CN116656738A - SINV vector for expressing GM-CSF and IL-12 and application thereof in preparation of antitumor drugs - Google Patents

Abstract

The invention discloses an SINV vector for expressing GM-CSF and IL-12 and application thereof in preparing antitumor drugs, wherein the SINV vector takes pSINV as a framework vector, and the framework vector is connected with GM-CSF and IL-12. The invention provides a sindbis virus infectious vector for stably expressing GM-CSF and IL-12 genes, and sindbis virus particles prepared by the sindbis virus infectious vector can increase the number of T cells, CD8+ T cells and NK cells in solid tumor cells of a U87-MG cell immunodeficiency mouse model, can play an obvious role in killing tumors on the solid tumor of the U87-MG cell immunodeficiency mouse model, and has important practical significance and wide application value for application research and basic research such as oncolytic treatment of malignant glioma.

Description

SINV vector for expressing GM-CSF and IL-12 and application thereof in preparation of antitumor drugs

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a SINV vector for expressing GM-CSF and IL-12 and application thereof in preparation of antitumor drugs.

Background

Gliomas refer to tumors originating from glial cells, are the most common primary intracranial tumors, and the current treatment means mainly depend on surgery and postoperative auxiliary radiotherapy and chemotherapy, but most patients are insensitive to traditional treatment and have poor prognosis. The immune and targeted therapy as a novel therapeutic means can be beneficial to delay tumor recurrence and improve the therapeutic effect of the tumor. Over the past two years there has been a new substantial advance in the art of Gliobalam (GBM) therapy for phase ii/iii targeted therapies, immunotherapies and related combination therapies.

SINV is a blood-borne virus transmitted by mosquitoes and belongs to the genus alphavirus of the family togaviridae. Sindbis viral vectors for gene expression have been well studied in vitro, but have not been widely used in vivo gene therapy, except for some reports on Sindbis virus-mediated gene transfer to the central nervous system in vivo and antigen presenting cells for vaccination against various pathogens and cancer immunotherapy. SINV is also well known for its ability to induce apoptosis in infected mammalian cells, and these characteristics make SINV a great potential as an oncolytic virus.

Granulocyte-macrophage colony-stimulating factor (GM-CSF), also known as colony-stimulating factor 2 (CSF 2), is a monomeric glycoprotein secreted by macrophages, T cells, mast cells, natural killer cells, endothelial cells and fibroblasts, the function of which is a cytokine. The GM-CSF gene therapy has remarkable anti-tumor and immunoregulatory effects in lung cancer, renal cell carcinoma, bladder cancer, melanoma and hematological malignancy.

Interleukin 12 (IL-12) is a multi-biologically active cytokine, and its important role in anti-tumor immunity is to establish a link between natural resistance mediated by macrophages, NK cells, and acquired immunity mediated by Th1 cells, CTL cells. IL-12 regulates the immune response of tumor patients as a new, promising strategy for tumor therapy.

Oncolytic Virus (OV) therapy is a treatment that uses viruses that can replicate themselves to kill cancer cells. Viruses are of a wide variety, but not all viruses can be designed as oncolytic viruses, and typical characteristics of OVs must include the ability to be non-pathogenic, target and kill cancer cells, and the ability to be transformed by genetic engineering methods to express tumor killing factors. OV has become a promising treatment for cancer in the new era, and it is reasonable to believe that oncolytic virus therapy may be one of the primary therapies for treating cancer.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a SINV infectious vector for stably expressing GM-CSF and IL-12, a virus particle and application thereof, and the influence of the virus particle on tumor microenvironment and the effect in a malignant glioma U87-MG mouse subcutaneous tumor model are evaluated. The invention successfully prepares sindbis virus particles capable of stably expressing GM-CSF and IL-12 by using sindbis virus infectious vector transfected cells, and is successfully applied to oncolytic treatment of a glioblastoma U87-MG mouse model.

The invention provides an SINV infectious vector for stably expressing GM-CSF and IL-12, wherein the SINV infectious vector takes pSINV as a framework vector, and the framework vector is connected with GM-CSF and IL-12; the SINV infectious vector is connected with a UBC promoter, a 5'UTR, a nucleotide sequence of an NSP1 gene, a nucleotide sequence of an NSP2 gene, a nucleotide sequence of an NSP3 gene, a nucleotide sequence of an NSP4 gene, a 26s promoter, a nucleotide sequence of a GM-CSF gene, a 26s promoter, a nucleotide sequence of a CAP gene, a nucleotide sequence of an E3 gene, a nucleotide sequence of an E2 gene, a nucleotide sequence of a 6K gene, a nucleotide sequence of an E1 gene, a 26s promoter, a nucleotide sequence of an IL-12 gene and a 3' UTR.

Further, the nucleotide sequence of the SINV infectious vector is shown as SEQ ID NO. 16.

The total length of the sequence SEQ ID NO.16 is 17142bp, and the bases at the 15941-17142 positions are as follows:

cgcgagctcgcgccgggttttggcgcctcccgcgggcgcccccctcctcacggcgagcgctgccacgtcagacgaagggcgcagcgagcgtcctgatccttccgcccggacgctcaggacagcggcccgctgctcataagactcggccttagaaccccagtatcagcagaaggacattttaggacgggacttgggtgactctagggcactggttttctttccagagagcggaacaggcgaggaaaagtagtcccttctcggcgattctgcggagggatctccgtggggcggtgaacgccgatgattatataaggacgcgccgggtgtggcacagctagttccgtcgcagccgggatttgggtcgcggttcttgtttgtggatcgctgtgatcgtcacttggtgagtagcgggctgctgggctggccggggctttcgtggccgccgggccgctcggtgggacggaagcgtgtggagagaccgccaagggctgtagtctgggtccgcgagcaaggttgccctgaactgggggttggggggagcgcagcaaaatggcggctgttcccgagtcttgaatggaagacgcttgtgaggcgggctgtgaggtcgttgaaacaaggtggggggcatggtgggcggcaagaacccaaggtcttgaggccttcgctaatgcgggaaagctcttattcgggtgagatgggctggggcaccatctggggaccctgacgtgaagtttgtcactgactggagaactcggtttgtcgtctgttgcgggggcggcagttatggcggtgccgttgggcagtgcacccgtacctttgggagcgcgcgccctcgtcgtgtcgtgacgtcacccgttctgttggcttataatgcagggtggggccacctgccggtaggtgtgcggtaggcttttctccgtcgcaggacgcagggttcgggcctagggtaggctctcctgaatcgacaggcgccggacctctggtgaggggagggataagtgaggcgtcagtttctttggtcggttttatgtacctatcttcttaagtagctgaagctccggttttgaactatgcgctcggggttggcgagtgtgttttgtgaagttttttaggcaccttttgaaatgtaatcatttgggtcaatatgtaattttcagtgttagactagtaaattgtccgctaaattctggccgtttttggcttttttgttagacttaattaa。

the invention also provides a preparation method of sindbis virus particles carrying GM-CSF and IL-12, and cells are transfected by using the SINV infectious vector.

Further, the cell is a BHK cell.

The invention also provides sindbis virus particles carrying GM-CSF and IL-12, which are prepared by transfecting cells with the SINV infectious vector.

The invention also provides application of the sindbis virus particle carrying GM-CSF and IL-12 in preparing a medicine for improving tumor microenvironment.

The invention also provides application of the sindbis virus particle carrying GM-CSF and IL-12 in preparing medicines for treating glioblastoma.

Compared with the prior art, the invention achieves the following technical effects:

(1) The invention provides a sindbis virus infectious vector for stably expressing GM-CSF and IL-12 genes, which does not need the steps of in vitro transcription and RNA transfection, and can directly transfect cells by the sindbis virus infectious vector, thereby saving time and operation steps. The SINV infectious vector can stably express the inserted exogenous gene, and is beneficial to developing the research related to the sindbis virus infectious vector serving as a novel oncolytic virus.

(2) The invention has important value for researching the application prospect of sindbis virus as a novel oncolytic virus, and has important practical significance and wide application value for application research such as oncolytic treatment of malignant glioma and basic research (such as killing mechanism of virus in tumor cells, change of immune cells in tumor and the like).

(3) The Sindbis virus particle prepared by the invention can increase the number of T cells, CD8+ T cells and NK cells in solid tumor cells of a U87-MG cell immunodeficiency mouse model within 5 days.

(4) The Sindbis virus particle prepared by the invention can play an obvious role in killing tumors on solid tumors of a U87-MG cell immunodeficiency mouse model within 7 days.

(5) Oncolytic virus therapy utilizes genetic engineering means to modify oncolytic viruses so as to ensure that the oncolytic viruses retain the replication capacity of the viruses, and the oncolytic viruses are delivered to tumor cells in a targeted manner to kill the tumor cells, thereby achieving the aim of treatment. The SINV virus particles of the invention can replicate in malignant glioma U87-MG cells, selectively infect tumor cells, and realize the killing effect on tumors in an immunodeficiency mouse model.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a schematic diagram (A) of construction of the sindbis virus infectious vector expressing GM-CSF and IL-12, and a schematic diagram (B) of the structure of pSINV GM-CSF/IL-12 in example 1 of the present invention, wherein NSP 1-4, CAP, E3, E2, 6K and E1 are sindbis virus proteins.

FIG. 2 shows a one-step growth curve (A) of the Sindbis virus infectious vector carrying GM-CSF gene and IL-12 gene of example 2 of the present invention after infection of BHK cells with 0.01MOI, and the expression of GM-CSF and IL-12 proteins at cellular levels at different time points after infection of BHK cells with virus with 0.01MOI (B).

FIG. 3 shows the effect of sindbis virus particles carrying GM-CSF gene and IL-12 gene on cell viability after infection of BHK cells (A) and U87-MG cells (B) with different MOIs according to example 3 of the invention.

FIG. 4 shows the oncolytic treatment of solid tumors of the immunodeficiency mouse model of example 4 carrying GM-CSF gene and IL-12 gene of the invention, using Sindbis virus particles subcutaneously planted in U87-MG cells; wherein A is an immunodeficiency mouse model subcutaneously planted by U87-MG cells and the administration flow, and B is the tumor volume change condition of the mice in the experimental group and the control group within 14 days after the beginning of the administration.

FIG. 5 shows the numbers of intratumoral T cells (A), CD8+ T cells (B) and NK cells (C) in the experimental group (SINV GM-CSF/IL-12) and the control group (PBS) after 4 days of application of the Sindbis virus particles carrying GM-CSF gene and IL-12 gene of example 5 to solid tumors of an immunodeficiency mouse model subcutaneously planted in U87-MG cells.

Detailed Description

In order that those skilled in the art will better understand the present invention, a technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in which it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, shall fall within the scope of the invention.

The technical scheme of the invention is conventional in the art unless specifically stated otherwise.

The cells used in the examples were purchased from American Type Culture Collection (ATCC) and the mice used were purchased from Hunan Stokes Lemonda laboratory animals Co., ltd.

Example 1

The SINV infectious vector for stably expressing GM-CSF and IL-12 is prepared by the following steps:

pSINV GM-CSF/IL-12 initiates transcription and translation of viral structural proteins and nonstructural proteins by the UBC promoter. The primers shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 are used for respectively amplifying the fragments shown in IL-12 gene and SEQ ID NO.5, and then fused into the fragment shown in SEQ ID NO. 6;

the PCR reaction system was 50. Mu.l: 5 x ReactionBuffer:10 μl,10mM dNTPs:1 μl,10 μM Forward Primer:2.5 μl,10 μM Reverse Primer:2.5 μl, template DNA:0.5 μl, DNAPolymerase:0.5 μl, nuclear-Free Water:33 μl; the amplification conditions were: 98 ℃ 60s,98 ℃ 10s,55 ℃ 15s,72 ℃ 90s,72 ℃ 10min,16 ℃ 10min,30 cycles;

the recombinant product was transformed into competent HB101 using ApaI and NotI restriction enzymes (plasmid pSINV-EGFP has been disclosed in China patent application "CN202111117573.9 Sindbis virus vector and its viral particles and application in nerve Loop"), and then the correct clone was named pSINV IL-12 by sequencing by inserting the fragment shown in SEQ ID No.6 into pSINV-EGFP using Vazyme homologous recombination kit, culturing the clone identified as positive by PCR and extracting the plasmid.

The primers shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 and SEQ ID NO.13 are used for amplifying fragments shown in SEQ ID NO.9 and GM-CSF gene and SEQ ID NO.14 respectively, and then fused into a fragment shown in SEQ ID NO. 15;

the PCR reaction system was 50. Mu.l: 5 x ReactionBuffer:10 μl,10mM dNTPs:1 μl,10 μM Forward Primer:2.5 μl,10 μM Reverse Primer:2.5 μl, template DNA:0.5 μl, DNAPolymerase:0.5 μl, nuclear-Free Water:33 μl; the amplification conditions were: 98 ℃ 60s,98 ℃ 10s,55 ℃ 15s,72 ℃ 60s,72 ℃ 10min,16 ℃ 10min,30 cycles;

pSINV IL-12 was digested with SapI and Pm1I, then the fragment shown in SEQ ID NO.15 was inserted into pSINV IL-12 using Vazyme homologous recombination kit, the recombinant product was transformed into competent HB101, the clone identified as positive by PCR was cultured and the plasmid was extracted for sequencing, and the correctly mutated clone was named pSINV GM-CSF/IL-12 whose nucleotide sequence was shown in SEQ ID NO. 16.

Example 2

One-step growth curve of SINV-infected cells stably expressing GM-CSF and IL-12, and expression of GM-CSF and IL-12 proteins at cellular level of cells infected with Sindbis virus:

after the pSINV GM-CSF/IL-12 plasmid prepared in example 1 was extracted with a plasmid extraction kit, 2. Mu.g of the pSINV GM-CSF/IL-12 plasmid was transfected into BHK cells with 4. Mu.l of lipofectamine 2000 (Thermo Fisher), 37℃at 5% (v/v) CO ₂ The resulting virus was cultured in an incubator to infect BHK cells at a dose of 0.01MOI, and the cell status was observed by an inverted fluorescence microscope at various time points, and the cells appeared to have significant cytopathic effects after 48 hours. After a part of the virus supernatant collected at different time points is split-charged, a part of the virus supernatant collected at different time points is detected by a double-layer plaque method, and a one-step growth curve of infectious clone is drawn, wherein the one-step growth curve of infectious clone is shown as A in figure 2. And subpackaging the virus supernatant collected at the time point of 48 hours of infection, and preserving at-80 ℃ for later use in subsequent experiments. By infection of this example, a preparation of an infectious vector from SINV GM-CSF/IL-12 can be obtainedSindbis virus particles carrying GM-CSF gene and IL-12 gene. The incubation period and the cleavage amount of sindbis virus carrying GM-CSF gene and IL-12 gene and the titer of the virus at different time points can be obtained through a one-step growth curve so as to further understand the growth characteristics of the modified virus.

Cell samples were collected 24 hours, 48 hours and 72 hours after infection of BHK with Sindbis virus particles carrying GM-CSF gene and IL-12 gene at 0.01MOI, and treated with 1xSDS-PAGE buffer of YEASEN. The samples were then denatured by heating them in a metal bath at 95℃for 5 minutes, after which the samples were loaded onto a 10% SDS-PAGE gel for separation, after which the proteins were transferred to PVDF membrane, blocked with 5% skimmed milk for 1 hour at room temperature and incubated overnight in a refrigerator at 4℃with Abcam's Anti-IL-12 Anti-body (cat# ab 9992) and Proteintech's GM-CSF Polyclonal antibody (cat# 17762-1-AP), respectively. The next day the PVDF membrane was washed with 1XTBST buffer, incubated with Proteintech HRP-conjugatedAffinipure GoatAnti-Rabbit IgG secondary antibody for 2 hours at room temperature, and after washing the PVDF membrane again with 1XTBST buffer, imaging of protein bands was performed, the results are shown in FIG. 2B. The presence of protein bands suggests that sindbis virus vectors carrying the GM-CSF gene and the IL-12 gene are capable of successfully expressing GM-CSF protein and IL-12 protein in cells.

Example 3

Infection of BHK and U87-MG cells with Sindbis virus particles carrying GM-CSF gene and IL-12 Gene of the present invention, and Effect on BHK and U87-MG cell viability:

fresh BHK and U87-MG cells were infected with the virus supernatant stored for later use in example 2 at 1MOI, 0.1MOI and 0.01MOI, respectively, after 24 hours, the supernatant was discarded, and dead living cells were identified with the Calcein/PI cell viability assay kit of Beyotime, wherein the living cells were stained with Calcein and displayed green fluorescence, and the red fluorescent label was PI-stained dead cells. Viable cells were counted in each well and cell viability was calculated for different MOI infections, the results are shown in figure 3. The viability is an important indicator reflecting the state of the cells, and the results of the cell viability test further demonstrate that sindbis virus particles carrying the GM-CSF gene and IL-12 gene are more sensitive to U87-MG cells and cause more cell killing.

Example 4

The sindbis virus particle carrying the GM-CSF gene and the IL-12 gene is applied to the oncolytic treatment condition of the immunodeficiency mouse model solid tumor which is subcutaneously planted by U87-MG cells:

after resuspension of U87-MG cells with PBS, 100. Mu.l of the cells were taken containing 5X 10 ⁶ Cell suspensions of individual U87-MG cells were prepared by subcutaneous injection Nu at 10 weeks of age 3-4 Nu female nude mice. On day 7 after tumor implantation, 10 mice were randomly divided into two groups, one group as the experimental group, and 100 microliters of 1x 10-containing mice were injected on day 7, day 9, and day 11 after tumor implantation, respectively ⁶ SINV GM-CSF/IL-12 virus supernatant from each viral particle (collected during the transfection experiment of example 2) was injected as a control group with 100 microliters of PBS on days 7, 9, and 11, respectively, after tumor implantation, and the experimental procedure is shown as A in FIG. 4.

Tumor volume of model mice was calculated by measuring the length and width of tumor of mice daily before and after administration, tumor volume=1/2×length (mm) ×width (mm). The results of the change of the tumor volumes of the mice in the experimental group and the control group after the administration (average tumor volume of 5 mice in each group) are shown as B in fig. 4, and the tumor-bearing volume of the mice in the control group is obviously larger than that of the mice in the experimental group after 14 days of the administration, which shows that the Sindbis virus particles carrying the GM-CSF gene and the IL-12 gene have obvious tumor killing effect when applied to the solid tumors of the immunodeficiency mouse model which are subcutaneously planted in U87-MG cells.

Example 5

The Sindbis virus particle carrying the GM-CSF gene and the IL-12 gene is applied to the cases of the number of T cells, CD8+T cells and NK cells in an immunodeficiency mouse model solid tumor which is subcutaneously planted by U87-MG cells:

after resuspension of U87-MG cells with PBS, 100. Mu.l of the cells were taken containing 5X 10 ⁶ Cell suspensions of individual U87-MG cells were subcutaneously injected into 6 Nu/Nu females 3-4 weeks oldIn sex nude mice. On day 7 after tumor implantation, 6 mice were randomly divided into two groups, one group was injected as an experimental group with 100 microliters of 1x10 ⁶ SINV GM-CSF/IL-12 virus supernatant from each viral particle (collected during the transfection experiment of example 2) was used as a control to inject 100 microliters of PBS.

After 4 days of virus supernatant injection, tumor tissues of 6 mice in total of the control group and the experimental group were taken in 100 mm dishes, respectively. The tumor tissue of each mouse was treated with the following: tumor tissue was first minced with scissors after rinsing with 1x HBSS from Gibco and transferred to a 15 ml centrifuge tube, 5 ml of enzyme cocktail (1 g collagenase IV, 100 mg hyaluronidase and 20,000 units dnase in 100 ml HBSS solution, filtered through a 0.22um filter, sub-packaged and stored at-20 ℃) was added to the centrifuge tube and digested overnight at room temperature. Digestion was then stopped by adding Gibco RPMI 1640 medium containing serum and centrifuging for 5 min at 300g, then washing the pellet with PBS to remove the medium, re-suspending the pellet in 100. Mu.l PBS after two repeated washes with PBS to make a cell suspension, adding FITC-anti-mouse CD4, APC anti-mouse CD3, PE anti-mouse CD49b, APC/Cyanine7 anti-mouse CD8a antibodies purchased from Biolegend, incubating for 20 min on ice in the absence of light, and then analyzing with a flow cytometer, the results obtained were analyzed using Flowjo software, as shown in FIG. 5. As can be seen from FIG. 5, the numbers of T cells, CD8+ T cells and NK cells in the tumor of the mice treated with SINV GM-CSF/IL-12 are far greater than those of the control group, which indicates that sindbis virus particles carrying GM-CSF gene and IL-12 gene increase the number of immune cells in the tumor, and lay a foundation for further and efficient killing of solid tumors.

By combining the above examples, the invention provides a Sindbis virus infectious vector for stably expressing GM-CSF and IL-12, and the infectious vector has obvious tumor killing effect when applied to glioma cells and malignant glioma subcutaneous models; the method has wide application value in the aspects of establishment of a drug screening platform, establishment of an animal model, analysis of action mechanisms of drug killing glioma cells, analysis of mechanisms of viruses for stimulating immune responses in solid tumors, and the like.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Claims (7)

1. An SINV infectious vector for stably expressing GM-CSF and IL-12, which is characterized in that the SINV infectious vector takes pSINV as a framework vector, and the framework vector is connected with GM-CSF and IL-12;

the SINV infectious vector is connected with a UBC promoter, a 5'UTR, a nucleotide sequence of an NSP1 gene, a nucleotide sequence of an NSP2 gene, a nucleotide sequence of an NSP3 gene, a nucleotide sequence of an NSP4 gene, a 26s promoter, a nucleotide sequence of a GM-CSF gene, a 26s promoter, a nucleotide sequence of a CAP gene, a nucleotide sequence of an E3 gene, a nucleotide sequence of an E2 gene, a nucleotide sequence of a 6K gene, a nucleotide sequence of an E1 gene, a 26s promoter, a nucleotide sequence of an IL-12 gene and a 3' UTR.

2. The SINV infectious vector stably expressing GM-CSF and IL-12 according to claim 1, wherein the nucleotide sequence of said SINV infectious vector is set forth in SEQ ID No. 16.

3. A method for preparing sindbis virus particles carrying GM-CSF and IL-12, characterized in that cells are transfected with the SINV infectious vector of claim 1.

4. The method of producing sindbis virus particles carrying GM-CSF and IL-12 according to claim 3, wherein the cells are BHK cells.

5. Sindbis virus particles carrying GM-CSF and IL-12, prepared by the process of claim 3.

6. Use of sindbis virus particles carrying GM-CSF and IL-12 according to claim 5 for the preparation of a medicament for improving tumor microenvironment.

7. Use of sindbis virus particles carrying GM-CSF and IL-12 according to claim 5 for the preparation of a medicament for the treatment of glioblastoma.