CN116693646B - Method for cultivating rust-resistant plants by HIGS technology, protein used by method and related biological material - Google Patents

Abstract

The invention discloses a method for cultivating rust-resistant plants by HIGS technology, and protein and related biological materials used by the method, belonging to the technical field of genetic engineering. The stripe rust effector protein disclosed by the invention is Pst00846 which is a typical secretory protein, and a tobacco heterologous expression system is utilized to find that Pst00846 can inhibit Bax-induced cell necrosis and has a certain toxic function. The invention utilizes the gene silencing technology induced by a host to silence the Pst00846, thus obtaining the transient silencing plant. Inoculating the compatible race CYR31 to find that the spore yield of the silent plant is reduced, the disease resistance is enhanced, the wheat stripe rust resistance is obvious, and the wheat stripe rust resistance can be used as a durable material for genetic improvement of wheat stripe rust resistance.

Description

Method for cultivating rust-resistant plants by HIGS technology, protein used by method and related biological material

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a method for cultivating a rust-resistant plant by utilizing HIGS technology, and a protein and a related biological material used by the method.

Background

Stripe rust (jaundice) caused by the specialized wheat of the Puccinia striolata species (Puccinia striiformis f. Sp. Tritici) is a devastating disease in wheat growing areas of the world. The yield loss caused by the method is greatly different due to different variety resistance, disease development speed and duration, and can reach 100% if the high-sensitivity variety is in a climatic condition suitable for the growth of the stripe rust. The rapid variation of the rust bacteria virulence race overcomes disease resistance genes in wheat varieties, adapts to different environmental conditions, and simultaneously enables rust bacteria summer spores to spread remotely through wind power or human activities, so that the rust is an important disease threatening the global wheat production safety. Planting disease-resistant varieties is the most economical and effective measure for controlling the disease. Therefore, the prevention and control work of the disease is to take the comprehensive prevention and control measures taking the cultivation of disease-resistant varieties as the main, the monitoring and early warning, the use of bactericides and proper cultivation measures as the auxiliary.

Disclosure of Invention

The invention aims to solve the technical problem of digging stripe rust pathogenic effector protein. The technical problems to be solved are not limited to the described technical subject matter, and other technical subject matter not mentioned herein will be clearly understood by those skilled in the art from the following description.

In order to solve the technical problems, the invention provides the following technical scheme:

The invention provides a method for cultivating a rust resistant plant, which comprises the steps of introducing a coding gene of an RNA molecule into a target plant to obtain the rust resistant plant, wherein the rust resistant plant has higher resistance to rust than the target plant, and the RNA molecule targets mRNA transcribed from the coding gene of Pst00846 protein:

a1 A protein having an amino acid sequence of SEQ ID No. 1;

A2 Amino acid sequence is protein (polypeptide) of 89-155 of SEQ ID No. 1;

a3 Amino acid sequence is the protein (polypeptide) of 285-357 of SEQ ID No. 1;

A4 A protein which is obtained by substituting and/or deleting and/or adding an amino acid residue in the amino acid sequence shown in SEQ ID No.1, has more than 80% of identity with the protein shown in A1) and has the same function;

a5 Fusion proteins with the same function obtained by ligating a tag to the N-terminal and/or C-terminal of A1), A2), A3) or A4).

The plant of interest may be a host plant of the species rust. The host plant of the rust fungus can be specifically wheat, and further can be a wheat variety water source 11.

In order to facilitate purification or detection of the protein of A1), a tag protein may be attached to the amino-or carboxy-terminus of the protein consisting of the amino acid sequence shown in SEQ ID No.1 of the sequence Listing.

Such tag proteins include, but are not limited to: GST (glutathione-sulfhydryl transferase) tag protein, his6 tag protein (His-tag), MBP (maltose binding protein) tag protein, flag tag protein, SUMO tag protein, HA tag protein, myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

The nucleotide sequence encoding the protein Pst00846 of the present invention can be easily mutated by a person skilled in the art using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity to the nucleotide sequence of the protein Pst00846 isolated by the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein Pst00846 and have the function of the protein Pst 00846.

The 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

Herein, identity refers to identity of an amino acid sequence or a nucleotide sequence. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, by using blastp as a program, expect values are set to 10, all filters are set to OFF, BLOSUM62 is used as Matrix, gap existence cost, per residue gap cost and Lambda ratio are set to 11,1 and 0.85 (default values), respectively, and search is performed to calculate the identity of amino acid sequences, and then the value (%) of identity can be obtained.

Herein, the 80% identity or more may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

The nucleotide sequence of the coding gene of the RNA molecule is 265 th to 465 th nucleotides of SEQ ID No. 2.

The nucleotide sequence of the coding gene of the RNA molecule is 853 to 1071 nucleotides of SEQ ID No. 2.

The aforementioned proteins are also within the scope of the present invention.

The invention provides the protein-related biomaterial, which is any one of the following:

B1 An RNA molecule that inhibits or reduces or down-regulates the expression of a gene encoding the protein or an RNA molecule that inhibits or reduces or down-regulates the activity or content of the protein;

b2 A gene encoding the RNA molecule of B1);

b3 An expression cassette comprising the gene of B2);

B4 A recombinant vector comprising the gene of B2), or a recombinant vector comprising the expression cassette of B3);

B5 A recombinant microorganism comprising the gene of B2), a recombinant microorganism comprising the expression cassette of B3), or a recombinant microorganism comprising the recombinant vector of B4);

b6 A transgenic plant cell line containing the gene of B2), or a transgenic plant cell line containing the expression cassette of B3), or a transgenic plant cell line containing the recombinant vector of B4);

B7 A transgenic plant tissue containing the gene of B2), or a transgenic plant tissue containing the expression cassette of B3), or a transgenic plant tissue containing the recombinant vector of B4);

b8 A transgenic plant organ containing the gene of B2), or a transgenic plant organ containing the expression cassette of B3), or a transgenic plant organ containing the recombinant vector of B4);

B9 A nucleic acid molecule encoding the aforementioned protein;

b10 An expression cassette comprising the nucleic acid molecule of B9);

B11 A recombinant vector comprising the nucleic acid molecule of B9), or a recombinant vector comprising the expression cassette of B10);

B12 A recombinant microorganism comprising the nucleic acid molecule of B9), or a recombinant microorganism comprising the expression cassette of B10), or a recombinant microorganism comprising the recombinant vector of B11);

B13 A transgenic plant cell line comprising the nucleic acid molecule of B9), or a transgenic plant cell line comprising the expression cassette of B10);

b14 A transgenic plant tissue comprising the nucleic acid molecule of B9), or a transgenic plant tissue comprising the expression cassette of B10);

B15 A transgenic plant organ comprising a nucleic acid molecule according to B9), or a transgenic plant organ comprising an expression cassette according to B10).

The RNA molecule of B1) in the biological material targets mRNA transcribed from any one of the following genes:

b1 A DNA molecule with the coding sequence of the coding strand shown in SEQ ID No. 2;

b2 A DNA molecule of which the coding sequence of the coding strand is 265 to 465 as shown in SEQ ID No. 2;

b3 The coding sequence of the coding strand is the DNA molecules at positions 853 to 1071 shown in SEQ ID No. 2.

In the above biological material, B2) the coding gene is a DNA molecule which is reversely complementary to the DNA fragment of 265 th to 465 th nucleotides of SEQ ID No.2, and B2) the coding gene may also be a DNA molecule which is reversely complementary to the DNA fragment of 853 th to 1071 th nucleotides of SEQ ID No. 2.

The nucleic acid molecule B9) in the biological material is a cDNA molecule or a DNA molecule with the coding sequence of SEQ ID No. 2.

Herein, such vectors are well known to those skilled in the art, including but not limited to: plasmids, phages (e.g., lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), ti plasmids, or viral vectors. Specifically pGR107,107 and BSMV: gamma.

The invention also provides the use of a protein or any of the foregoing biomaterials:

D1 Increasing disease resistance of wheat;

d2 Preparing a product for improving disease resistance of wheat;

D3 Cultivating wheat with improved disease resistance;

d4 Preparing a product for cultivating wheat with improved disease resistance;

D5 Improving high disease resistance wheat or preparing a product of high disease resistance wheat;

D6 Wheat breeding;

D7 Inhibiting growth and development of rust bacteria;

d8 Preparing a product for inhibiting the growth and development of the rust.

The disease resistance is stripe rust resistance. The stripe rust is specifically a disease caused by the anti-stripe rust affinity race CYR 31.

The plant is any one of the following:

m1) dicotyledonous or monocotyledonous plants;

M2) gramineae plants;

M3) a gramineous plant;

M4) wheat plants;

M5) wheat.

According to the invention, a tobacco heterologous expression system is utilized to find that Pst00846 can inhibit Bax-induced cell necrosis, has a certain toxic function, and further utilizes a host-induced gene silencing technology to silence Pst00846, thereby obtaining a transient silencing plant. Inoculating the compatible race CYR31 to find that the spore yield of the silent plant is reduced, the disease resistance is enhanced, the wheat stripe rust resistance is obvious, and the wheat stripe rust resistance can be used as a durable material for genetic improvement of wheat stripe rust resistance.

Drawings

FIG. 1 shows the analysis of the expression level of Pst00846 at different infection times of Rhizoctonia cerealis.

FIG. 2 shows that the signal peptide of Pst00846 has secretion function, pst00846 is a typical secretion protein.

FIG. 3 shows that Pst00846 was able to inhibit Bax-induced cell necrosis.

FIG. 4 is a graph showing the results of the localization of Pst00846 to the cytoplasm and nucleus.

FIG. 5 shows the result of the localization of Pst00846 to the cytoplasm and nucleus.

FIG. 6 shows spore yield after transient silencing of Pst 00846.

FIG. 7 is a graph showing the results of active oxygen area, hyphal length and hyphal area after Pst00846 has been transiently silenced.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The quantitative tests in the following examples were all set up in triplicate and the results averaged.

Wheat variety water source 11 is described in literature "Wan C,Liu Y,Tian S,Guo J,Bai X,Zhu H,Kang Z,Guo J.A serine-rich effector from the stripe rust pathogen targets a Raf-like kinase to suppress host immunity,Plant Physiology,2022,190(1):762-778", under the designation "Suwon11" in the literature.

No. 31 of the new species of Rumex japonicus (abbreviated as Rumex japonicus CYR 31) is disclosed in documents "Wang Fengle, wu Liren, xu Shichang, jin Shelin, gu Qiuzhen, yuan Wenhuan, yang Guxiu. Ind. 30, 31 of the new species of Rumex japonicus [ J ] Protect plant school, 1996 (01): 39-44 ]. The public is available from the university of agriculture and forestry science and technology in northwest.

PSUC2T7M13ORI vector, pGR107-PVX vector, BSMV: gamma vector, BSMV: alpha vector, BSMV: beta vector and BSMV: PDS: the public is described in literature "Tuo Qi,Jia Guo,Peng Liu,Fuxin He,Cuiping Wan,Md Ashraful Islam,Brett M Tyler,Zhensheng Kang,Jun Guo.Stripe Rust Effector PstGSRE1Disrupts Nuclear Localization of ROS-Promoting Transcription Factor TaLOL2 to Defeat ROS-InducedDefense in Wheat.Mol Plant.2019Dec 2;12(12):1624-1638.", and is available from the university of agriculture and forestry science and technology in northwest, and the biological material is only used for repeated experiments related to the invention and cannot be used for other purposes. pSUC2T7M13ORI vector the pSUC vector is abbreviated in the examples below.

PGR 107A 107-PVX-GFP vector is obtained by substituting a fragment between the recognition sites of restriction endonucleases Cla1 and Not1 of pGR A107-PVX vector with the nucleotide sequence of GFP (GenBank: AAB 02572.1), and maintaining pGR A107-PVX vector other sequences unchanged.

The pGR-PVX-PstGSRE 1 vector was obtained by substituting the restriction endonuclease Cla1 and Not1 recognition site of the pGR-107-PVX vector with the nucleotide sequence of PstGSRE1 (GenBank: MH 426738) and keeping the other sequences of the pGR-107-PVX vector unchanged to obtain a recombinant expression vector which expresses PstGSRE1 protein.

The following examples were run using GRAPHPAD PRISM statistical software and the experimental results were expressed as mean ± standard deviation using One-way ANOVA test, P < 0.05 (x) indicated significant differences and P <0.01 (x) indicated very significant differences.

The inventor of the invention obtains an effector Pst00846 which is highly expressed in the invasion process of the wheat stripe rust by transcriptome data analysis in the early stage, and finds that Pst00846 is highly expressed in the early invasion stage by qRT-PCR analysis; the signal peptide of Pst00846 is verified to have secretion function through a yeast secretion system, which shows that Pst00846 is a typical secretion protein; the positioning of Pst00846 to cytoplasm and nucleus was found by tobacco subcellular localization and wheat protoplast localization experiments; the tobacco heterologous expression system is utilized to find that Pst00846 can inhibit Bax-induced cell necrosis, so that the preliminary explanation is that Pst00846 can play a toxic function in the rust infection process and promote infection. Two specific sequences are selected on Pst00846 for amplification, and named Pst00846-1as and Pst00846-2as, the two amplified specific fragments are connected to a BSMV: gamma vector, and the toxicity function exerted by Pst00846 is further studied by HIGS technology. The method comprises the following steps:

Example 1:

Selecting a wheat variety water source 11 for inoculation test, when wheat grows to a two-leaf and one-heart state, selecting about 7-8cm of the middle section of the two leaves as an inoculation part, marking the inoculation part by a marker pen in advance, so as to facilitate the subsequent inoculation and subsequent sample collection. Culturing under proper conditions after inoculating the Rumex patiens CYR31, and selecting time points of 2h, 4h, 6h, 8h, 12h, 18h, 24h, 36h, 48h, 72h, 96h, 120h and 168h for sampling. The sampled sample is put into tinfoil paper, the name and sampling time of the sample are marked, the sample is immediately put into liquid nitrogen for quick freezing, and then the sample is stored in a refrigerator at minus 80 ℃ in a laboratory. RNA was extracted using the Wash Viea ultra-fast plant RNA extraction kit. Reverse transcription was performed with the aid of reverse transcription kit REVERTAID FIRST STRAND CDNA SYNTHESIS KIT (Thermo Fisher).

According to the Pst00846 gene sequence obtained by amplification (shown as SEQ ID No.2, the coded protein sequence is shown as SEQ ID No. 1), a quantitative primer is designed by using related software, and the specificity of the quantitative primer is verified to ensure accurate amplification results. The quantitative primers are:

qRT-PCR-Pst00846-F：5’-CACCATCAACCATAACCAGGC-3’

qRT-PCR-Pst00846-R：5’-GATCATACCCAAATTCAGAGAACTCT-3’

Quantitative Mix is prepared according to qPCR SYBR GREEN MASTER Mix instruction, and after uniform instantaneous separation, a reaction program is set in a real-time fluorescence quantitative PCR instrument according to the instruction.

SEQ ID No.1

MNTSLLLLLLLLITINHNQADQQQQLILNPSQQEQQPQINTYLGWSSWSLQAYRGKGYGFHWLNERHVKAQADVIYKEFSEFGYDRINLDSGWQDAELDGYGRTVLNTETFPSGIDGLQSYLSQRNLKLGLYYLPGIDSRAVDNQYPVRNTEYTADQIIQCPIDHHHLNHNEQRRPKCDRPMANAFNSGYALNYSHPGSQMYINSVVDGLYSWNVSFVKLDALVPGSSFSPEDYTKCDTREDIAAWRRAIDSRYEEEWQYAGRERIWLVASWAIPTIEGPTMDLNADSWRVEQDIEAYGQRMTTFDRVIRNIKTAALWTSVEKNRAYRGLIDLDSLLISDMTYQESMSTVTLWAILGSPFYLGDDLTTLSEPRKKLVQNVEVLEVARIASQNPAKLERFDQSKLDQYRLTKNPENQMKIIEDCERFVEKRRMVVGLSLHQNVDSVFDLHQCLKNQFNRYRSSTLSPLDSSSQDSSEWDLQRWVLQHDHGVLFVAIINAGYQNDFDIPREVEIKLSELETFQGTRSRPSNNNNKKGLKSVDEGTPEEEDWYSVRDLWKRETIGLVTFDGKIKVKLGVHGSILLKFTPIIKF

SEQ ID No.2

atgaacactagcttactactactactgctgctgcttatcaccatcaaccataaccaggcagatcaacaacagcaacttatactcaatccaagccaacaggaacaacagcctcagatcaatacctatctcggttggtctagctggagtttacaagcttatagagggaagggatatggattccattggttaaacgaacgtcatgttaaagctcaagctgatgtaatctataaagagttctctgaatttgggtatgatcgaattaacttggattcgggttggcaagacgctgaactggatggatacggtcgaacggtactcaatactgaaacttttccgagtggaatcgatggtttacagtcatatctaagccaaagaaacctcaaattgggattatattatttaccaggaattgattcacgagcagtagacaatcaatatccggttaggaatacggagtacacggccgaccaaatcattcaatgtcctatcgaccatcaccacttgaaccacaatgaacaacgtcgtccgaaatgtgatagaccgatggccaatgccttcaattcaggatatgcgttgaactacagtcatccgggaagtcagatgtatatcaacagtgtcgtggatggattatatagctggaacgtgagctttgtcaagctggatgcgctcgtaccgggatcatcattctctccagaggattacaccaagtgtgatacacgtgaggatatagcggcatggaggagagcgatcgattcccgatacgaggaggagtggcaatatgcgggcagggaacggatttggttggttgctagttgggcaattccaactatcgaaggtccgacgatggacttgaacgccgatagttggcgagtcgaacaagatatcgaggcttatggtcaacgtatgactacgttcgatcgagtcattcgtaacatcaaaaccgctgctctctggacctcagtcgaaaagaatcgcgcgtatagagggcttatcgatctcgattccctcctcattagcgatatgacttaccaagaatctatgagtactgtcactctttgggcaattctcggctcaccattttatttaggagatgatttaaccacattatctgaaccaagaaagaaattagttcaaaacgtagaagtgttagaagtagcaagaatagcgagtcaaaacccagccaagttagaaagatttgatcaaagtaaacttgatcaatatcgactgaccaaaaatcctgaaaaccaaatgaagataatcgaagattgtgaaagatttgtagagaaacgtaggatggttgttggattatctcttcatcaaaatgttgactctgtattcgacctccatcaatgcttgaaaaatcaattcaatcgttatagatcttctactctctctcctcttgattcctcatctcaagactcgtctgaatgggatcttcaacgttgggttttgcaacatgatcatggtgttctttttgtggctattatcaatgccggttatcaaaatgatttcgatataccaagagaagtagagattaagttaagtgaattagaaacttttcaaggtactagatctcgaccaagcaacaacaacaacaaaaaaggcttgaaatcagtcgatgaaggtacaccagaagaagaggattggtattcagttcgagatttatggaagagagagactattggattagttacttttgatgggaaaattaaggttaagttaggcgttcatggttctatcttacttaaattcacccctatcatcaaattctga

As a result, as shown in FIG. 1, the wheat rust gene Pst00846 significantly up-regulated expression at the early stage of rust infection of 4hpi (4 h after infection) and at the early stage of 18hpi (18 h after infection).

Example 2 Pst00846 is a typical secreted protein

The 1-20 amino acids of effector Pst00846 were predicted by Signal 4.1 website as Signal peptide, the nucleotide sequence of the predicted Signal peptide (i.e., 1-60 DNA sequence of SEQ ID No. 2) was ligated into pSUC2 vector, resulting in recombinant expression vector Pst00846 (Pst 00846 in fig. 2), which was a fragment between restriction endonuclease EcrRI (GAATTC) and XhoI (CTCGAG) recognition sites of pSUC vector replaced with 1-60 DNA sequence of SEQ ID No.2, and other sequences of pSUC2 vector were kept unchanged, resulting in recombinant expression vector expressing Signal peptide consisting of 1-20 amino acids of Pst 00846.

The nucleotide sequence of the soybean phytophthora effector Avr1b was ligated into pSUC vector to obtain a recombinant expression vector Avr1b (Avr 1b in fig. 2), which replaces the fragment between the restriction endonuclease EcrRI (GAATTC) and XhoI (CTCGAG) recognition sites of pSUC vector, and keeps the other sequences of pSUC vector unchanged, which expressed Avr1b protein. pSUC2 (empty vector), recombinant expression vector Pst00846 and recombinant expression vector Avr1b were transferred into yeast strain YTK12, respectively, to obtain recombinant strain pSUC, recombinant strain Pst00846 and recombinant strain Avr1b.

Recombinant strain pSUC, recombinant strain Pst00846, recombinant strain Avr1b, yeast empty strain YTK12 and yeast empty strain Mg87 were inoculated on CMD-W and YPRAA medium, respectively, and as a result, as shown in fig. 2, yeast empty strain YTK12 could not grow on CMD-W and YPRAA medium, nor could TTC be reduced to red TRF; recombinant strain pSUC containing pSUC vector (empty vector) and yeast empty strain Mg87 were able to grow on CMD-W but not on YPRAA medium, nor were TTCs reduced to red TRF; while the positive control recombinant strain Avr1b and the experimental recombinant strain Pst00846 were able to grow on CMD-W and YPRAA medium while being able to reduce TTC to red TRF. From this, it was found that the signal peptide of Pst00846 has a secretory function, and Pst00846 is a typical secretory protein.

Example 3, pst00846 inhibits Bax-induced cell necrosis

PGR107-PVX-Pst00846 vector (Pst 00846 in FIG. 3): pst00846 was constructed into vector pGR-107-PVX vector to obtain recombinant expression vector pGR-PVX-Pst 00846, the recombinant expression vector pGR-PVX-Pst 00846 was a fragment between restriction endonuclease Cla1 and Not1 recognition site of pGR-PVX vector replaced with the nucleotide sequence shown in SEQ ID No.2, and other sequences of pGR-PVX vector were kept unchanged to obtain recombinant expression vector expressing Pst00846 protein.

Agrobacterium containing pGR.sup.107-PVX-Pst 00846 vector: the pGR-PVX-Pst 00846 vector was transferred into Agrobacterium tumefaciens competent GV3101 by cold transfer to obtain Agrobacterium containing the pGR-PVX-Pst 00846 vector.

Agrobacterium containing pGR107,107-PVX-PstGSRE 1 vector: the pGR-PVX-PstGSRE 1 vector was transferred into Agrobacterium tumefaciens competent GV3101 by cold transfer to obtain Agrobacterium containing the pGR-PVX-PstGSRE 1 vector.

Agrobacterium containing pGR107,107-PVX-GFP vector: the pGR-PVX-GFP vector was transferred into Agrobacterium tumefaciens competent GV3101 by cold transfer to obtain Agrobacterium containing pGR-PVX-GFP vector.

Each group was tested using the tobacco heterologous expression system according to the following method:

Pst00846+mgcl ₂ group: and (3) injecting the agrobacterium tumefaciens bacterial solution containing pGR-PVX-Pst 00846 vectors after treatment to the back of the tobacco leaves, carrying out light shielding treatment for 12 hours, transferring to culture under normal illumination for 12 hours, and injecting MgCl ₂. After 12h of light-shielding treatment, the culture is carried out for 3 to 5 days in a normal culture environment.

Pst00846+bax group: and (3) injecting the agrobacterium tumefaciens bacterial solution containing pGR-PVX-Pst 00846 vectors after treatment to the back of the tobacco leaves, carrying out light shielding treatment for 12 hours, transferring to normal light for culturing for 12 hours, and injecting BAX. After 12h of light-shielding treatment, the culture is carried out for 3 to 5 days in a normal culture environment.

Gfp+mgcl ₂ group: the agrobacterium liquid containing pGR-PVX-GFP vector is injected to the back of tobacco leaf, and then is processed for 12 hours in a dark place, and is transferred to normal light for culturing for 12 hours, and then MgCl ₂ is injected. After 12h of light-shielding treatment, the culture is carried out for 3 to 5 days in a normal culture environment.

Gfp+bax group: and (3) injecting the agrobacterium tumefaciens bacterial liquid containing pGR-PVX-GFP vector after treatment to the back of the tobacco leaf, carrying out light shielding treatment for 12h, transferring to culture under normal illumination for 12h, and injecting BAX. After 12h of light-shielding treatment, the culture is carried out for 3 to 5 days in a normal culture environment.

PstGSRE1+mgcl ₂ group: and (3) injecting the agrobacterium tumefaciens bacterial liquid containing pGR-PVX-PstGSRE 1 vector after treatment to the back of the tobacco leaf, carrying out light shielding treatment for 12 hours, transferring to culture under normal illumination for 12 hours, and injecting MgCl ₂. After 12h of light-shielding treatment, the culture is carried out for 3 to 5 days in a normal culture environment.

PstGSRE1+bax group: and (3) injecting the agrobacterium tumefaciens bacterial liquid containing pGR-PVX-PstGSRE 1 vector after treatment to the back of the tobacco leaf, carrying out light shielding treatment for 12 hours, transferring to culture under normal illumination for 12 hours, and injecting BAX. After 12h of light-shielding treatment, the culture is carried out for 3 to 5 days in a normal culture environment.

As shown in FIG. 3, pst00846 can inhibit Bax-induced cell necrosis, and initially shows that Pst00846 plays a toxic function in the rust infection process and promotes infection.

Example 4 localization of Pst00846 to the cytoplasm and nucleus

1. The tobacco subcellular localization test proves that Pst00846 is distributed in cytoplasm and nucleus

PCAMBIA1302 vector: the public is described in literature "Yunqian Wang,Cong Liu,Yuanyuan Du,Kunyan Cai,Yanfeng Wang,Jia Guo,Xingxuan Bai,Zhensheng Kang,Jun Guo.A stripe rust fungal effector PstSIE1 targets TaSGT1 to facilitate pathogen infection.Plant J.2022Dec;112(6):1413-1428.", and is available from the university of agriculture and forestry science and technology in northwest, and the biological material is only used for repeated experiments related to the invention and cannot be used for other purposes.

The nucleotide sequence of gene Pst00846 ^Δsp (i.e., bases 61-1773 of SEQ ID No. 2) from which the signal peptide was removed was ligated to a fragment between the restriction endonuclease spe1 and Avr2 recognition sites of the pCAMBIA1302 vector, and the other sequences of the pCAMBIA1302 vector were kept unchanged to obtain a recombinant expression vector expressing the protein of the Pst00846 ^Δsp gene. By using a tobacco heterologous expression system, an empty vector pCAMBIA1302-GFP is selected as a control, and the specific method is as follows: and (3) injecting the agrobacterium tumefaciens bacteria solution containing the target body after treatment to the back of the tobacco leaf, carrying out light shielding treatment for 12 hours, transferring to culture under normal illumination for 12 hours, and injecting BAX. After 12h of light-shielding treatment, the culture is carried out for 3 to 5 days in a normal culture environment. The results show that Pst00846 ^Δsp -GFP is localized predominantly to the cytoplasm and nucleus in tobacco as shown in FIG. 4.

2. The wheat protoplast test proves that the Pst00846 is distributed in cytoplasm and nucleus

PJIT16318 vector: the public is described in literature "Xingxuan Bai,Gangming Zhan,Shuxin Tian,Huan Peng,Xiaoyu Cui,Md Ashraful Islam,Farhan Goher,Youzhi Ma,Zhensheng Kang,Zhao-Shi Xu,Jun Guo.Transcription factor BZR2 activates chitinase Cht20.2 transcription to confer resistance to wheat stripe rust.Plant Physiol.2021Dec 4;187(4):2749-2762.", and is available from the university of agriculture and forestry science and technology in northwest, and the biological material is only used for repeated experiments related to the invention and cannot be used for other purposes.

To further clarify the localization of Pst00846 in wheat cells, the nucleotide sequence of Pst00846 ^Δsp (i.e., bases 61-1773 of SEQ ID No. 2) was ligated to a fragment between the restriction endonuclease BamHI recognition sites of the pJIT16318 vector, and the other sequences of the pJIT16318 vector were kept unchanged to give a recombinant expression vector (Pst 00846 ^Δsp -GFP in fig. 5) that expressed the protein of the Pst00846 ^Δsp gene. The empty vector pJIT16318 was selected as a control (EV-GFP in FIG. 5). The obtained plasmid was subjected to large extraction using the plasmid large extraction kit from century corporation. The wheat protoplast is then obtained and transformed by the following experimental method:

(1) Spreading water absorbing paper in a culture dish, selecting water source 11 wheat seeds with plump seeds, uniformly scattering about 40 seeds on the water absorbing paper, adding a certain tap water into the culture dish, and culturing at room temperature for about 8 d;

(2) Cutting the cultured wheat leaves into small sections of about 2mm by a blade, pouring the small sections into a culture dish, adding 15mL of enzymolysis liquid into the culture dish, wrapping the culture dish by tinfoil paper, and vacuumizing in a vacuum pump for 30 min. The preparation method of the enzymolysis liquid comprises the following steps:

TABLE 1

(3) Placing the culture dish after the vacuumizing is finished into a room temperature shaking table, processing for 4 hours at 40rpm, and then adding an equal volume of W5 solution to terminate the reaction;

(4) Taking out the sterilized 200-mesh screen, using a small amount of W5 solution to rinse the screen, filtering the liquid in a new 50mL centrifuge tube by using the screen, placing the 50mL centrifuge tube in a horizontal rotor centrifuge at 4 ℃, centrifuging for 10min at 3-4 g under acceleration and deceleration, and carefully sucking the supernatant by using a gun head with a gun head tip subtracted;

(5) Carefully adding 10mL of precooled W5 solution into a centrifuge tube along the tube wall, lightly rotating the centrifuge tube to resuspend the sediment, centrifuging for 10min in the same procedure, carefully sucking and discarding the supernatant, and repeating for one time;

(6) Carefully adding 3mL of precooled W5 solution into a centrifuge tube along the tube wall, lightly rotating the centrifuge tube to resuspend the sediment, standing on ice for 30min, centrifuging for 10min after the standing is finished, and carefully sucking and discarding the supernatant;

(7) Carefully adding 2mL of precooled MMG solution into a centrifuge tube along the tube wall, lightly rotating the centrifuge tube to resuspend the sediment, and placing the sediment on ice for standby, wherein the obtained mixture is protoplast suspension;

(8) Taking a new round bottom 2mL centrifuge tube, adding 10 mug of large extraction plasmid, then adding 100 mug of protoplast suspension and 110 mug of PEG solution, immediately lightly rotating the bottom of the tube to uniformly mix the protoplast suspension and the PEG solution, and placing the uniformly mixed centrifuge tube into a 23 ℃ metal bath for reaction for 30min;

(9) Taking out the centrifuge tube from the metal bath, carefully adding 450 mu L of precooled W5 solution along the wall, lightly rotating the bottom of the tube to resuspend, centrifuging for 2min at room temperature by 300g, carefully sucking and discarding the supernatant, and repeating for one time;

(10) 200 mu L of precooled W5 solution is carefully added into a centrifuge tube along the wall, the bottom of the tube is gently rotated to be resuspended, and the tube is placed in a 23 ℃ metal bath to be subjected to dark culture for 16-18 hours, and then the expression condition and the fluorescence distribution condition are observed through a high-resolution microscopic imager FV 3000.

The results show that Pst00846 Δ ^sp -GFP is localized predominantly to the cytoplasm and nucleus in wheat protoplast cells as shown in figure 5.

Example 5 transient silencing of Pst00846 using HIGS (Host-reduced GENE SILENCING, HIGS) technique

Two specific DNA fragments named Pst00846-1as (nucleotide sequence is 853 to 1071 of SEQ ID No. 2) and Pst00846-2as, respectively, were selected on Pst00846 for amplification. Wherein Pst00846-1as encodes a peptide having the amino acid sequence of amino acids 285 to 357 of SEQ ID No.1, and Pst00846-2as encodes a peptide having the amino acid sequence of amino acids 89 to 155 of SEQ ID No. 1. The two specific fragments obtained by amplification are connected to a BSMV: gamma vector to obtain recombinant viral vectors BSMV: pst00846-1as and BSMV: pst00846-2as. The recombinant viral vector BSMV: pst00846-1as is a fragment between the restriction endonuclease NOT1 and PAC1 recognition site of the BSMV: gamma vector replaced by a DNA molecule which is reversely complementary to Pst00846-1as shown in the nucleotide sequence of 853 to 1071 of SEQ ID No.2, and other sequences of the pBSMV: gamma vector are kept unchanged to be recombinant expression vectors. The recombinant viral vector BSMV: pst00846-2as is a fragment between the restriction endonuclease NotI and PacI recognition sites of the BSMV: gamma vector replaced by a DNA molecule which is reversely complementary to Pst00846-2as shown in the 265 th to 465 th nucleotide sequence of SEQ ID No.2, and other sequences of the pBSMV: gamma vector are kept unchanged to be recombinant expression vectors.

1. BSMV related vector linearization

In order to obtain the virus with single-stranded RNA, the recombinant viral vectors BSMV: pst00846-1as, BSMV: pst00846-2as, BSMV: gamma, BSMV: alpha, BSMV: beta and BSMV: PDS are subjected to linearization treatment, and the specific treatment system is as follows:

the BSMV: gamma and BSMV: alpha treatment systems are as follows:

TABLE 2

Reagent(s)	Dosage of
		Vector plasmid	1μg
MluⅠ	1μL
		R Buffer(10×)	1μL
ddH2O	To10μL

The BSMV: beta treatment system is as follows:

TABLE 3 Table 3

Reagent(s)	Dosage of
		Vector plasmid	1μg
SpeⅠ	1μL
		Tango Buffer(10×)	1μL
ddH2O	To10μL

For BSMV: pst00846-1as, BSMV: pst00846-2as, BSMV: PDS treatment system is as follows:

TABLE 4 Table 4

Reagent(s)	Dosage of
		Vector plasmid	1μg
BsshⅡ	0.5μL
		RBuffer(10×)	1μL
ddH2O	To10μL

After the sample is added into a PCR tube, the PCR tube is placed into a metal bath at 37 ℃ for reaction for 4 hours, 1 mu L of enzyme digestion product is sucked into a new PCR tube, 1 mu L of 5 multiplied by DNA loading buffer and 5 mu L of ddH ₂ O are added into the new PCR tube, and after blowing and mixing, whether linearization is successful or not is detected by agarose gel electrophoresis.

2. In vitro transcription of BSMV-related vector linearized products

Placing the residual linearization products successfully detected by linearization on ice, and carrying out the following experiment by using RiboMAX LARGE SCALE RNA Production System-T7, ribom 7 and G Cap Analog Caps in-vitro transcription kits, wherein the whole experiment process is carried out in an ultra-clean workbench, the used reagents are required to be placed on ice in the whole process, and an experimenter wears a mask in the whole process, and the method comprises the following specific operations:

TABLE 5

Adding the above reagent into an RNAase-free PCR tube, placing the RNAase-free PCR tube into a PCR instrument, reacting for 2 hours at 37 ℃, then sucking 1 mu L of reaction product into a new PCR tube in an ultra-clean workbench, adding 1 mu L of 5X DNA loading buffer and 5 mu L of ddH ₂ O into the new PCR tube, blowing and mixing uniformly, detecting whether the in-vitro transcription is successful or not through agarose gel electrophoresis, then adding 20 mu L of RNAase-free H ₂ O into the RNAase-free PCR tube successful in the in-vitro transcription, sucking and mixing uniformly, and placing into a refrigerator at-80 ℃ for preservation for standby, thereby respectively obtaining BSMV-alpha in-vitro transcribed RNA, BSMV-beta in-vitro transcribed RNA and BSMV: taRHP1 in vitro transcription of RNA.

3. Inoculation of BSMV virus

(1) Selecting 15-16 seeds of water source 11 full of seeds, uniformly planting the seeds in square basin, culturing under proper conditions, and inoculating virus to the middle part of two leaves when wheat seedlings grow to a two-leaf one-heart period after about 2 weeks. Wherein the virus is a virus used for Mock treatment, a virus used for BSMV: gamma treatment, a virus used for BSMV: pst00846-1as treatment or a virus used for BSMV: pst00846-2as treatment respectively. 40 wheat seedlings were inoculated with each virus.

Preparation of virus used for Mock treatment:

Preparation of virus used for BSMV. Gamma. Treatment: mixing BSMV-alpha in vitro transcribed RNA, BSMV-beta in vitro transcribed RNA, BSMV: gamma in vitro transcribed RNA and Fes buffer according to Table 6 to obtain the virus used for BSMV: gamma treatment.

Preparation of virus used for treatment of BSMV: pst00846-1 as: the BSMV-alpha in vitro transcribed RNA, the BSMV-beta in vitro transcribed RNA and the BSMV: pst00846-1as in vitro transcribed RNA were mixed with Fes buffer according to Table 6 (composition of virus) to obtain the virus used for the BSMV: pst00846-1as treatment.

Preparation of virus used for treatment of BSMV: pst00846-2 as: the BSMV-alpha in vitro transcribed RNA, the BSMV-beta in vitro transcribed RNA, the BSMV: pst00846-2as in vitro transcribed RNA and the Fes buffer were mixed according to Table 6 to obtain the viruses used for the treatment of BSMV: pst00846-2 as.

(2) When the virus is inoculated, a mask is required to be worn, the following reagents are sucked by using a special gun head of RNAase-free according to a proportion and mixed on a new PE glove, the mixture is gently blown and evenly mixed, and the gun head is separated into a plurality of drops for inoculation. The ratio of the reagents added is as follows:

TABLE 6

The Fes buffer formulation was as follows:

TABLE 7

Reagent(s)	Dose/wheat per plant
		Sodium pyrophosphate	1g
Diatomite	1g
		Glycine (Gly)	0.75g
Bentonite	1g
		Dipotassium hydrogen phosphate	1.05g
0.1% DEPC aqueous solution	To100mL

Fes buffer was added to a 250mL Erlenmeyer flask according to the formulation, and incubated at 30℃and 200rpm for 24 hours. Sterilizing with high pressure steam sterilizing pot at 121deg.C for 30min, subpackaging with 2mL centrifuge tube in ultra-clean workbench, and preserving at-80deg.C;

(3) The inoculation is preferably performed by rubbing the wheat two leaves with a new small latex glove, dipping the mixture on the PE glove, and preferably generating a slight squeak. After the inoculation is finished, the mixture is subjected to dark moisture preservation at 25 ℃ for 24 hours and then is transferred into a normal photoperiod, and the mixture is subjected to continuous high-temperature high-humidity culture at 25 ℃;

(4) About 10d after virus inoculation, the virus symptoms are observed, the photo-bleaching phenomenon of BSMV: PDS, the mosaic leaf phenomenon of BSMV: gamma, BSMV: pst00846-1as or BSMV: pst00846-2as appears, namely, the virus is normal, and the following inoculation experiment is carried out.

4. Inoculation of wheat stripe rust and collection and treatment of sample

(1) Removing plants without toxicity, selecting plants with normal toxicity in the third step, inoculating wheat stripe rust bacteria CYR31 after 2 weeks of toxicity inoculation, selecting four leaves of the wheat plants at the inoculation position, and marking the inoculation position by a marker pen in advance so as to facilitate subsequent inoculation and sample collection;

(2) Collecting histological samples and RNA samples 24h, 48h and 120h after inoculating the wheat stripe rust;

(3) When a histological sample is collected, preparing DAB dye liquor in advance, preparing 0.1% DAB, dissolving in HCl (pH=3.8), sucking 500 mu L DAB dye liquor in a 2mL centrifuge tube, shearing 2-3cm She Duanyi morphological upper end up, placing the DAB dye liquor with morphological lower end down, placing the DAB dye liquor under room temperature illumination for 8 hours, placing the leaves in decolorizing solution (ethanol: glacial acetic acid=1:1) for decolorizing treatment when the DAB dye liquor is completely at the morphological upper end, replacing the decolorizing solution every other day until the decolorizing of the leaves is completed, placing the decolored leaves in saturated chloral hydrate for fixing treatment, and observing the active oxygen condition of the leaves by a fluorescence microscope after fixing for 8 hours;

(4) The histological samples after observing the active oxygen continued to be stained with wheat germ lectin (WGA). Firstly, washing 3 times with 50% ethanol for 15min each time, then washing 3 times with 50mM Tirs-HCl (pH=7.5) buffer solution for 5min each time, immersing the leaves in the solution by adding 1M KOH each time, sterilizing the leaves with high-pressure steam at 105 ℃ for 1min, then washing 3 times with 50mM Tirs-HCl (pH=7.5) buffer solution for 5min each time, adding WGA dye solution into the leaves, dyeing overnight, washing 3 times with 50mM Tirs-HCl (pH=7.5) buffer solution for 5min each time, and finally placing the leaves into 50mM Tirs-HCl (pH=7.5) buffer solution for room temperature preservation.

5. Sample collection and treatment after inoculation of wheat stripe rust

Samples of 5d and 10d after inoculation are collected for DNA extraction, then Rael-time PCR is used for analyzing the relative biomass content, and a CTAB method is adopted for DNA extraction, and the specific experimental steps are as follows:

(1) Fully grinding the collected sample, adding the powder into a 2mL centrifuge tube, sucking 600 mu L of CTAB extract into the 2mL centrifuge tube, shaking and uniformly mixing by a vortex instrument, placing the mixture into a 65 ℃ oven for 30min, and uniformly mixing every 10min in a reverse way;

(2) Absorbing 600 mu L of DNA extracting solution (phenol: chloroform: isoamyl alcohol=25:24:1, PH > 7.8), adding into a centrifuge tube, shaking and mixing by a vortex machine, centrifuging at room temperature of 12000rpm for 10min;

(3) Sucking 550 mu L of supernatant into a new centrifuge tube, adding 550 mu L of chloroform, mixing uniformly by vortex, and centrifuging at the room temperature of 12000rpm for 10min;

(4) Sucking 500 mu L of supernatant into a new 1.5mL centrifuge tube, adding 500 mu L of simulated isopropanol at 4 ℃, vortex mixing uniformly, and placing into a refrigerator at-20 ℃ for standing for 10 hours;

(5) Centrifuging the refrigerated and standing centrifuge tube at 12000rpm for 10min, discarding the supernatant, adding 700 μl of 75% ethanol, swirling to resuspend the precipitate at 12000rpm, centrifuging for 10min, and discarding the supernatant;

(6) Adding 700 μl of absolute ethanol, vortexing to resuspend the precipitate, centrifuging at 12000rpm at room temperature for 10min, discarding supernatant, standing at room temperature for 6h to volatilize ethanol completely, adding 200 μl of ddH2O, standing at room temperature for 8h, measuring the concentration, and storing in a refrigerator at-20deg.C for use.

The results are shown in FIG. 6: the silencing efficiency analysis is performed by qRT-PCR on leaves 24h, 48h and 120h after inoculation, and the transcriptional expression level of Pst00846 in the silencing plant (calculation method 2 ^-ΔΔt) is obviously reduced (P < 0.01) compared with the control (D in fig. 6), so that Pst00846 is proved to be effectively silenced. The number of plant leaf spores of the inoculum 14d was observed, and it was found that the spore production of the rust on the leaves of the silencing plants BSMV: pst00846-1as and BSMV: pst00846-2as was reduced (FIGS. 6B and C) compared with the control group (Mock) and BSMV: γ group, and that the biomass of the rust summer spores was indeed reduced (FIG. 6E) by biomass quantitative analysis (calculation method 2 ^-ΔΔt).

The observation of the active oxygen area and hypha growth process in the process of the wheat stripe rust infection of the silent plant is shown in fig. 7: the active oxygen area in the silencing plants BSMV: pst00846-1as and BSMV: pst00846-2as was increased (C in FIG. 7), while the hypha length (D in FIG. 7) and colony area in the Pst00846 silencing plants were decreased (E in FIG. 7). The expression shows that the growth of the rust is obviously inhibited by the silencing plants BSMV: pst00846-1as and BSMV: pst00846-2 as.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains.

Claims (2)

1. A method for growing a rust resistant plant, comprising introducing into a plant of interest a gene encoding an RNA molecule that is more resistant to rust than the plant of interest, wherein the RNA molecule targets mRNA transcribed from the gene encoding a protein whose amino acid sequence is SEQ ID No.1, wherein the plant is wheat, and wherein the nucleotide sequence of the gene encoding the RNA molecule is reverse-complementary to nucleotides 265 to 465 of SEQ ID No.2 or to nucleotides 853 to 1071 of SEQ ID No. 2.

2. Use, characterized in that the use of a biological material related to the protein of claim 1 is any of the following:

d1 Increasing the disease resistance of wheat stripe rust;

d2 Preparing a product for improving the disease resistance of wheat stripe rust;

d3 Cultivating wheat with improved stripe rust disease resistance;

D4 Preparing a product for cultivating wheat with improved disease resistance of stripe rust;

d5 Improving wheat with high resistance to stripe rust or preparing a product of wheat with high resistance to stripe rust;

D6 Wheat breeding;

D7 Inhibiting growth and development of rust bacteria;

d8 Preparing a product for inhibiting the growth and development of the stripe rust;

The biological material is any one of the following:

B1 An RNA molecule that inhibits or reduces or down-regulates the expression of a gene encoding the protein or an RNA molecule that inhibits or reduces or down-regulates the activity or content of the protein; the amino acid sequence of the protein is SEQ ID No.1, and the nucleotide sequence of the coding gene of the RNA molecule is reversely complementary with 265 th to 465 th nucleotides of SEQ ID No.2 or 853 th to 1071 th nucleotides of SEQ ID No. 2;

b2 A gene encoding the RNA molecule of B1);

b3 An expression cassette comprising the gene of B2);

B4 A recombinant vector comprising the gene of B2), or a recombinant vector comprising the expression cassette of B3);

B5 A recombinant microorganism comprising the gene of B2), a recombinant microorganism comprising the expression cassette of B3), or a recombinant microorganism comprising the recombinant vector of B4).