CN116656864A - Molecular marker for identifying cotton leaf cracking character, method and application - Google Patents
Molecular marker for identifying cotton leaf cracking character, method and application Download PDFInfo
- Publication number
- CN116656864A CN116656864A CN202310746900.XA CN202310746900A CN116656864A CN 116656864 A CN116656864 A CN 116656864A CN 202310746900 A CN202310746900 A CN 202310746900A CN 116656864 A CN116656864 A CN 116656864A
- Authority
- CN
- China
- Prior art keywords
- cotton
- leaf
- molecular marker
- indel
- identifying
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 229920000742 Cotton Polymers 0.000 title claims abstract description 95
- 239000003147 molecular marker Substances 0.000 title claims abstract description 38
- 238000000034 method Methods 0.000 title claims abstract description 20
- 238000005336 cracking Methods 0.000 title description 2
- 238000009395 breeding Methods 0.000 claims abstract description 14
- 230000001488 breeding effect Effects 0.000 claims abstract description 14
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 8
- 210000000349 chromosome Anatomy 0.000 claims abstract description 7
- 239000002773 nucleotide Substances 0.000 claims abstract description 6
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 6
- 230000003321 amplification Effects 0.000 claims description 16
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 16
- 238000003752 polymerase chain reaction Methods 0.000 claims description 10
- 210000001519 tissue Anatomy 0.000 claims description 10
- 238000012408 PCR amplification Methods 0.000 claims description 7
- 238000001514 detection method Methods 0.000 claims description 7
- 238000006243 chemical reaction Methods 0.000 claims description 6
- 238000003205 genotyping method Methods 0.000 claims description 5
- 238000012163 sequencing technique Methods 0.000 claims description 5
- 108010006785 Taq Polymerase Proteins 0.000 claims description 3
- 238000000137 annealing Methods 0.000 claims description 3
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 239000012154 double-distilled water Substances 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 239000003550 marker Substances 0.000 abstract description 8
- 230000012010 growth Effects 0.000 abstract description 4
- 230000000243 photosynthetic effect Effects 0.000 abstract description 3
- 238000002834 transmittance Methods 0.000 abstract description 2
- 238000009423 ventilation Methods 0.000 abstract description 2
- 241000219146 Gossypium Species 0.000 description 67
- 241000196324 Embryophyta Species 0.000 description 6
- 238000011161 development Methods 0.000 description 5
- 239000000463 material Substances 0.000 description 4
- 238000005457 optimization Methods 0.000 description 4
- 108090000623 proteins and genes Proteins 0.000 description 4
- 238000012216 screening Methods 0.000 description 4
- 230000018109 developmental process Effects 0.000 description 3
- 230000002068 genetic effect Effects 0.000 description 3
- 238000011835 investigation Methods 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 2
- 238000012165 high-throughput sequencing Methods 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 230000000877 morphologic effect Effects 0.000 description 2
- 230000029553 photosynthesis Effects 0.000 description 2
- 238000010672 photosynthesis Methods 0.000 description 2
- 230000008121 plant development Effects 0.000 description 2
- 230000008635 plant growth Effects 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 1
- 108700003861 Dominant Genes Proteins 0.000 description 1
- 240000002024 Gossypium herbaceum Species 0.000 description 1
- 235000004341 Gossypium herbaceum Nutrition 0.000 description 1
- 238000009825 accumulation Methods 0.000 description 1
- 230000006978 adaptation Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 230000009456 molecular mechanism Effects 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 238000007493 shaping process Methods 0.000 description 1
- 239000004753 textile Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application relates to a molecular marker for identifying cotton leaf splitting characters, a method and application thereof, wherein the molecular marker is 1 InDel molecular marker, the InDel molecular marker is a nucleotide sequence with 6724781 th base of cotton A01 chromosome and upstream and downstream base composition thereof, and the genotype of 6724781 th base of the InDel molecular marker positioned on the cotton A01 chromosome is T or T TCA GTC CAG TAA CAC GCC CTT. The InDel marker locus is closely linked or co-separated with the cotton leaf split trait, and the marker can be used for identifying the cotton leaf split trait and molecular breeding of the cotton leaf shape trait. The infinite growth habit of cotton is easy to cause the problems of canopy shading, low group light energy utilization rate and the like, and the ideal cotton leaf shape can reduce cotton group shading, so that the group ventilation light transmittance and photosynthetic efficiency are improved, and a foundation is laid for cotton high-light-efficiency breeding.
Description
Technical Field
The application belongs to the technical field of molecular markers, and particularly relates to a molecular marker for identifying cotton leaf splitting characters, a method and application thereof.
Background
Cotton is an important raw material of cotton textile industry and is also an important strategic material related to national folk life, the plant type of crops is a morphological structure expressed by crops for adapting to the environment, the quality and the yield of the cotton are directly determined, leaves are main places of photosynthesis, are main source organs of plant growth and development, bear 90% of organic matters required by the plant growth and development, the form of the leaves has important influence on the cotton growth and development, are important components of the morphological formation of the plant type, can directly influence the canopy structure and the photosynthetic efficiency of the crops, easily cause the canopy shadow of the cotton due to the infinite growth characteristics of the cotton, directly influence the light energy utilization efficiency of the population, and moderate leaf cracks can reduce the canopy shadow of the population, improve the light energy utilization rate of the population and achieve the aim of increasing the accumulation of dry matters and the yield of the crops.
The method is characterized in that the method is used for shaping ideal cotton leaf shapes, has great significance for constructing ideal cotton plant types, utilizes biological breeding technology to develop breeding of new varieties of cotton with high light efficiency, is one of the most effective ways for greatly improving cotton yield in the future, is mainly based on cultivation measures in the current cotton production process, has complex farm work operation, gradually increases the cost of manpower and material resources, has not broken through progress in cotton high light efficiency breeding, has limited genetic basis and molecular mechanism analysis generated by cotton leaf shape change so far, has relatively lack of gene resources for cotton leaf shape improvement, and severely restricts the cotton high light efficiency biological breeding process.
At present, only molecular markers related to the leaf crack depth of cotton are reported, but not related to the molecular markers of the leaf crack presence or absence of cotton are reported, and the application designs and screens InDel marker sites related to the leaf crack presence or absence of cotton through genetic positioning and primers, and can improve the accuracy of leaf shape character identification in the breeding process and improve the efficiency of ideal plant type breeding of cotton by utilizing the linkage markers of the leaf crack presence or absence of cotton.
Disclosure of Invention
The application aims to provide a molecular marker for identifying cotton leaf splitting characters, a method and application thereof, and compared with the prior art, the InDel molecular marker is directly expressed in the form of DNA, can be detected in all tissues and all development stages of cotton, is not limited by environment and seasons, is not affected by the problems of expression or the like, and can provide practical markers, gene resources and germplasm resources for cotton high-light-efficiency breeding.
The application realizes the above purpose through the following technical scheme:
a molecular marker for identifying cotton leaf splitting characters, wherein the molecular marker is 1 InDel molecular marker, which is named as InDelNo.1, the InDel molecular marker is a nucleotide sequence with 6724781 base of cotton A01 chromosome and upstream and downstream base composition thereof, and the genotype of 6724781 base of the InDel molecular marker on cotton A01 chromosome is T or T TCA GTC CAG TAA CAC GCC CTT; the mutant forms of the molecular markers are shown in the following table:
the application of a molecular marker for identifying cotton leaf crack traits in cotton leaf-shaped molecular marker assisted breeding is disclosed, and the InDel molecular marker is used for detecting cotton leaf crack traits.
Method for identifying cotton leaf crack character by using molecular marker for identifying cotton leaf crack character
The method comprises the following specific steps:
step 1: extracting DNA of cotton tissues to be detected;
step 2: designing a specific amplification primer by taking a genome locus of the InDel molecular marker and a sequence consisting of upstream and downstream bases of the genome locus as a target sequence, and carrying out PCR (polymerase chain reaction) amplification by taking the DNA as a template and utilizing the specific amplification primer to obtain a PCR amplification product;
step 3: carrying out genotyping detection and sequencing on the amplified product to obtain the genotype of the cotton to be detected at the InDel locus to be detected;
step 4: judging the leaf shape character of the cotton according to the genotype of the molecular marker amplification product.
As a further optimization scheme of the present application, in step 2, the specific amplification primer sequence is:
upstream primer sequence: 5 'TAGGGGTGTAGGAGGATTTATTCTTTG3';
downstream primer sequence: 5'GTGATGATGGATGTTTTCTGGGATTTGATG3'.
As a further optimization scheme of the application, in the step 4, the genotype is T, the cotton to be identified is in a leaf-free split leaf shape, the genotype is T TCA GTC CAG TAA CAC GCC CTT, and the cotton to be identified is in a leaf-split leaf shape.
As a further optimization of the application, in step 1, the cotton tissue is selected from each tissue of each developmental stage of cotton.
As a further optimization scheme of the application, in step 2, the PCR amplification system is: 2 μl of DNA with a concentration of 80-200 ng/. Mu.L, 1 μl of each of forward and reverse primers of the specific amplification primer, 2 μl of 10 XPCR Buffer, 1.6 μl of 2.5mM dNTP, taqDNA Polymerase 0.2.2 μl, 12.2 μl of ddH2O, and 20 μl of the total reaction system; the PCR amplification procedure was: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s; annealing at 61 ℃ for 30s; extending at 72 ℃ for 30s;35 cycles; final extension at 72℃for 10min; the amplified product was stored at 4 ℃.
The application has the following beneficial effects:
1) The InDel marker locus is closely linked or co-separated with the cotton leaf split trait, and the marker can be used for identifying the cotton leaf split trait and molecular breeding of the cotton leaf shape trait. The infinite growth habit of cotton is easy to cause the problems of canopy shading, low group light energy utilization rate and the like, and the ideal cotton leaf shape can reduce cotton group shading, so that the group ventilation light transmittance and photosynthetic efficiency are improved, and a foundation is laid for cotton high-light-efficiency breeding;
2) The InDel molecular marker related to cotton leaf splitting provided by the application is directly expressed in a DNA form, can be detected in each tissue and development stage of cotton, is not limited by environment and seasons, is free from the problems of expression or the like, is obtained by extracting cotton tissue DNA, carrying out PCR amplification, comparing the extracted cotton tissue DNA with a reference sequence, and carrying out genotyping comparison on a detected single plant, so that different genotypes of InDel loci are effectively distinguished, and different cotton leaf shapes are screened and identified.
Drawings
FIG. 1 is a phenotypic chart of round leaf M2 (left, no leaf split) and Xinlunzao 74 (right, leaf split).
Detailed Description
The present application will be described in further detail with reference to the accompanying drawings, wherein it is to be understood that the following detailed description is for the purpose of further illustrating the application only and is not to be construed as limiting the scope of the application, as various insubstantial modifications and adaptations of the application to those skilled in the art can be made in light of the foregoing disclosure.
1. Material
The methods used in this example are conventional methods known to those skilled in the art unless otherwise indicated, and the materials such as reagents used are commercially available products unless otherwise indicated.
2. Method of
2.1, leaf shape Property investigation of F2 genetic populations
Taking Xinlanzao 74 (production popularization variety) and cotton round leaf M2 (from cotton germplasm mid-term library of China national academy of agricultural sciences) as parents, and obtaining F by hybridization 1 Selfing to form F 2 For the purpose of mapping the population,for F 2 Each individual plant of the population is subjected to leaf shape property investigation, the investigation result accords with Mendelian's law of separation, and the separation ratio is 1:2:1, it is explained that the leaf crack trait is controlled by a pair of incomplete dominant genes.
2.2, BSR high throughput sequencing method for locating leaf crack character gene locus
Based on the results, constructing two character extreme cDNA mixed pools for BSR high-throughput sequencing, comparing the sequencing results with a reference genome, eliminating false positives in variation results, correcting SNP and InDel error marks by using GATK software, ensuring that the detection results are correct and reliable, screening homozygous difference sites between two parents based on genotyping results, calculating SNP/InDel-index of mixed pool samples according to the detected SNP/InDel sites, calculating the frequency difference of the two extreme character mixed pools, selecting 95% confidence level as a screening threshold, selecting SNP/InDel sites with obvious difference between the two offspring in SNP/InDe l-index, namely selecting SNP/InDel sites with obvious difference between offspring 2 (extreme character B/vaneless crack) and SNP/InDel-index, and screening the sites with the extreme character A/vaneless crack) of offspring 1 (SNP/InDel-index being close to 0, thereby obtaining polymorphism mark sites as potential mutation sites of candidate genes.
2.3 InDel detection
The accuracy and reliability of InDel obtained by screening are verified by utilizing a PCR technology, and the InDel marker (see table 1) of which 1 is positioned on the A01 chromosome of cotton is found to be closely linked or co-separated with the cotton leaf splitting character by combining with the F2 population single plant leaf phenotype.
TABLE 1 InDel site information closely linked or co-separated with cotton leaf split traits
The InDel detection steps are as follows:
specific amplification primers for PCR reactions were designed based on InDel site information, and DNA extraction and PCR amplification were performed on leaves of 576 individuals in the F2 population as shown in Table 2.
Sequencing and typing detection is carried out on the amplified product, when the genotype of the InDel molecular marker locus is T, the cotton to be identified is in a leaf-free split leaf shape, and when the genotype of the InDel molecular marker locus is T TCA GTC CAG TAA CAC GCC CTT, the cotton to be identified is in a leaf-split leaf shape, as shown in Table 3.
TABLE 2 InDel specific amplification primer sequences closely linked or co-isolated with cotton leaf split traits
TABLE 3 InDelNo.1 amplification product sequencing typing detection results
PCR reaction system:
the PCR amplification system comprises: 2. Mu.l of DNA at a concentration of 80-200 ng/. Mu.l, 1. Mu.l of each of forward and reverse primers of the specific amplification primer, 2. Mu.l of 10 XPCR Buffer, 1.6. Mu.l of 2.5mM dNTP, taqDNA Polymerase 0.2.2. Mu.l, and 12.2. Mu.l of ddH2O, and 20. Mu.l of the total reaction system.
Reaction procedure for PCR: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s; annealing at 61 ℃ for 30s; extending at 72 ℃ for 30s;35 cycles; final extension at 72℃for 10min; the amplified product was stored at 4 ℃.
The nucleotide sequence of the amplified product of the InDel molecular marker is as follows:
SEQ ID NO.1-2：TAGCGGTGTAGGAGGAGGATTTATCTTTGGCACTCCTCCACCGCAGTCACTGCCGACGGCTTTTGGCCAAAACAGCCAATTGTTTTCTCAGAGGGGACCCC[T/TTCAGTCCAGTAACACGCCCTT]GGTTCGTGCTTGGATAGACCAGCCAATTTCCACAACCGACCAACACCAACACCAACACCATCATCATCAACAACATCACCACCATCAAATCCCAGAAAACATCCATCATCAC
wherein, the underline indicates the combination position of the upstream primer and the downstream primer with the DNA template, the deletion position and the variation type of InDel bases are arranged in brackets, the nucleotide sequence of a normal amplified product is shown as SEQ ID NO.1, and the nucleotide sequence of the amplified product after 21 bases are deleted is shown as SEQ ID NO. 2.
TABLE 4 InDel marker in F closely linked or co-separated with cotton leaf split trait 2 Genotyping results in offspring
3. Conclusion(s)
Statistical results show that when the genotype of the InDel molecular marker locus is T, all cotton to be detected is in a leaf-free split leaf shape, and when the genotype of the InDel molecular marker locus is T TCA GTC CAG TAA CAC GCC CTT, all cotton to be detected is in a leaf-split leaf shape.
The result shows that the InDel marker locus is closely linked or co-separated with the cotton leaf split trait, can be used for molecular identification of the cotton leaf split trait, and the cotton leaf split trait related to the application can improve the problems of cotton crown shading, low group light energy utilization rate and the like to a certain extent by taking the leaf as a main place of photosynthesis, and has important significance for breeding high-light-efficiency cotton varieties.
The foregoing examples illustrate only a few embodiments of the application and are described in detail herein without thereby limiting the scope of the application. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application.
Claims (7)
1. A molecular marker for identifying cotton leaf splitting characters, which is characterized in that the molecular marker is 1 InDel molecular marker, the InDel molecular marker is a nucleotide sequence with 6724781 th base of cotton A01 chromosome and upstream and downstream base composition, and the genotype of 6724781 th base of the InDel molecular marker positioned on the cotton A01 chromosome is T or T TCA GTC CAG TAA CAC GCC CTT.
2. The use of the molecular marker for identifying cotton leaf split traits according to claim 1 in cotton leaf shaped molecular marker assisted breeding, wherein the InDel molecular marker is used for detecting cotton leaf split traits.
3. A method for identifying cotton leaf crack traits by using the molecular marker for identifying cotton leaf crack traits according to any one of claims 1-2, which comprises the following specific steps:
step 1: extracting DNA of cotton tissues to be detected;
step 2: designing a specific amplification primer by taking a genome locus of the InDel molecular marker and a sequence consisting of upstream and downstream bases of the genome locus as a target sequence, and carrying out PCR (polymerase chain reaction) amplification by taking the DNA as a template and utilizing the specific amplification primer to obtain a PCR amplification product;
step 3: carrying out genotyping detection and sequencing on the amplified product to obtain the genotype of the cotton to be detected at the InDel locus to be detected;
step 4: judging the leaf shape character of the cotton according to the genotype of the molecular marker amplification product.
4. The method of claim 3, wherein in step 2, the specific amplification primer sequences are:
upstream primer sequence: 5 'TAGGGGTGTAGGAGGATTTATTCTTTG3';
downstream primer sequence: 5'GTGATGATGGATGTTTTCTGGGATTTGATG3'.
5. A method of identifying a leaf slit trait of cotton as claimed in claim 3 wherein in step 4 the genotype is T, the cotton to be identified is leaf-free slit leaf, the genotype is T TCA GTC CAG TAA CAC GCC CTT, and the cotton to be identified is leaf-slit leaf.
6. A method of identifying cotton leaf crack traits as claimed in claim 3 wherein in step 1, the cotton tissue is selected from individual tissues of individual developmental stages of cotton.
7. The method of claim 3, wherein in step 2, the PCR amplification system is: 2 μl of DNA with a concentration of 80-200 ng/. Mu.L, 1 μl of each of forward and reverse primers of the specific amplification primer, 2 μl of 10 XPCR Buffer, 1.6 μl of 2.5mM dNTP, taqDNA Polymerase 0.2.2 μl, 12.2 μl of ddH2O, and 20 μl of the total reaction system; the PCR amplification procedure was: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s; annealing at 61 ℃ for 30s; extending at 72 ℃ for 30s;35 cycles; final extension at 72℃for 10min; the amplified product was stored at 4 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310746900.XA CN116656864A (en) | 2023-06-19 | 2023-06-19 | Molecular marker for identifying cotton leaf cracking character, method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310746900.XA CN116656864A (en) | 2023-06-19 | 2023-06-19 | Molecular marker for identifying cotton leaf cracking character, method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116656864A true CN116656864A (en) | 2023-08-29 |
Family
ID=87718988
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310746900.XA Pending CN116656864A (en) | 2023-06-19 | 2023-06-19 | Molecular marker for identifying cotton leaf cracking character, method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116656864A (en) |
-
2023
- 2023-06-19 CN CN202310746900.XA patent/CN116656864A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108779459B (en) | Cotton whole genome SNP chip and application thereof | |
| CN111719010A (en) | High-throughput SNP diagnostic marker of wheat powdery mildew resistance gene Pm21 and application thereof in breeding | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| CN113249509B (en) | Identification primer and identification method for interspecific hybrid progeny of populus jaborandi and populus microphylla | |
| CN110551843B (en) | Codominant marking primer capable of distinguishing tobacco spot wilt-resistant locus RTSW homozygous heterozygous genotype, distinguishing method and application thereof | |
| CN110283929B (en) | SNP (single nucleotide polymorphism) marker 5-160 related to pepper phytophthora blight resistance gene as well as specific primer and application thereof | |
| CN109439788B (en) | KASP molecular marker closely linked with major gene locus of wheat plant height and application thereof | |
| CN116515858A (en) | Peanut early leaf spot resistance major gene AhESR 1 and application of molecular marker thereof | |
| CN114480709B (en) | Molecular marker for detecting wheat leaf rust resistance gene Lr47, detection method and application thereof | |
| CN116656864A (en) | Molecular marker for identifying cotton leaf cracking character, method and application | |
| CN111607659B (en) | SNP molecular marker associated with hemicellulose content of ramie and application thereof | |
| CN114606335A (en) | Development and application of KASP molecular marker of sugarcane mosaic virus disease resistance gene of corn | |
| CN113897457A (en) | KASP molecular marker linked with wheat stripe rust resistant QTL and application thereof | |
| CN110358855B (en) | SNP (Single nucleotide polymorphism) marker 5-156 of pepper phytophthora disease resistance gene as well as specific primer and application thereof | |
| CN107858448B (en) | Single nucleotide polymorphism marker site, primer pair, kit and application for identifying peach pollen fertility character | |
| CN107345251B (en) | Primer combination and kit for identifying flue-cured tobacco Longjiang 911, application and identification method | |
| CN107893125B (en) | Single nucleotide polymorphism marker locus, primer pair, kit and application for identifying peach blossom bell/rose type trait | |
| CN107354204B (en) | Primer combination and kit for identifying flue-cured tobacco Longjiang 981, application and identification method | |
| CN112342309B (en) | SNP molecular marker related to cotton flower basal leaf spot character and application thereof | |
| CN113005215B (en) | Haplotype molecular marker related to poplar wood yield and application thereof | |
| CN116590453B (en) | SNP molecular marker related to dwarf trait of lotus plant and application thereof | |
| CN113817862B (en) | KASP-Flw-sau6198 molecular marker linked with wheat flag leaf width major QTL and application thereof | |
| CN110484651B (en) | Molecular marker in wheat yield related gene TaNRT2-6D and application thereof | |
| CN116732230B (en) | Rice nitrogen efficient InDel molecular marker GRF4M1 and application thereof | |
| CN114381544B (en) | Watermelon leaf yellowing lethal major gene, dCAPS molecular marker for identifying major gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |