application provides a solution for Zika virus, and through a large number of screening and experiments, the inventor determines a plurality of spacer sequences capable of effectively inhibiting the virus, and the spacer sequences are selected from SEQ ID NO. 1-11. Based on this, the application also provides a series of crrnas, comprising the spacer and DR sequences (direct repeats). The DR sequence can be from a commercial plasmid that is based on the CRISPR technology.

Thus, in some embodiments, the CRISPR-CAS system of the present application contains at least one crRNA.

In some embodiments, a CRISPR system described herein comprises a plurality of crrnas, e.g., 1, 2, 3, 4, 5, 6, 7, 8, or more crrnas.

In classical CRISPR systems, the degree of complementarity between a guide sequence and its corresponding target sequence may be about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or 100%. In some embodiments, this degree of complementarity is 90-100%. Thus, variants of the crrnas designed based on SEQ ID NOs 1-11 described above are also encompassed by the present application, as long as the variants are also capable of acting as complements, guiding Cas nuclease (Cas 13, preferably Cas13 b) to the target site, and acting to cleave/modify the target gene.

In some embodiments, the crRNA is contained in a backbone sequence, e.g., the backbone sequence has a stem loop (hairpin) structure.

In some embodiments, the DNA encoding the crRNA is contained in an expression vector.

In some embodiments, the crRNA targets (target hybridizes or targets complement) the front or back of the corresponding sequence segment of the target nucleic acid sequence comprises a PAM sequence that does not itself hybridize or complement the PAM sequence.

To reduce off-target interactions, such as to reduce the interaction of crrnas with low-complementarity target sequences, mutations can be introduced in the CRISPR system that enable the CRISPR system to distinguish between target sequences and off-target sequences that have greater than 80%, 85%, 90% or 95% complementarity. In some embodiments, this degree of complementarity is 80% -95%, such as about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% or 95% (e.g., one can distinguish a 18 nucleotide target from an 18 nucleotide off-target that has 1, 2 or 3 mismatches). Thus, in some embodiments, one crRNA is more than 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5% or 99.9% complementary to its corresponding target sequence. In some embodiments, the degree of complementarity is 100%.

It is known in the art that full complementarity is not required for sufficient complementarity to function. Cleavage efficiency may be modulated by introducing mismatches, for example by introducing one or more mismatches, such as1 or 2 mismatches between the spacer sequence and the target sequence (including the location of the mismatch along the spacer/target). If one mismatch (e.g., a double mismatch) is located closer to the center (i.e., not at the 3 'or 5' end), the greater the impact on the cleavage efficiency. Thus, mismatches may be introduced at positions along the spacer sequence to adjust cleavage efficiency. For example, if it is desired to achieve less than 100% target cleavage (as in a population of cells), mismatches between 1 or 2 spacers and the target sequence can be introduced into the spacer sequence.

In some embodiments, the CRISPR-CAS system may use multiple crrnas such that effector proteins, including effector protein systems, therein are capable of targeting multiple nucleic acids. In some embodiments, a CRISPR system described herein comprises a plurality (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, or more) crrnas.

Expression of crRNA can also be arranged in a manner that includes an induction system. Because of the inducibility of the system, spatial and temporal control of gene editing or gene expression can be achieved. In some embodiments, electromagnetic radiation, sonic energy, chemical energy, and/or thermal energy are used to stimulate the inducible system.

In some embodiments, transcription of crRNA may be modulated by: inducible promoters such as tetracycline or doxycycline controlled transcriptional activation (Tet-On and Tet-Off expression systems), hormone-inducible gene expression systems (e.g., ecdysone) or arabinose-inducible gene expression systems. Some other embodiments of the induction system include: small molecule two-hybrid transcriptional activation systems (FKBP, ABA, etc.), photoinduction systems (phytochrome, LOV domain or cryptochrome) or photoinduction transcriptional effectors (LITE).

Chemical modifications may be applied to the crRNA. Backbone modifications (e.g., phosphorothioates) modify the charge on the phosphate backbone and aid in delivery of the oligonucleotide and nuclease resistance (see e.g., eckstein, phosphorothioate, essential components of therapeutic oligonucleotides, nucleic.acid ter., 24, pp.374-387,2014); modification of sugars, such as 2 '-O-methyl (2' -OMe), 2'-F, locked Nucleic Acid (LNA), can enhance base pairing and nuclease resistance (see, e.g., allerson et al, 2' -fully modified oligonucleotide duplex has better in vitro potency and stability compared to unmodified small interfering RNA, J.Med. Chem.48.4:901-904, 2005). Chemically modified bases, such as 2-thiouridine or N6-methyladenosine, can make base pairing stronger or weaker (see, e.g., bramsen et al, "development of therapeutic grade small interfering RNA by chemical engineering", front. Genet.,2012Aug.20; 3:154). In addition, the RNA may be conjugated at the 5 'and 3' ends to various functional moieties, including fluorescent dyes, polyethylene glycol, or proteins.

In some embodiments, the crRNA comprises one or more phosphorothioate modifications. In some embodiments, the crRNA comprises one or more locked nucleic acids for enhancing base pairing and/or increasing nuclease resistance.

In some embodiments, the crRNA can be chemically modified. Examples of chemical modification of crrnas include, but are not limited to, incorporation of 2' -O-methyl (M), 2' -O-methyl 3' -phosphorothioate (MS), or 2' -O-methyl 3' -thiopie (MSP) at one or more terminal nucleotides. Chemically modified crrnas may have higher stability and activity than unmodified crrnas, with on-target and off-target specificity not being predicted. See, hendel, nat Biotechnol.33 (9): 985-9,2015, incorporated herein by reference in its entirety. Chemically modified crrnas may also include, but are not limited to, an RNA that contains phosphorothioate linkages and Locked Nucleic Acid (LNA) nucleotides that have a methylene bridge between the 2 'and 4' carbons.

The crRNA of the application cooperates with the Cas13 enzyme to form the CRISPR-CAS system.

In the present application, cas13 is preferably Cas13b, preferably PspCas13b, and variants thereof, derivatives thereof, modified products thereof, and the like are also included in the present application.

The present application also provides a delivery system comprising: the CRISPR-CAS compound or recombinant plasmid disclosed by the application; and a delivery vehicle. The delivery system facilitates the introduction of a CRISPR-Cas complex of the application comprising a Cas nuclease and an appropriate crRNA into the vicinity of a target gene. Preferably, the delivery vehicle includes a delivery vehicle selected from (but not limited to): nanoparticles, liposomes, microvesicles or gene gun.

The present application also provides a composition comprising: the CRISPR-CAS complex of the application or the delivery system; preferably, the composition is a pharmaceutical composition, preferably the composition further comprises: a physiologically or pharmaceutically acceptable pharmaceutical carrier.

The application also provides a kit or kit comprising said CRISPR-CAS complex, said delivery system or said composition. In some embodiments, the kit may further comprise a piece of instructions regarding how to use the components of the kit and/or how to use additional components with the components of the kit. Any of the components of the kit may be stored in any suitable container.

Application of

The CRISPR-CAS system of the application can be applied to the inhibition of Zika virus or used for preparing a composition for inhibiting the Zika virus.

In the specific embodiment of the present application, first, a ZIKV infection system capable of efficiently reading virus infection and replication by fluorescence was constructed. The inventor firstly constructs ZIKV icDNA for stably expressing mCherry reporter gene, and establishes ZIKV replicon vector pFK-ZIKV-mCherry on the basis of plasmid pZL 1. mCherry was fused to the N-terminus of ZIKV capsid protein with a self-cleaving FMDV2A peptide linker. On this basis, ZIKV-mCherry RNA was obtained. pFK-ZIKV-mCherry plasmid is stable in expression in bacteria E.coli. Extracting the constructed plasmid, and transcribing RNA under the T7 promoter by taking the pFK-ZIKV-mCherry plasmid as a template to obtain ZIKV-mCherry RNA. The inventors then transfected ZIKV-mCherry RNA into Vero E6cells using electroporation, and virus supernatants were collected on day 5 and day 8 after the culture infection and frozen in a-80℃refrigerator for storage.

In a specific embodiment of the present application, the inventors constructed the PspCas13b-GFP-NES system with fluorescent markers to facilitate detection of PspCas13b protein expression. The inventors fused the green fluorescent protein GFP after the PspCas13b protein. The construction of the GFP-expressing vector pC0046-PspCas13b-GFP-NES was carried out as follows: the GFP-encoding sequence was inserted into the pC0046 plasmid (AddGene # 103862) to construct pC0046-PspCas13b-GFP-NES. Specifically, the GFP sequence is fused to the Cas13b sequence through an XTEN linker. The GFP gene fragment was recombined with plasmid pC0046-EF1a-PspCas13b-NES-HIV after NheI/EcoRI digestion using primers Cas13b-GFP-P5/GFP-P3 and pC0056-LwCas13a-msfGFP-NES as templates, using a one-step cloning kit (C112-02, vazyme) to obtain pC0046-PspCas13b-GFP-NES plasmid. The pC0046-PspCas13b-GFP-NES plasmid was then transformed into bacteria E.coli. The plasmid was transformed in E.coli DH 10. Beta. Competent cells by heat shock, and was heat shock for 90sec in a 42℃water bath. Spread on LB medium and grow overnight at 37 ℃. The constructed plasmid PspCas13b-GFP-NES was subjected to shaking and sucking.

In a specific embodiment of the application, the inventors constructed crRNA plasmids with CRISPR-Cas13b that cleave ZIKV RNAs. For 1137 available ZIKV genomic sequences, after extensive research experiments, the target site region (nucleotide variation stable region) of the zika virus genome of interest was obtained, based on which a set of crrnas was prepared (gmC, gC, gprM, gE, gNS1, gNS2B, gNS3, gNS4A, gNS4B, gNS 5). That is, in the present application, crrnas for mutation-stabilizing regions of different ZIKV variants are designed in consideration of the fact that the crrnas are directed against different ZIKV variants and prevent escape of viral mutations. The crRNAs sequences were inserted into pC0043-PspCas13b-crRNA-backbone (AddGene # 103854) to construct an expression crRNA expression plasmid.

In a specific embodiment of the application, the inventors synthesized primers corresponding to crRNA sequences. Then, after annealing the complementary primers, a series of crRNA expression plasmids were obtained by inserting them into crRNA-backgenes using T4DNA ligase (Thermo). The crRNAs constructed include gprM, gE, gNS1-1, gNS1-2, gNS2B, gNS3, gNS4B, gNS, gmC, gNT-1 and gNT-2.

In a specific embodiment of the application, the inventors transformed the PspCas13b-crRNA plasmid into bacteria e.coli. The plasmid was transformed in E.coli DH 10. Beta. Competent cells by heat shock, and was heat shock for 90sec in a 42℃water bath. Spread on LB medium and grow overnight at 37 ℃. The constructed plasmid PspCas13b-crRNA was shake-extracted.

In a specific embodiment of the application, further, the inventors constructed a CRISPR-Cas13b expression system in Vero E6 and 293T-DC-SIGN cells, and studied their expression kinetics.

The application generates a cell system suitable for ZIKV infection. DC-SIGN receptors can promote the entry of DENV into cells. ZIKV envelope proteins can use DC-SIGN receptors to evade immune surveillance. The inventors constructed a 293T-DC-SIGN cell line and used this method to construct 3T3 cells containing DC-SIGN receptors. The inventors infected 293T-DC-SIGN cells with ZIKV-mCherry, and found that the susceptibility to ZIKV-mCherry infection was increased in 293T-DC-SIGN cells compared to 293T cells and VeroE6 cells.

The present application generates a CRISPR-Cas13b system expressed cell line. The PspCas13b-GFP-NES plasmid was transfected into VeroE6, 293T and 293T-DC-SIGN cells using the Lipofectamine3000 kit.

The present application generates PspCas13b-crRNA lineCell lines expressed in the system. Using Lipofectamine ^TM The 3000 kit transfected pC0043-PspCas13b-crRNA plasmid into VeroE6, 293T and 293T-DC-SIGN cells.

In a specific embodiment of the application, ZIKV RNA replication is further inhibited by crRNA and CRISPR-Cas13b designed as described above. Interference of Cas13b-GFP protein and crRNA complexes inhibited the replication of infected ZIKV RNAs in 293T-DC-SIGN cells. 293T-DC-SIGN cells were simultaneously transfected with CRISPR vectors (PspCas 13B-GFP and pC0043-PspCas 13B-crRNA) and cultured on petri dishes for 24 hours. Transfected 293T-DC-SIGN cells were then infected with ZIKV-mCherry at an MOI of 0.1. Flow cytometry analysis was performed 48 hours after infection.

There is no ZIKV RNA replication that utilizes CRISPR-Cas13b intervention inhibition in the art. The CRISPR-Cas13b based RNA editing technique of the present application inhibits mammalian cell ZIKV RNA replication. The technology can also be used for operating and interfering ZIKV in mosquito cells or mosquitoes, and provides an effective means for interfering with the prevention of Zika virus.

The application will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present application and are not intended to limit the scope of the present application. The experimental procedures, which are not specifically noted in the examples below, are generally carried out according to conventional conditions such as those described in J.Sam Brookfield et al, molecular cloning guidelines, third edition, scientific Press, or according to the manufacturer's recommendations.

Example 1 construction of a highly efficient ZIKV-mCherry infection System

The main construction method of the ZIKV-mCherry infection system is as follows:

1. construction of plasmid pFK-ZIKV-mCherry for stably expressing ZIKV icDNA (inpfection cDNA) of mCherry reporter gene

A pFK-ZIKV-mCherry plasmid map is designed, wherein the ZIKV is the genome sequence of the full-length genome of the virus, and the GenBank accession number is KU321639. The promoter is T7, mCherry and Capsid protein Capid are connected through 2A tag, the 2A tag can be self-cut after protein translation, and finally mature proteins mCherry and Capid can be separated.

The gene synthesis company was commissioned to synthesize plasmids.

pFK-ZIKV-mCherry plasmid is stable in expression in bacterial E.coli

RNA is transcribed under the T7 promoter by taking pFK-ZIKV-mCherry plasmid as a template, so as to obtain ZIKV-mCherry RNA. The method comprises the following steps:

A. extraction of plasmid pFK-ZIKV-mCherry

A small amount of strain pFK-ZIKV-mCherry containing the synthesized plasmid is picked and transferred into an LB liquid culture medium test tube added with antibiotics. The test tube was placed in a shaker at 37℃and 220RPM overnight for incubation.

(1) The bacterial liquid in the cultured test tube is added into a 1.5mL centrifuge tube, and the mixture is centrifuged for 1min at 10000 Xg at room temperature.

(2) The supernatant was removed, plasmid extraction was started using plasmid miniextraction kit (OMEGA), 250 μl of solution i (containing Rnase a) was added, and the EP tube was inverted until the cells were completely suspended.

(3) 250 mu L of solution II is added into an EP tube, and the centrifuge tube is gently shaken up and down for 4 to 6 times, so that clear lysate can be obtained. Incubation at room temperature for about 2min does not allow vigorous mixing, otherwise chromosomal DNA is broken and plasmid purity is reduced.

(4) Then 350. Mu.L of solution III was added and gently mixed, a white flocculent precipitate was observed, and then centrifuged at 13000 Xg for 10min.

(5) The supernatant was aspirated and transferred to an assembled column without aspiration of pellet and cell debris. Centrifuge 10000 Xg for 1min.

(6) The centrifugate was discarded, 500. Mu.L Buffer HB was added to the centrifuge tube, and then centrifuged at 10000 Xg for 1min.

(7) The centrifuge was discarded, a 700. Mu. LWAsh Buffer was added to the tube and washed, and the procedure was repeated 2 times with 10000 Xg centrifugation for 1min.

(8) Finally, 13000 Xg was centrifuged for 2min, and ethanol was removed, which affected the experimental data.

(9) The column was placed in a new 1.5mL centrifuge tube, 40. Mu.L of sterile water was added to the filter membrane and centrifuged at 10000 Xg for 2min.

(10) And (3) detection: 1. Mu.L of plasmid solution was taken and the OD260/280 was measured using a NanoDrop2000 instrument to obtain plasmid solution concentration (. Mu.g/. Mu.L)

B. Using pFK-ZIKV-mCherry plasmid as a template, and transcribing RNA under a T7 promoter to obtain ZIKV-mCherry RNA; scrRNA in vitro transcription was performed using T7 RNA Polymerase (NEB); transcription System (50 μl):

after mixing, the mixture was reacted at 37℃for 5 hours or overnight (12 hours).

C. Digestion of template DNA

(1) Ethanol precipitation

1/10 volume of sodium acetate (pH=5.2) was added to the transcription system, and 2 times the volume of absolute ethanol was further added (for example, 50. Mu.l of transcription system was added with 5. Mu.l of sodium acetate, and 100. Mu.l of absolute ethanol was further added), and the mixture was allowed to stand at 20℃for 30 minutes to precipitate nucleic acid.

Centrifuge at 15000g for 10min at 4deg.C, discard supernatant.

Mu.l of 75% ethanol was added, the precipitate was washed (15-20 shots were blown on at the tip), centrifuged at 15000g for 10min at 4℃and the supernatant was discarded.

Washing with 500 μl of 75% ethanol at 4deg.C for 10min, centrifuging at 15000g, and removing supernatant (this time preferably by gun suction, so as to remove thoroughly)

Standing at room temperature for 15min to evaporate ethanol, and dissolving precipitate with RNase-free water.

(2) DNase I digestion of template DNA

Next, the DNA was digested with 100. Mu.l of the system, so that 90. Mu.l of RNase-free water was added to dissolve the precipitate, then 10. Mu.l of 10 XDNase I Buffer, 2. Mu.l of DNase I (Takara) were added, and after mixing, the mixture was reacted at 37℃for 1-2 hours to digest the DNA template.

D. Recovery of ZIKV-mCherry RNA

RNA transcribed in vitro was recovered using the RNA Clean & Concentrator-5Kit (Zymo). The operation is as follows:

2 volumes of RNA Binding Buffer were added followed by an equal volume of absolute ethanol (e.g., 100. Mu.l of sample, 200. Mu. l RNA Binding Buffer, followed by 300. Mu.l of absolute ethanol). Mixing, loading onto zymoIC column, and standing at room temperature for 1min. Centrifuge 12000g for 1min, discard down tube liquid.

400 mu l RNA Prep Buffer and 12000g were added and centrifuged for 1min, and the down tube liquid was discarded.

700 mu l RNA Wash Buffer g and 12000g were added and centrifuged for 30s, and the down tube liquid was discarded.

500 mu l RNA Wash Buffer and 12000g were added and centrifuged for 30s, and the down tube liquid was discarded.

The column was returned to the cannula and centrifuged at 12000g for 2min (air-thrown, further removing RNA Wash Buffer).

The column was placed in a new 1.5ml Ep tube and left at room temperature for 5min to allow the alcohol to evaporate sufficiently. Adding 50-100 μl RNase-free water (preheated at 50-60deg.C), and standing for 1-2min.10000g are centrifuged for 30s, and the recovered crRNA sample is obtained. After Nanodrop quantification, the samples were stored at-80 ℃.

3. ZIKV-mCherry RNA was transfected into Vero E6cells by electroporation. Approximately 5. Mu.g of ZIKV-mCherry RNA was electrotransferred to 5X 106Vero E6cells, and 0.45kV and 25. Mu.F were pulsed 3 times, 3s apart, in a 4mm electrotransfer cup using a Bio-Rad electrotransfer apparatus. Culturing then continues in the cell culture incubator. Viral supernatants were collected on day 5 and day 8 after ZIKV infection by culture and stored in a-80℃freezer.

The ZIKV genome, the insertion of mCherry and the construction of the elements of ZIKV-mCherry are shown in FIG. 3.

EXAMPLE 2 construction of pC0046-PspCas13b-GFP-NES System

The lentiviral plasmid vector (AddGene # 103862) was edited using the pC0046-EF1a-PspCas13b-NES-HIV gene.

1. Design and construction of CRISPR-PspCas13b System with fluorescent Label

To facilitate detection of the expression of the PspCas13b protein, the inventors fused the green fluorescent protein GFP after the PspCas13b protein.

A. The construction of the GFP-expressing vector pC0046-PspCas13b-GFP-NES was carried out as follows:

the pC0056-LwCas13a-msfGFP-NES plasmid template was obtained from AddGene.

Primers were designed to amplify fragments of the GFP sequence, the sequences were as follows:

Cas13b-GFP-P5：atgaagggatcccttcaaggaggaggtggaagcggaggaggaggaagcggaggaggaggtagcgtgagtaaaggtga；

GFP-P3：tgattatcgataagcttgatatcg。

the GFP fragment was PCR amplified by the following reaction system:

the PCR reaction procedure was as follows:

94℃，2min；

98 ℃,10s,58 ℃,30 s,72 ℃, 1min,72 ℃ 5min,30 cycles;

the PCR fragments were recovered by gel.

NheI/EcoRI double enzyme digestion pC0046-EF1a-PspCas13b-NES-HIV plasmid

The gel was recovered at 37℃for 30 min.

C. Preparation of pC0046-PspCas13b-GFP-NES plasmid using the one-step cloning kit (C112-02, vazyme)

The reaction was carried out at 37℃for 1 hour.

D. Transformation of the pC0046-PspCas13b-GFP-NES plasmid into bacteria E.coli; converting the plasmid in DH10 beta competent cells of the escherichia coli by heat shock, and performing heat shock for 90sec in a 42 ℃ water bath kettle; spread on LB medium and grow overnight at 37 ℃.

2. The constructed plasmid pC0046-PspCas13b-GFP-NES is extracted by shaking, and the construction process and the obtained recombinant plasmid are shown in FIG. 1.

Example 3 construction of CRISPR-Cas13b CrRNA plasmid that cleaves ZIKV RNA

In view of the fact that ZIKV is an RNA virus with high variability, it has been difficult in the art to prepare targeted inhibition targets based on CRISPR technology that can effectively target ZIKA and variants thereof with stable inhibition. In order to find suitable targets, the present inventors conducted extensive and extensive analysis work on the genome of ZIKA virus, obtaining 1137 ZIKV genomic sequences from NCBI gene library (tables 1 and 2), and conducting repeated alignments and experimental analyses of these sequences.

TABLE 1

/>

TABLE 2

/>

After extensive research screening, the inventors determined a number of target regions against which the primary analysis had a certain inhibitory effect when crrnas were designed. In further screening, the inventors determined 10 ZIKV gene mutation stable regions and designed 15 crrnas. Wherein gNT (Non Target) is negative control. gmC (gmCherry) is a targeting red fluorescent protein gene mCherry.

In this example, a crRNA plasmid was constructed in which CRISPR-Cas13b cleaves ZIKV RNA.

1. Primers for preparing crRNA targeting ZIKV RNA

Primers for preparing crrnas targeting ZIKV RNAs were designed, together 14 pairs of primers targeting Zika crrnas, a pair of primers targeting mCherry crrnas and a pair of primers for forming non-target controls, the sequences are shown in table 3.

TABLE 3 Table 3

2. Construction of plasmid pC0043- (PspCas 13 b) -crRNA (ZIKV-mCherry)

The specific operation method is as follows:

A. primer preparation

Dissolving ZIKV-crRNA-P5 and ZIKV-crRNA-P3 primers into 10 mu M mother solution by using water, and adding 80 mu L of 0.5 xTE (pH8.0) into 10 mu L of each mother solution to make the final concentration of each mother solution be 1 mu M; placing the mixture in a PCR instrument for treatment at 98 ℃ for 3min, and naturally cooling to room temperature.

BbsI restriction enzyme pC0043-PspCas13b-crRNA-backbone vector

The pC0043-PspCas13b-crRNA-backbone vector was obtained from AddGene.

The fragments were recovered with gel at 37℃for 30 min.

C. Ligation reaction

Ligation for 30min at 25℃yielded pC0043- (PspCas 13 b) -crRNA (ZIKV-mCherry) plasmid (FIG. 2).

Two recombinant plasmids, namely pC0046-PspCas13b-GFP-NES and pC0043- (PspCas 13 b) -crRNA (ZIKV-mCherry), are abbreviated as PspCas13b-GFP-NES: crRNA- (ZIKV) double plasmid system.

Example 4 CRISPR-Cas13b interference inhibition of ZIKV-mCherry RNA replication Effect in animal cells

In this example, the effect of CRISPR-Cas13b interference in inhibiting ZIKV-mCherry RNA replication in animal cells was examined.

1. 293T-DC-SIGN cells were cultured in DMEM+10% foetal calf serum medium, 37℃in a 5% carbon dioxide cell incubator.

2. The day before transfection, 293T-DC-SIGN cells were plated at 1.5X10 per well ⁵ The amount of individual cells was seeded in 24-well plates. Cells were transfected when they grew to 80% confluence. The medium in the 24-well plate was replaced with fresh medium (serum-containing, no diabody) prior to transfection.

3. The transfection reagent is Lipofectamine of Siemens technology company ^TM 3000Transfection Reagent, the transfection procedure (fig. 4) was as follows:

(1) Using Opti-MEM ^TM Dilution of Lipofectamine3000 reagent in Medium (Opti-MEM ^TM Culture medium 23.5. Mu.L/well, lipofectamine3000 reagent 1.5. Mu.L/well).

(2) Using Opti-MEM ^TM The DNA was diluted in the medium to prepare a DNA premix, and the PspCas13b-GFP-NES crRNA- (ZIKV) double plasmid system was added in an amount of 500ng per plasmid, followed by supplementation with P3000 ^TM The reagent reached 25. Mu.L/well and was thoroughly mixed.

(3) Diluted DNA premix (1:1 ratio) was added to diluted Lipofectamin3000 reagent, 25. Mu.L/well each.

Evenly mixed and incubated for 10-15 minutes at room temperature.

(4) PspCas13b-GFP-NES crRNA- (ZIKV) double plasmid System-lipid complexes were added to all 24 well plates (50. Mu.L/well) and mixed with gentle shaking. Meanwhile, a control group is arranged, namely, only transfection reagent is added, and a PspCas13b-GFP-NES crRNA- (ZIKV) double plasmid system is not added.

(5) The medium containing serum was replaced with fresh medium containing diabody 6 hours after transfection.

(6) After the culture was continued for 48 hours, the observation was carried out by photographing under a fluorescence microscope.

2. 293T-DC-SIGN cells transfected with PspCas13b-GFP-NES and crRNA- (ZIKV) were infected with ZIKV-mCherry RNA virus.

(1) 293T-DC-SIGN cells transfected with PspCas13b-GFP-NES and crRNA- (ZIKV) were transfected for 24 hours and started to infect ZIKV-mCherry RNA;

(2) Adding Polybrene into the collected ZIKV-mCherry RNA virus supernatant to a final concentration of 1 μg/mL, incubating at room temperature for 10-15min, and adding into each well of 24-well plateAdding 1mL of virus solution, and heating at 37deg.C and 5% CO ₂ Culturing and adsorbing in an incubator for 1 hour, shaking the culture plate for 1 time every 15min to ensure that viruses are adsorbed uniformly;

(3) After further culturing for 24, 48, 72 hours, photographing observation was performed under a fluorescence microscope.

3. Flow cytometry to detect different fluorescent cell numbers in cells

(1) Cells in the 24-well plate that need to be subjected to flow detection are removed from the incubator and sample preparation is started.

(2) The original medium in the 24-well plate was discarded by a waste aspirator, and washed once with 1 XPBS.

(3) Adding pancreatin for digestion for 1min, observing the cells under an inverted microscope, immediately adding an streaming diluent to stop digestion when the cells are slightly rounded, collecting the cells, centrifuging and removing the supernatant.

(4) The flow dilution was washed once more, centrifuged and the supernatant removed leaving approximately 0.5mL of cell suspension, the cells were dispersed by filtration through a 200 mesh nylon mesh, sub-packaged in flow sample tubes and checked on a machine within 1 hour.

As a result, as shown in fig. 5, the inventors screened crrnas that obtained some very significant inhibitory effects.

The inventors have also conducted the inhibition experiments described above for various variant viruses of ZIKA, including those listed in tables 1 and 2 of the subsequent examples of the present application, and as a result, found that inhibition of gNS1-2 was significant for each virus.

The proportion of ZIKV-infected cells in co-expressing Cas13b and mCherry-targeted crRNA (i.e., positive control, gmC) cells was significantly reduced (50% lower, p= 0.00022, double sided t-test). Of the 14 ZIKV-targeted crrnas, the cell numbers of the crrnas targeted to gE-2, gNS1-1, gNS1-2, gNS3-1 and gNS4B-1 were significantly lower than the non-targeted crrnas (gNT) (-50% decrease, p-values of 0.00028, 0.00011, 0.00022, 0.00018 and 0.00017 (p <0.001; double sided t-test), respectively.) therefore, these crrnas could effectively inhibit the replication of ZIKV-mCherry in mammalian cells (fig. 5) this inhibitory effect was highly desirable for high variability viruses such as RNA viruses.

Using the same experimental methods as described above, the inventors selected a series of viruses (various mutant viruses) in tables 1 and 2 as the subjects of inhibition, and constituted crRNAs with any one of the sequences shown in SEQ ID NOS 1 to 5 in Table 3, and found that crRNAs with any one of the sequences shown in SEQ ID NOS 1 to 5 had significant inhibitory effects on a series of viruses.

The foregoing examples illustrate only a few embodiments of the application and are described in detail herein without thereby limiting the scope of the application. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application. Accordingly, the scope of protection of the present application is to be determined by the appended claims. All documents referred to in this disclosure are incorporated by reference herein as if each was individually incorporated by reference.

Sequence listing

<110> molecular plant science Excellent innovation center of China academy of sciences

<120> method for inhibiting Zika virus based on CRISPR-CAS13 system intervention and application thereof

<130> 221446

<160> 48

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 1

gtggacctta gtgcctgggc attcctcaaa 30

<210> 2

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 2

ggcagagtct ggatgttcct cgctctctct 30

<210> 3

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 3

acatggggtt tttgacagat cccacaacga 30

<210> 4

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 4

gtcctcggtt cacaatcaag tcctaggctt 30

<210> 5

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 5

catgcgtaga atggcatccc tttgcccata 30

<210> 6

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 6

gctgcaaagg gtatggctat tgggttcatg 30

<210> 7

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 7

agtagatgac tttttggctc gttgagctac 30

<210> 8

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 8

tcctagcatt gattattctc agcatggcag 30

<210> 9

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 9

acatgagcca tgcgctggcc ccaagagtca 30

<210> 10

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 10

cctcatattt cactggcctc ctaggcccgt 30

<210> 11

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 11

cttcaacacc acctcctgag ttctctctcc 30

<210> 12

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 12

tttcccttca gagagaggag cataaacccc 30

<210> 13

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 13

tcgcccatct caacccttgt tgaaatgtat 30

<210> 14

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 14

cctctgccac atccaagatc aatgaccttt 30

<210> 15

<211> 58

<212> DNA

<213> Artificial Sequence

<400> 15

tggtcacctt cagcttggcg gtctgggtgc ctggtcagac tttataacgg ccaaggtt 58

<210> 16

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 16

ctggtcagac tttataacgg ccaaggtt 28

<210> 17

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 17

caccgtggac cttagtgcct gggcattcct caaa 34

<210> 18

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 18

caactttgag gaatgcccag gcactaaggt ccac 34

<210> 19

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 19

caccggcaga gtctggatgt tcctcgctct ctct 34

<210> 20

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 20

caacagagag agcgaggaac atccagactc tgcc 34

<210> 21

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 21

caccacatgg ggtttttgac agatcccaca acga 34

<210> 22

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 22

caactcgttg tgggatctgt caaaaacccc atgt 34

<210> 23

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 23

caccgtcctc ggttcacaat caagtcctag gctt 34

<210> 24

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 24

caacaagcct aggacttgat tgtgaaccga ggac 34

<210> 25

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 25

cacccatgcg tagaatggca tccctttgcc cata 34

<210> 26

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 26

caactatggg caaagggatg ccattctacg catg 34

<210> 27

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 27

caccgctgca aagggtatgg ctattgggtt catg 34

<210> 28

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 28

caaccatgaa cccaatagcc ataccctttg cagc 34

<210> 29

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 29

caccagtaga tgactttttg gctcgttgag ctac 34

<210> 30

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 30

caacgtagct caacgagcca aaaagtcatc tact 34

<210> 31

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 31

cacccgtttt agcatattga caatccggaa tcct 34

<210> 32

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 32

caacaggatt ccggattgtc aatatgctaa aacg 34

<210> 33

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 33

caccacatga gccatgcgct ggccccaaga gtca 34

<210> 34

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 34

caactgactc ttggggccag cgcatggctc atgt 34

<210> 35

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 35

cacccctcat atttcactgg cctcctaggc ccgt 34

<210> 36

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 36

caacacgggc ctaggaggcc agtgaaatat gagg 34

<210> 37

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 37

cacccttcaa caccacctcc tgagttctct ctcc 34

<210> 38

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 38

caacggagag agaactcagg aggtggtgtt gaag 34

<210> 39

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 39

cacctttccc ttcagagaga ggagcataaa cccc 34

<210> 40

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 40

caacggggtt tatgctcctc tctctgaagg gaaa 34

<210> 41

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 41

cacctcgccc atctcaaccc ttgttgaaat gtat 34

<210> 42

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 42

caacatacat ttcaacaagg gttgagatgg gcga 34

<210> 43

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 43

cacccctctg ccacatccaa gatcaatgac cttt 34

<210> 44

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 44

caacaaaggt cattgatctt ggatgtggca gagg 34

<210> 45

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 45

cacctggtca ccttcagctt ggcggtctgg gtgc 34

<210> 46

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 46

caacgcaccc agaccgccaa gctgaaggtg acca 34

<210> 47

<211> 32

<212> DNA

<213> Artificial Sequence

<400> 47

caccctggtc agactttata acggccaagg tt 32

<210> 48

<211> 32

<212> DNA

<213> Artificial Sequence

<400> 48

caacaacctt ggccgttata aagtctgacc ag 32

Claims (14)

1. Use of crRNA for the preparation of a composition for inhibiting a zika virus, said crRNA being directed against the zika virus genome comprising:

   (1) DR sequence; and

   (2) Selected from any one of the sequences shown in SEQ ID NO 1-11 or the sequence combination.
2. 2. The use according to claim 1, wherein in (2) is selected from any one of the sequences shown in SEQ ID NOs 1 to 9 or a combination of sequences; more preferably, any one or a combination of sequences selected from the group consisting of SEQ ID NOS.1 to 5.
3. 3. The use of claim 1, wherein said zika virus comprises any one of the viruses listed in tables 1 and 2.
4. 4. The use of claim 1, wherein the sequence of (2) is formed by primer annealing; preferably, the sequence of (2) is formed by annealing the primers shown in SEQ ID NOS.17 to 38.
5. 5. A crRNA comprising:

   (1) DR sequence; and

   (2) A sequence or a sequence combination selected from any one of SEQ ID NO 1-11;

   preferably, the sequence of (2) is formed by primer annealing; preferably, the sequence of (2) is formed by annealing the primers shown in SEQ ID NOS.17 to 38.
6. 6. A recombinant plasmid or recombinant cell, wherein the recombinant plasmid comprises the crRNA of claim 5; or, the recombinant cell contains the crRNA of claim 5 or the recombinant plasmid.
7. 7. A CRISPR-CAS complex, comprising: cas nuclease; and, the crRNA of claim 5; preferably, the Cas nuclease comprises a Cas13 nuclease; preferably, the Cas13 nuclease comprises a Cas13a nuclease or a Cas13b nuclease.
8. 8. The CRISPR-CAS complex of claim 7, wherein said CAS nuclease is encoded by a plasmid system and said crRNA is expressed by a plasmid system.
9. 9. A delivery system, comprising:

   the CRISPR-CAS complex of claim 7 or 8 or the recombinant plasmid of claim 6; the method comprises the steps of,

   a delivery vehicle; preferably, the delivery vehicle comprises a member selected from the group consisting of: nanoparticles, liposomes, microvesicles or gene gun.
10. 10. A method of inhibiting a zika virus, the method comprising: targeting cleavage of the target site region of the zika virus, with the crRNA of claim 5 as a guide, in cooperation with Cas nuclease, inhibits the zika virus.
11. 11. The method of claim 10, wherein the virus-carrying object is treated with the CRISPR-CAS complex of claim 7 or 8 or the delivery system of claim 9; preferably, the CRISPR-CAS complex is adjacent to or in contact with a target site region of a viral genome, and the CAS nuclease cleaves the target site region, thereby disrupting the zika virus genome and inhibiting the zika virus.
12. 12. A method of detecting the presence of a target site region of a zika virus in a sample to be tested, comprising introducing into the sample to be tested a CRISPR-CAS complex as defined in claim 7 or 8 or a delivery system as defined in claim 9 carrying a detectable label; wherein when the CRISPR-CAS complex binds to the target site region, the CAS nuclease cleaves the target site region and the presence of the target site region in the sample to be tested is analyzed by observing the presence of the detectable label; preferably, the detectable label is a reporter gene, a fluorescent group, a chromogenic agent, a developing agent or a radioisotope.
13. 13. A composition, said composition comprising: the CRISPR-CAS complex of claim 7 or 8 or the delivery system of claim 9; preferably, the composition is a pharmaceutical composition, preferably the composition further comprises: a physiologically or pharmaceutically acceptable pharmaceutical carrier.
14. 14. A kit or kit comprising the CRISPR-CAS complex of claim 7 or 8, the delivery system of claim 9 or the composition of claim 13.