CN116650670A - Application of RND3 gene overexpression reagent in preparation of medicines for treating myocardial aging - Google Patents

Application of RND3 gene overexpression reagent in preparation of medicines for treating myocardial aging Download PDF

Info

Publication number
CN116650670A
CN116650670A CN202310580007.4A CN202310580007A CN116650670A CN 116650670 A CN116650670 A CN 116650670A CN 202310580007 A CN202310580007 A CN 202310580007A CN 116650670 A CN116650670 A CN 116650670A
Authority
CN
China
Prior art keywords
rnd3
mir
gene
expression
aav9
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310580007.4A
Other languages
Chinese (zh)
Inventor
揭伟
郭峻莉
吴林栩
申志华
罗才
施凯佳
朱星霖
凌学斌
赵阳阳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hainan Medical College
Guangdong Medical University
Original Assignee
Hainan Medical College
Guangdong Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hainan Medical College, Guangdong Medical University filed Critical Hainan Medical College
Priority to CN202310580007.4A priority Critical patent/CN116650670A/en
Publication of CN116650670A publication Critical patent/CN116650670A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14123—Virus like particles [VLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention provides an application of an RND3 gene overexpression reagent in preparation of a medicament for treating myocardial aging, and belongs to the technical field of disease treatment. The invention provides an application of an RND3 gene overexpression reagent in preparation of a medicament for treating myocardial aging. The invention discovers that the RND3 level in human peripheral blood cells is inversely related to age for the first time; RND3 expression was decreased in heart tissue of diabetic animal model and in cardiomyocytes cultured with high sugar in vitro, with a distinct senescent phenotype of cardiomyocytes; the specific over-expression of RND3 can effectively treat myocardial aging, especially diabetic cardiomyopathy, and the heart-specific over-expression of RND3 can reverse diabetes-induced myocardial cell aging and restore heart function.

Description

Application of RND3 gene overexpression reagent in preparation of medicines for treating myocardial aging
Technical Field
The invention belongs to the technical field of disease treatment, and particularly relates to application of an RND3 gene overexpression reagent in preparation of a medicament for treating myocardial aging.
Background
Cardiomyocyte Aging/Aging (Aging/senescence) refers to degenerative changes in cardiomyocyte structure and function that occur with age, ultimately affecting cardiac function. Physiological aging is a direct cause of myocardial aging, but other pathological conditions such as diabetes can accelerate aging caused by aging, exhibiting synergistic and additive effects.
In cases of persistent control of blood glucose, the prevalence, disability and mortality of diabetic cardiovascular complications are correspondingly increased. Therefore, the research on how to effectively control blood sugar to treat the diabetic cardiomyopathy is focused on at present, and more patent applications for treating the diabetic cardiomyopathy based on traditional Chinese medicine components exist in China. Since the mechanism of aging of diabetic cardiomyocytes is not clear, there is no effective therapeutic means.
RND3 is an atypical member of the Rho GTPase superfamily, whose activity is primarily dependent on the level of expression and regulation of protein modification, unlike the regulatory mechanisms by which the GTP-binding and GDP-binding states of classical Rho1, rho2, etc. interconvert. The study demonstrates that RND3 is an endogenous inhibitor of Rho-associated coiled coil forming protein kinase (ROCK 1), playing an important role in cytoskeletal and polarity maintenance, cell proliferation, cell migration, cell cycle, apoptosis, and cell differentiation processes. The relationship between RND3 gene and myocardial cell aging has not been reported.
Disclosure of Invention
In view of the shortcomings in the prior art, it is an object of the present invention to provide the use of promoting the expression of RND3 in the preparation of a formulation for reversing cardiomyocyte senescence.
The invention aims at realizing the following technical scheme:
the invention provides application of an RND3 gene overexpression reagent in preparation of a medicament for treating myocardial aging.
Preferably, the myocardial aging comprises physiologically advanced myocardial aging and/or diabetic cardiomyopathy.
Preferably, the diabetic cardiomyopathy comprises type one diabetic cardiomyopathy and/or type two diabetic cardiomyopathy.
Preferably, the nucleotide sequence of the RND3 gene is shown in SEQ ID NO. 1.
Preferably, the overexpression agent comprises a viral vector that overexpresses the RND3 gene and/or a miR103a-3p inhibitor.
Preferably, the miR-103a-3p inhibitor comprises an antisense oligonucleotide of miR-103a-3p and/or miR-103a-3p sponge.
Preferably, the miR-103a-3p inhibitor comprises a viral vector that inhibits expression of miR-103a-3 p.
The invention provides an AAV9 virus particle over-expressing RND3 gene, and the preparation method of the AAV9 virus particle over-expressing RND3 gene comprises the following steps:
cloning RND3 gene into AAV9 virus vector to obtain RND3 gene expression vector;
AAV9 virus particles expressing RND3 gene were packaged by cotransfecting AAV9-293 cells with RND3 gene expression vector, pAAV-RC plasmid and pHelper plasmid.
The invention provides an AAV9 virus particle for inhibiting miR-103a-3p expression, which comprises the following steps:
cloning miR-103a-3p sponge into an AAV9 virus vector to obtain an miR-103a-3p sponge expression vector; the nucleotide sequence of the miR-103a-3p sponge is shown in SEQ ID NO. 4;
and co-transfecting the miR-103a-3p sponge expression vector, the pAAV-RC plasmid and the pHelper plasmid into AAV9-293 cells, and packaging AAV9 virus particles for expressing the miR-103a-3p sponge.
The invention also provides application of the RND3 gene overexpression reagent in preparing a medicament for treating diabetes; the RND3 gene overexpression reagent comprises an AAV9 virus vector and/or miR103a-3p inhibitor for overexpression of the RND3 gene.
The beneficial effects of the invention are that
The invention provides an application of an RND3 gene overexpression reagent in preparation of a medicament for treating myocardial aging. The invention discovers that the RND3 level in human peripheral blood cells is inversely related to age for the first time; RND3 expression was decreased in heart tissue and in vitro high-sugar cultured cardiomyocytes in animal models of diabetes, with a pronounced senescent phenotype of the cardiomyocytes. The specific over-expression of RND3 can effectively treat myocardial aging, especially diabetic cardiomyopathy, and the heart-specific over-expression of RND3 can reverse diabetes-induced myocardial cell aging and restore heart function.
Furthermore, the high sugar stimulation can inhibit the expression of RND3 by up-regulating miR-103a-3p in a targeted manner, and the in vitro administration of a miR-103a-3p inhibitor or a heart-targeted over-expressed miR-103a-3p sponge not only can obviously raise the expression of RND3 in myocardial cells, but also can effectively reverse the aging phenotype of the cells and can restore the heart function.
The results of the examples show that: cardiac targeted overexpression of RND3 can prevent impaired cardiac function caused by diabetes. Down-regulating expression of secretion phenotype protein related to aging, reversing aging phenotype of cells, and recovering heart function, thereby achieving the effect of treating diabetic cardiomyopathy. miR-103a-3p antisense oligonucleotide restores the expression of the RND3 gene by inhibiting the combination of miR-103a-3p and the 3' UTR of the RND3 gene, and reduces myocardial cell aging and DNA damage caused by high sugar stimulation. AAV9 virus particles carrying miR-103a-3p sponge play a role in treating diabetic cardiomyopathy by inhibiting miR-103a-3p and then restoring RND3 expression.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.
FIG. 1 is a graph showing the correlation of RND3 mRNA expression in human peripheral blood mononuclear cells with age and partial clinical indicators;
FIG. 2 is a graph showing the expression of cardiac function, RND3 and senescence-associated factors in young and old mice;
FIG. 3 is a graph showing the effect of high sugar stimulation on RND3 expression and cardiomyocyte senescence;
FIG. 4 is a schematic representation of the prevention of replication of the diabetic rat heart injury model by overexpression of RND 3;
FIG. 5 is a graph showing the effect of cardiac over-expression RND3 on cardiac function and senescence-associated secretory phenotype gene expression in a diabetic rat;
FIG. 6 is a graph showing the upregulation of miR-103a-3p function and binding to the 3' UTR of the RND3 gene by high sugar stimulation;
FIG. 7 is a diagram showing the construction of a vector for over-expressing GV272 of a promoter;
FIG. 8 is a structural diagram of a miR-103a-3p precursor miR-103a-1 over-expression GV268 vector;
FIG. 9 is a graph showing the effect of miR-103a-3p inhibitors on the expression of RND3 and senescence-associated secretory phenotype genes in high sugar stimulated H9C2 cells;
FIG. 10 is a graph of the effect of miR-103a-3p inhibitors on cell senescence in high-sugar stimulated H9C2 cells;
FIG. 11 is a diagram showing the structure of AAV9 viral vector GV 387;
FIG. 12 is a phenotype diagram associated with heart-targeted AAV9 of miR103 a-3p_front to restore heart function and slow aging in diabetic rats;
FIG. 13 is a graph showing the relationship between blood glucose and blood lipid and the expression of serum miR-103a-3p of a diabetic patient group.
Detailed Description
The invention provides an application of an RND3 gene overexpression reagent in preparation of a medicament for treating myocardial aging.
In the present invention, the myocardial aging preferably includes physiological myocardial aging and/or diabetic cardiomyopathy. In the present invention, the diabetic cardiomyopathy preferably comprises type one diabetic cardiomyopathy and/or type two diabetic cardiomyopathy. In the invention, the length of the RND3 gene sequence of the rat is 2002bp, and the nucleotide sequence of the RND3 gene is shown as SEQ ID NO. 1.
The nucleotide sequence of SEQ ID NO.1 is as follows:
GGCAGAAAACTTGTTGGAGAGGAGTAAAGAGCCGCTGCCTCTCCTCCTCCAACTCCGCTGCGCTTAAGGGGTTCCCTCCGGCCTTGCGATTTATTTTTATATCCGCTTTTTATAGAGAGAAGTATATATATTTTTTTCTTCTAAAGAGAAAAATTCCTGTTCCAAGAGAAAATAAGGCAACATCAATGAAGGAGAGAAGAGCCAGCCAGAAATTATCCAG TAAATCTATCATGGATCCTAATCAGAACGTGAAATGCAAGATAGTAGTGGTGGGCGACAGCCAGTGTGGGAAAACC GCGCTGCTCCACGTCTTCGCAAAGGACTGCTTCCCCGAAAATTACGTCCCTACGGTGTTTGAGAATTACACTGCCA GTTTTGAAATCGACACACAAAGAATAGAGTTGAGCCTGTGGGACACTTCAGGTTCCCCTTACTATGACAACGTCCG TCCCCTCTCTTACCCAGATTCTGATGCTGTGCTCATTTGCTTTGACATCAGTAGACCAGAAACTCTGGACAGTGTC TTAAAGAAGTGGAAAGGTGAAATCCAGGAGTTTTGTCCCAATACCAAGATGCTGTTGGTTGGTTGCAAGTCTGACC TTCGGACAGATGTCAGCACACTAGTGGAACTCTCAAATCACAGGCAGACTCCTGTGTCATATGATCAGGGGGCAAA CATGGCGAAGCAGATCGGAGCAGCCACTTACATAGAATGCTCAGCTTTACAGTCGGAGAACAGCGTCAGAGACATT TTTCACGTCGCCACCTTGGCGTGTGTAAATAAGACAAATAAAAACGTTAAGCGGAACAAATCACAGAGGGCCACAA AGCGGATTTCACACATGCCTAGCAGACCAGAACTCTCAGCAGTTGCTACGGACTTACGAAAGGACAAAGCCAAGAG CTGCACTGTGATGTGAGGCTTCACCGTCTTTAATGAGGACACATGGAAATCTGGTGTAAAAAAAAAATTAAAATAAAATTTGAAACAGCAAGAGCAAACGGAAAGAGGGAGTCAAATGAAGTGCACAGCCAAAGTCACATGGACACAAGGCGTAGGAGTCCCTTGAAAAAAAAAGTGGATACCCACTTTTCGGAATCCTGTCCTTAGTTTCGGCATGTAGACCGAGTGGTGAGAAGCGAATGCGTTGAAGAGTTTTGTGTAACAAGAGGTGTGACTTGAAAAATACACCAAAAACAAAGGGAGCTACAAACGGGCGAGCGCTAGAGAAGTGGGGGGCCCTGGTACCTCCAAGAAGAAAGTCCACGCTTTGAATGGTGCTTGAGTATTTTTGGTTTTGTGTTTGTGGTTTTATTACAACCTATTCGTGGATCTCTACTTTGATTTAGTTTTTCAATGTTTTAATCCCTTTTTCCAAAAAAGTATATATTAGTAGACCGTCCTCGTTGGGAACTCGCACTGTGACCTTAGCGTTTAGTTTTCTAGAGGATGTGATCTAATTTCCTCCTAGCTCGTCATTAAAATGGAAATTGTACTAGGACCCGGTGGGATTCGAGAGGAAAAACTTGCTGCGGCTTTGAAATCTTGACTTCCTGAAGGTCGCCGCTGAGCGAGATGGTTTGAAGCAAGGCTTCCTGGCCTTACAAGATGCGTAGACCAGCACTACAGAGATTGCGTAGATCAACTAGAAGAGAGTGTTGCTTTTTCTTCTGTCTTGATGGTTTTGTTCATCCTCGTGATTGTCCTTAAACAAGTGGTAAATCGTTCCGTGTAATATTTTTTGTGCGCTGTGTAGAAGAGTGTGTGTGTGGCTTCGTTTTGTTTTTCTTTTTTCTTTTTGCCATCGTTGATGAAAACAAGAAGTCAAATAAAAGATGTCTTCGTCTGATTGTGATAGCGTGATTAAAGAGGAGGCAGGTGGGTGCCGATTTCACCAGGAGAGACCTTGAATGAAGGAGTAGTGATAGCAGAGAGCACAGTTGGTGAATGGGGCTGTCTGGAAGGAAGTTATACATCAAATACACAGAGCAAAAGCACTCT。
note that: the CDS region is 186-920 bp, and the underlined part is marked.
In the present invention, the RND3 gene overexpression agent includes a viral vector that overexpresses the RND3 gene, more preferably AAV9 viral particles that overexpress the RND3 gene. The method for preparing the AAV9 virus particles over-expressing the RND3 gene is not particularly limited, and AAV9 virus particles over-expressing the RND3 gene prepared by the conventional method in the art can be used.
The invention discovers that the RND3 level in human peripheral blood cells is inversely related to age for the first time; RND3 expression was decreased in heart tissue and in vitro high-sugar cultured cardiomyocytes in animal models of diabetes, with a pronounced senescent phenotype of the cardiomyocytes. Heart-specific overexpression of RND3 can reverse diabetes-induced cardiomyocyte senescence and restore cardiac function.
In the present invention, the over-expression agent preferably comprises a miR-103a-3p inhibitor.
In the present invention, the miR-103a-3p inhibitor comprises an antisense oligonucleotide of miR-103a-3p and/or miR-103a-3p sponge.
The invention discovers that in vitro high sugar stimulates myocardial cells to generate differential expression miRNA, wherein up-regulated expression miR-103a-3p can directly target 3' UTR combined with RND3 gene to inhibit RND3 expression. The antisense oligonucleotide of miR-103a-3p can restore the RND3 expression reduction caused by the stimulation of myocardial cells by high sugar and the expression of the aging-related phenotype genes. AAV9 expressing miR-103a-3p sponge can target and regulate cardiac RND3 expression of diabetic rats in vivo, and restore cardiac function and reverse cell senescence. Therefore, the miR-103a-3p inhibitor can achieve the effects of reversing myocardial cell senescence and restoring heart function by promoting RND3 expression.
In the invention, the nucleotide sequence of miR-103a-3p is preferably shown as SEQ ID NO. 2.
In the present invention, the nucleotide sequence of SEQ ID NO.2 is as follows:
AGCAGCAUUGUACAGGGCUAUGA。
in the present invention, the miR-103a-3p inhibitor preferably comprises an antisense oligonucleotide of miR-103a-3 p; the nucleotide sequence of the antisense oligonucleotide of miR-103a-3p is preferably shown in SEQ ID NO. 3.
In the present invention, the nucleotide sequence of SEQ ID NO.3 is as follows:
UCAUAGCCCUGUAAAUGCUGCU。
the antisense oligonucleotide of miR-103a-3p can be used as an inhibitor complementary with miR-103a-3p to be competitively combined with a mature miR-103a-3p sequence, so that the gene silencing effect of endogenous miR-103a-3p is weakened, and the expression level of a downstream target gene protein is improved.
In the present invention, the miR-103a-3p inhibitor preferably comprises a viral vector that inhibits miR-103a-3p expression, and more preferably an AAV9 viral particle that inhibits miR-103a-3p expression. The preparation method of the AAV9 virus particles for inhibiting miR-103A-3p expression is not particularly limited, and the AAV9 virus particles prepared by adopting the conventional preparation method in the field can inhibit miR-103A-3p expression. According to the invention, the miR-103a-3p sequence compositions of human, rat and mouse are obtained by inquiring the miR-103a-3p sequence compositions of human, rat and mouse through public databases NCBI, miRDB and miRBase. The invention discovers that in vitro high sugar stimulates myocardial cells to generate differential expression miRNA, wherein up-regulated expression miR-103a-3p can directly target 3' UTR combined with RND3 gene to inhibit RND3 expression.
The invention provides an AAV9 virus particle over-expressing RND3 gene, and the preparation method of the AAV9 virus particle over-expressing RND3 gene comprises the following steps:
Cloning RND3 gene into AAV9 virus vector to obtain RND3 gene expression vector;
the AAV9 virus particles expressing the RND3 gene are packaged by cotransfecting AAV9-293 cells with the RND3 gene expression vector, helper plasmids pAAV-RC and pHelper.
The invention clones RND3 gene into AAV9 virus vector to obtain RND3 gene expression vector.
In the present invention, the AAV9 viral vector is preferably GV387. In the present invention, the GV387 is preferably purchased from Shanghai Ji Kai Gene chemical technology Co., ltd., contract number GMUV0357412. In the present invention, before introducing the RND3 gene into the AAV9 viral vector, the RND3 sequence is preferably prepared from a cDNA library by PCR. When the invention adopts PCR to call the RND3 sequence from the cDNA library, the nucleotide sequence of the primer P1 upstream of the PCR is preferably shown as SEQ ID NO.30 (GGAGGTAGTGGAATGGATCCCGCCACCATGAAGGAGAGAAGAGCCAG), and the nucleotide sequence of the primer P2 downstream of the PCR is preferably shown as SEQ ID NO.31 (TCACCATGGTGGCGGGATCCATCACAGTGCAGCTCTTGGCTTTG). The length of the RND3 sequence which is prepared by the primers P1 and P2 is 778bp. After the PCR product is obtained, the PCR product and the linearized GV387 vector are preferably reacted for 30min at 37 ℃ in an exchange reaction system, so that the target gene (PCR product) is subjected to recombination reaction under the action of recombinase, and is connected into the digested linear GV387 vector to realize in-vitro cyclization of the linearized vector and the target gene fragment, thereby obtaining an exchange reaction product, which can also be called as a recombination product. In the present invention, the GV387 vector is preferably a linearized GV387 vector obtained by digestion treatment with EcoRI and BamHI restriction enzymes.
After the recombination reaction is completed, the exchange reaction product is preferably mixed with competent cells for transformation. In the present invention, the competent cell is preferably Stbl3 TM Competent cells. The method of transformation is not particularly limited, and conventional transformation methods in the art can be employed. After the end of the transformation, the transformation is completed,the invention preferably selects positive transformants for sequencing. The invention obtains the clone bacterial liquid after determining the correct sequence by sequencing. After the clone bacterial liquid is obtained, the invention preferably carries out amplification culture and extraction on the clone bacterial liquid to obtain high-purity plasmid, namely RND3 gene expression vector.
After the RND3 gene expression vector is obtained, AAV9 virus particles expressing the RND3 gene are packaged by cotransfecting AAV9-293 cells with the RND3 gene expression vector, auxiliary plasmids pAAV-RC and pHelper.
The method of transfection is not particularly limited in the present invention, and conventional transfection methods in the art may be employed. In the present invention, AAV9-293 cells are preferably cultured at 37℃for 48 hours to a confluence of 70 to 80% for transfection prior to transfection. In the present invention, the medium for performing cell culture is preferably DMEM medium. After obtaining the RND3 gene expression vector, the present invention preferably dilutes the RND3 gene expression vector to a mass concentration of 1mg/mL and then performs subsequent operations. In the present invention, the diluting solution is preferably a TE buffer; the pH of the TE buffer is preferably 7.5. After obtaining the diluted RND3 gene expression vector, the present invention preferably mixes the RND3 gene expression vector, pAAV-RC plasmid and pHelper plasmid in equal volumes to obtain a mixed plasmid solution. In the present invention, the amount of the RND3 gene expression vector to be added is preferably 10. Mu.g; the addition amount of the pAAV-RC plasmid is preferably 10. Mu.g; the mass amount of the pHelper plasmid is preferably 10. Mu.g. After the mixed plasmid solution is obtained, the present invention preferably combines the mixed plasmid solution with CaCl 2 The aqueous solution is gently mixed to obtain DNA/CaCl 2 And (3) mixing the liquid. In the present invention, the plasmid solution is mixed with CaCl 2 The volume ratio of the aqueous solution is preferably 30. Mu.L: 1mL; the CaCl 2 CaCl in aqueous solution 2 The molar concentration of (C) is preferably 0.3mol/L. Obtaining DNA/CaCl 2 After mixing the solutions, the invention preferably uses DNA/CaCl 2 Mixing the mixed solution with 2 XHBS solution gently to obtain DNA/CaCl 2 HBS solution. In the present invention, the DNA/CaCl 2 The volume ratio of the mixed solution to the HBS solution is preferably 1:1.03. Obtaining DNA/CaCl 2 After the HBS solution, the present invention preferably uses DNA/CaCl immediately 2 HBS solution dropwise additionAnd (3) uniformly mixing the cells in an AAV9-293 cell culture dish to obtain a transfection system. After obtaining the transfection system, the present invention preferably transfects the transfection system by culturing it at 37℃for 6 hours. After transfection, the invention preferably replaces the medium in the cell culture dish with 10mL of fresh medium and continues to culture at 37 ℃ for 72 hours. After the culture is finished, the invention preferably judges the condition of cell toxicity by observing the color of the culture medium and the change of the cell state. In the present invention, when the cells are toxic, the color of the medium changes from red to orange or yellow, and some cells round and fall off the tray and float in the medium. After determining the toxigenic cells, the present invention preferably collects the toxigenic cells and extracts AAV9 virus particles expressing RND3 genes in culture. The method for extracting AAV9 virus particles expressing RND3 gene, i.e., extracting virus particles, is not particularly limited, and conventional methods in the art can be used. In the present invention, the method for extracting virus particles preferably comprises centrifuging the toxigenic culture solution, and collecting the precipitate to obtain toxigenic cells. The rotational speed of the centrifuge according to the invention is preferably 200g; the time of the centrifugation is preferably 3min. After obtaining the toxigenic cells, the invention preferably re-suspends the toxigenic cells to obtain a cell suspension. The agent used to resuspend cells of the invention is preferably PBS. After obtaining the cell suspension, the cell suspension is preferably subjected to four freeze thawing treatments in the present invention. The primary freezing and thawing treatment step of the invention is preferably to use dry ice-ethanol bath for 10min and then to use water bath at 37 ℃ for 10min for thawing. The invention preferably oscillates slightly after each melting. After the four times of freeze thawing treatment, the invention preferably carries out centrifugation to remove cell fragments; the rotational speed of the centrifugation is preferably 10,000g; the time of the centrifugation is preferably 15min. After centrifugation, the supernatant is preferably concentrated, purified and desalted by ultrafiltration to obtain AAV9 virus particles expressing RND3 genes. The invention preferably carries out quantitative PCR detection of virus titer after ultrafiltration desalination. After AAV9 virus particles expressing RND3 gene are obtained, AAV9 virus particles expressing RND3 gene are preferably packaged and stored in the present invention. The temperature of preservation according to the invention is preferably-80 ℃.
The AAV9 virus particles expressing the RND3 gene provided by the invention can express the RND3 gene in rat heart tissues.
The invention provides a miR-103a-3p sponge, wherein the nucleotide sequence composition of the miR-103a-3p sponge is shown in SEQ ID NO. 4.
In the present invention, the nucleotide sequence of SEQ ID NO.4 consists of:
CTCTCGGCATGGACGAGCTGTACAAGGCTAGCTAATCATAGCCCTGGACATGCTGCTCTTCTCATAGCCCTGGACATGCTGCTCTTCTCATAGCCCTGGACATGCTGCTCTTCTCATAGCCCTGGACATGCTGCTCTTCTCATAGCCCTGGACATGCTGCTCTTCTCATAGCCCTGGACATGCTGCTAAGCTTAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCT。
note that: the bold type base is Sponges for miR103-3p, and is a repeated sequence of binding site sequences of miR103-3p and RND3_3' UTR. The underlined sites are cleavage sites.
The miR-103a-3p sponge provided by the invention is also called miR-103a-3 p-sponages; the miR-103a-3p sponge comprises 6 repeated miR-103a-3p binding sites; the miR-103-3p sponge can be specifically combined with miR-103-3p, so that the capability of combining miR-103a-3p with a 3' UTR combining site of an RND3 gene is inhibited, and the aim of regulating endogenous gene expression is fulfilled.
The invention provides an AAV9 virus particle for inhibiting miR-103a-3p expression, and the preparation method of the virus particle comprises the following steps:
cloning miR-103a-3p sponge genes into an AAV9 virus vector to obtain a miR-103a-3p sponge expression vector;
and co-transfecting the miR-103A-3p sponge expression vector, the pAAV-RC plasmid and the pHelper plasmid into AAV9-293 cells, and packaging AAV9 virus particles for expressing the miR-103A-3p sponge.
According to the invention, miR-103a-3p sponge is cloned into an AAV9 virus vector to obtain an miR-103a-3p sponge expression vector.
In the present invention, the AAV9 viral vector is preferably GV387. The miR-103a-3p sponge gene is preferably obtained through an artificial synthesis method. The method for artificially synthesizing the sequence is not particularly limited, and the conventional artificial synthesis method in the field can be adopted. The preparation method of the miR-103a-3p sponge expression vector is the same as that of the RND3 gene expression vector, and is not repeated here.
After the miR-103A-3p sponge expression vector is obtained, the miR-103A-3p sponge expression vector, pAAV-RC plasmid and pHelper plasmid are co-transfected into AAV9-293 cells, and AAV9 virus particles for expressing miR-103A-3p sponge are packaged to obtain the AAV9 virus particles for inhibiting miR-103A-3p expression.
The step of packaging the miR-103a-3p sponge for expressing AAV9 is the same as the step of packaging the RND3 for expressing AAV9, and detailed description is omitted here.
The AAV9 virus particles expressing the miR-103A-3p sponge provided by the invention can express the miR-103A-3p sponge in heart tissues of mice.
The invention also provides application of the RND3 gene overexpression reagent in preparation of a medicament for treating diabetes. In the present invention, the RND3 gene overexpression reagent preferably comprises a viral vector overexpressing the RND3 gene and/or a miR103a-3p inhibitor. In the present invention, the diabetes preferably includes type one diabetes and/or type two diabetes. The virus vector and/or miR103a-3p inhibitor for over-expressing the RND3 gene can play a role in remarkably relieving symptoms related to diabetes.
The technical solutions provided by the present invention are described in detail below with reference to the drawings and examples for further illustrating the present invention, but they should not be construed as limiting the scope of the present invention.
Example 1 RND3 expression levels were inversely correlated with human age and myocardial cell injury marker levels.
The test method comprises the following steps: on the premise of meeting ethical specifications, the invention collects 47 peripheral blood samples of the tested human group from the hospital, and obtains general clinical data of the tested human group, including detection indexes such as age, blood sugar, heart function, peripheral blood image indexes, myocardial zymogram, blood fat and the like.
1. The expression of RND3 mRNA in peripheral blood mononuclear cells was detected by qRT-PCR on 47 samples. The total RNA of peripheral blood mononuclear cells is obtained by using a human peripheral blood cell RNA extraction kit, and PCR is performed after reverse transcription.
The primers for PCR are shown in Table 1.
TABLE 1 PCR primers
Primer name Sequence number Nucleotide sequence
Upstream primer of RND3 SEQ ID NO.5 AATAGAGTTGAGCCTGTGGG
Downstream primer of RND3 SEQ ID NO.6 CTAATGTACTAACATCTGTCCGC
Beta-actin upstream primer SEQ ID NO.7 TCTCCCAAGTCCACACAGG
Beta-actin downstream primer SEQ ID NO.8 GGCACGAAGGCTCATCA
System setup for qRT-PCR:qPCR SYBR Green Master Mix (Low Rox Plus) 5 μl, DEPC water 3.Mu.l of each of the PCR primers was 0.8. Mu.l upstream and downstream, 1. Mu.l of cDNA, and 10. Mu.l of the total reaction system.
qRT-PCR program settings: after 5min of pre-denaturation at 95 ℃, 40 cycles of 10s at 95 ℃, 20s at 60 ℃ and 20s at 72 ℃ are performed, and finally 20s are extended at 72 ℃ to enter a dissolution profile measuring stage.
2. The results of the qRT-PCR analysis, namely, the expression data of RND3 mRNA, and the clinical parameter data of the human subjects were subjected to correlation analysis, and the results are shown in FIG. 1. A in fig. 1 is expression of RND3 mRNA in peripheral blood mononuclear cells of the clinical elderly (. Gtoreq.65 years) and control populations (. Gtoreq.65 years), mann-Whitney test, P <0.05; b in FIG. 1 is a linear correlation of peripheral blood mononuclear cell RND3 mRNA expression levels with age in clinical cohorts; c in FIG. 1 is the Spearman correlation of peripheral blood mononuclear cell RND3 mRNA expression levels with age (age), lactate Dehydrogenase (LDH), monocyte ratio (MON), troponin (CTNI) in the clinical cohort.
As can be seen from a in fig. 1, the expression level of RND3 mRNA in peripheral blood mononuclear cells was significantly reduced in elderly (. Gtoreq.65 year old) population compared to non-elderly (. Gtoreq.65 year old) population (Mann-Whitney test, P < 0.05). As can be seen from B in fig. 1, linear analysis found that the expression level of RND3 was inversely related to age (r= -0.30, p < 0.05). From C in FIG. 1, the spin correlation analysis found that the expression level of RND3 was significantly inversely correlated with the percentage of Monocytes (MON), myocardial Lactate Dehydrogenase (LDH) and high sensitive troponin (cTNI) levels. As can be seen from FIG. 1, the down-regulation of RND3 mRNA expression was associated with aging and exacerbation of myocardial injury.
EXAMPLE 2 modification of RND3 expression and cardiac Functions in cardiac tissue of aged mice
The experimental method comprises the following steps: SPF grade male C57BL/6 mice were purchased from the Shanghai Nannon model animal center. The test mice were divided into 7 weeks of age (n=5) and 60 weeks of age (n=5), corresponding to young and old groups, respectively. All animal experiments were approved by the animal test ethics committee.
After isoflurane anesthetized mice, M-type ultrasound is first used to detect cardiac function in young and old mice, respectively, with detection indicators including cardiac Ejection Fraction (EF) and short Fraction (FS). Subsequently young and old mice were sacrificed at cervical and heart free, each mouse taking a block of left ventricular muscle to make frozen sections for senescence-associated beta-gal enzyme staining; then, 1 block of left ventricular tissue was excised to extract total proteins for western blot to detect the expression of RND3 and senescence-associated secretory phenotype (SASP) associated proteins, and primary antibodies including anti-RND 3, p53, MCP1, IL6 and beta-actin were used. The detection results are shown in FIG. 2. A in fig. 2 is M-type ultrasound detection cardiac ejection fraction and short contraction fraction, unpaired t-test, <0.05; b in fig. 2 is heart tissue senescence-associated β -gal staining, scale = 200 μm, unpaired t-test, <0.01; c in FIG. 2 is the expression of the Westernblot detection RND3 and SASP proteins; d in fig. 2 is the quantitative analysis of the expression levels of RND3 and SASP proteins P53, MCP-1 and IL6, unpaired t-test, P <0.05, P <0.01.
As can be seen from a in fig. 2, the cardiac Ejection Fraction (EF) and the short Fraction (FS) were significantly reduced in the aged mice compared to the young mice. As can be seen from B in FIG. 2, the heart tissue frozen section was stained with age-related beta-gal, and the results showed that the heart tissue of the young mouse had no age-related beta-gal staining positive cells, whereas the heart muscle tissue of the old mouse had a significantly increased rate of age-related beta-gal staining positive cells. As can be seen from FIGS. 2C and D, the level of RND3 protein in the heart of aged mice was decreased with concomitant increases in SASP index such as p53, MCP-1 and IL6 levels. As can be seen from fig. 2, the expression level of RND3 is inversely related to the aging of cardiomyocytes.
Example 3 defective RND3 expression promotes high sugar stimulation-induced cardiomyocyte senescence
1. Rat cardiomyocytes H9C2 and human cardiomyocytes AC16 were cultured in DMEM complete medium (10% fetal bovine serum) containing 30mmol/L dextrose, and after 48 hours, the cells were collected and assayed for RND3 expression using qRT-PCR and western blot, respectively. The detection results are shown as a and B in fig. 3. Wherein a in fig. 3 is qRT-PCR to detect the effect of in vitro hyperglycemic stimulation (30 mmol/L dextrose) on RND3 mRNA of cardiomyocytes, unpaired t-test, <0.05, <0.001, < P; b in FIG. 3 is the effect of western blot to detect in vitro high glucose stimulation (30 mmol/L dextrose) on RND3 protein expression in cardiomyocytes.
The primers used to detect the expression of RND3 in rat cardiomyocytes H9C2 are shown in table 2. Primers used for expression of RND3 in human cardiomyocyte AC16 are shown in table 1.
TABLE 2 primers for detecting the expression of RND3 in rat cardiomyocyte H9C2
As can be seen from a and B in fig. 3, stimulation of H9C2 and AC16 cardiomyocytes with high sugar in vitro significantly down-regulated RND3 expression.
2. RND3 knockout H9C2 cardiomyocytes (labeled RND3_KO) were constructed using CRISPR/Cas9 technology (see earlier task force publication Shoo Z, wangK, zhang S, et al, ingeny pathway analysis of differentially expressed genes involved in signaling pathways and molecular networks in RhoE gene-edge cams J Mol Med,2020,46 (3): 1225-1238.).
In vitro, H9C2 myocardial cells with RND3 gene knockdown were cultured on 6-well plates with DMEM medium (additionally containing 10% fetal calf serum) containing normal glucose (NG, 5.5mmol/L dextrose) and DMEM medium (additionally containing 10% fetal calf serum) containing high sugar (HG, 30mmol/L dextrose, 50mmol/L dextrose) simultaneously, and after 72 hours of culture, the cell growth fusion degree was over 60%, and cells were collected. Washing the cells after culturing for 72 hours once by using PBS, adding an aging-related beta-galactosidase staining fixative solution, fixing for 15 minutes at room temperature, removing the fixative solution, washing 3 times by using PBS, adding the cell aging beta-galactosidase staining solution, incubating overnight in a constant temperature oven at 37 ℃, removing the staining solution the next day, adding PBS, observing under an inverted microscope, and photographing; the observed beta-galactosidase positive rates for 5 representative fields were also counted and t-tested. Performing western blot detection on the cells after 72h of culture, and detecting the expression of SASP related proteins such as p16, p53, MCP-1, IL6, GDF-15 and IL1 alpha; finally, immunofluorescence staining is adopted to detect gamma H of the cells after being cultured for 72 hours 2 The expression of AX is to confirm that the defect of high sugar (HG, 30mmol/L dextrose) and RND3 gene expression cooperate with the condition of DNA damage, and the specific operation is as follows: fluorescenceAfter incubation of the marked gamma H2AX, DAPI staining reagent is added to stain the cell nucleus, the gamma H2AX is colored green, and the cell nucleus is colored blue.
Wherein the effect of different concentrations of sugar stimulation on senescence-associated β -gal enzyme expression in Wild Type (WT) and RND3 knockout H9C2 cells is shown as C in fig. 3, scale = 60 μm; quantitative analysis of the effect of sugar stimulation on senescence-associated β -gal enzyme expression in wild type and RND3 knockout H9C2 cells as shown in D in fig. 3, where data are mean ± SD, positive rates from 5 and above representative fields, unpaired t-test performed with P <0.05, P <0.01; the effect of western blot detection on SASP protein expression in wild-type and RND3 knockout H9C2 cardiomyocytes from in vitro normal sugar (NG, 5.5mmol/L dextrose) and high sugar stimulation (HG, 30mmol/L dextrose) is shown as E in FIG. 3; the effect of high sugar (HG, 30mmol/L dextrose) stimulation on immunofluorescent staining of wild-type and RND3 knockout cardiomyocytes γh2ax is shown as F in fig. 3, where DAPI counterstains the nuclei, scale = 100 μm.
As can be seen from C, D and E in fig. 3, in vitro high sugar stimulation significantly induced H9C2 cell senescence, and RND3 gene knockout further amplified this effect, manifested by an increase in the positive rate of senescence-associated β -gal staining and an increase in SASP-associated protein expression. As available from F in FIG. 3, as gamma H 2 The degree of DNA damage represented by AX staining positivity was also significantly increased in high sugar stimulated rnd3_ko cells.
Example 4 an AAV9 viral particle overexpressing the RND3 gene, the method of preparing the AAV9 viral particle overexpressing the RND3 gene comprises the steps of:
RND3 sequence was prepared from a cDNA library (purchased from Shanghai Ji Kai Gene Co.) by PCR, the upstream primer of the PCR primer sequence was SEQ ID NO.30 (GGAGGTAGTGGAATGGATCCCGCCACCATGAAGGAGAGAAGAGCCAG) and the downstream primer was P2, and the nucleotide sequence of P2 was SEQ ID NO.31 (TCACCATGGTGGCGGGATCCATCACAGTGCAGCTCTTGGCTTTG). The PCR product was 778bp in length. The PCR product was reacted with linearized GV387 vector in an exchange reaction system at 37℃for 30min, 10. Mu.L of the exchange reaction product was added to 100. Mu.L of Stbl3 TM (Invitrogen, mesh # C7373-03) competent cells, the number of flick walls was mixed well, and placed on ice for 30min. Heat shock at 42 ℃ for 90s and ice-water bath incubation for 2min. 500. Mu.L of LB medium was added and the mixture was subjected to shaking culture at 37℃for 1 hour. And (3) uniformly coating a proper amount of bacterial liquid on a flat plate containing the corresponding antibiotics, inversely culturing for 16 hours in a constant temperature incubator, selecting positive transformants, determining correct sequence by sequencing, and performing amplification culture and extraction on the correct clone bacterial liquid to obtain the high-purity plasmid, namely the RND3 gene expression vector.
After the RND3 gene expression vector is obtained, AAV9 virus particles expressing the RND3 gene are packaged by co-transfecting AAV9-293 cells with the RND3 gene expression vector, AAV packaging auxiliary plasmids pAAV-RC and pHelper (pAAV-RC and pHelper plasmids are both purchased from Shanghai Ji Kai gene company).
Add 3X 10 to each 100-mm cell culture dish 6 AAV-293 cells were used for transfection when the DMEM growth medium was supplemented to a confluency of about 70-80% after 48 h. The concentration of the high purity plasmid prepared above was adjusted to 1mg/mL with pH7.5 TE buffer, and the required transfection system and plasmid amount were calculated. If a disc is packed, three plasmids of 1. Mu.g/. Mu.L of RND3 gene expression plasmid 10. Mu.L, 1. Mu.g/. Mu.L of pAAV-RC plasmid 10. Mu.L and 1. Mu.g/. Mu.L of pHelper plasmid 10. Mu.L are pipetted into a 1.5mL EP centrifuge tube, and 1mL of 0.3M CaCl is then added 2 An aqueous solution, gently mixing; 1mL of the 2 XHBS solution was pipetted into another 15mL conical bottom tube, to which 1.03mL of DNA/CaCl was added dropwise 2 Repeatedly blowing and beating the mixed solution and uniformly mixing; immediately mixing the DNA/CaCl 2 Dripping HBS solution onto the cell culture dish, and gently shaking the cell culture dish to uniformly distribute the solution in the culture medium as much as possible; placing the cell culture dish back to the incubator at 37 ℃ for 6 hours; after transfection, the medium in the tray was replaced with 10mL of fresh medium; the culture dish was returned to the incubator and cultured for an additional 72 hours to observe the cell detoxification (the color of the medium changed from red to orange or yellow, some cells rounded and detached from the dish, floating in the medium). Collecting the toxigenic cells together with the culture medium in a 15mL centrifuge tube, centrifuging 200g for 3min to separate cells and supernatant, and separating the supernatant The pelleted cells were resuspended in 1mL PBS for storage. The cell suspension was repeatedly transferred in dry ice-ethanol baths and 37 ℃ water baths, freeze-thawed four times, each for 10min. Slightly shaking after each melting. After the freeze thawing operation was completed, cell debris was removed by centrifugation at 10,000g for 15min, and the supernatant was transferred to a new centrifuge tube for virus concentration, purification, ultrafiltration desalting to obtain AAV9 virus particles expressing the RND3 gene. AAV9 viral particles expressing the RND3 gene were assayed for titres by quantitative PCR. Finally, AAV9 virus particles expressing RND3 genes are packaged and stored at-80 ℃ for standby.
Example 5 effects of cardiac direct Targeted recovery of RND3 on cardiac function and aging in diabetic rats
Male rats of 6 weeks old were selected as test rats, and the rats were divided into 4 groups (5 to 7 samples per group) respectively, NC+AAV9-NC group (normal control group injected with negative control AAV9 virus), NC+AAV9-RND3 group (normal control group injected with RND3 over-expressing AAV 9), T1DM+AAV9-NC group (diabetic group injected with negative control AAV9 virus), T1DM+AAV9-RND3 group (diabetic group injected with RND3 over-expressing AAV 9).
The rats of each experimental group were kept under normal conditions for 5 weeks, and at the 5 th week, AAV9-RND3 group was tail-vein-injected with AAV9 virus particles over-expressing RND3 prepared in example 4, and AAV9-NC group was tail-vein-injected with AAV9 negative control virus particles. AAV9 injection was performed in two portions, and the amount of each virus injection was 50. Mu.L (total 10 12 vg, injected in two times, 5×10 each 11 vg)。
The AAV9 virus required a certain period of time for expression of the exogenous gene in vivo, and a second injection was performed at week 8 of the experiment, wherein AAV9-NC group was again tail-vein injected with AAV9 negative control viral particles, AAV9-RND3 group was again tail-vein injected with AAV9 viral particles over-expressing RND3 prepared in example 4. Simultaneously, the T1DM+AAV9-RND3 group and the T1DM+AAV9-NC group were intraperitoneally injected with STZ (70 mg/kg) at one time, respectively, to induce diabetes mellitus, and the NC group was injected with an equal amount of sodium citrate solution. After the treatment of each test group is completed, conventional feed is continuously carried out, and the mice in each test group are cultured until the 16 th week, so that the physiological parameters of the mice in each test group are subjected to relevant detection. The overall experimental procedure is shown in fig. 4.
The blood sugar concentration is measured at the end point of the experiment (16 weeks of culture), and the diabetes modeling is considered successful according to the fasting blood sugar value of more than or equal to 16.7 mmol/L. Rat cardiac function detection, including Ejection Fraction (EF), shortening Fraction (FS), and E/a peak, was performed under isoflurane anesthesia using M-ultrasound. Groups of rats were sacrificed, heart tissue was isolated, and a portion of left ventricular wall tissue was used to extract proteins for detection of RND3 and SASP related gene expression. Primary antibodies detected by Westernblot include anti-RND 3, IL1 alpha, IL6, MCP-1, p53, beta-actin, etc.
The detection results of the heart function indexes of the rats in each test group of the M-type ultrasonic detection are shown as A in fig. 5, wherein the peak values of EF, FS and E/A are all unpaired t test, P is less than 0.01, P is less than 0.001, P is less than 0.0001 and ns, and the difference has no statistical significance; the expression of SASP-related proteins in cardiac tissues injected with T1DM+AAV9-RND3 and T1DM+AAV9-NC groups is shown as B in FIG. 5, wherein unpaired T-test is performed on the data, P <0.05 ns, and the difference is not statistically significant.
As can be seen from a in fig. 5, corresponding cardiac ultrasound examination was performed on the hearts of each group of rats, and it was found that peak values of EF, FS and E/a were significantly decreased in the t1dm+aav9-NC group (the negative control AAV9 virus-injected diabetes group) relative to the nc+aav9-NC group (the negative control AAV9 virus-injected normal control group), suggesting that the heart function of the diabetes model was impaired; compared with the T1DM+AAV9-NC group, the EF, FS and E/A values of the T1DM+AAV9-RND3 group injected with the over-expressed RND3 are significantly up-regulated, which suggests that heart targeting over-expressed RND3 can prevent heart function damage caused by diabetes. As can be seen from FIG. 5B, overexpression of exogenous RND3 by the heart can raise RND3 and down-regulate SASP-related senescence gene protein expression.
Example 6
1. Focusing on the small non-coding RNA in epigenetic modification, namely miRNA, the mechanism of inhibiting RND3 expression by high sugar stimulation is clear.
miRNA sequencing was performed on normal and high sugar cultured human AC16 cardiomyocytes to find RND 3-targeted mirnas regulated by sugar concentration.
AC16 cardiomyocytes were incubated with normal (5.5 mmol/L dextrose) and high (30 mmol/L dextrose) DMEM medium (containing 10% additional fetal bovine serum) for 48h, with 3 biological samples in each group being repeated. miRNA sequencing was performed on normal and high sugar cultured human AC16 cardiomyocytes. miRNA sequencing work is performed by using a Shenzhen Hua big experiment platform.
Sequencing results showed that AC16 was treated with high sugar for 48h to differentially express a total of 43 mirnas, 23 of which were up-regulated and 20 of which were down-regulated, compared to NG group, wherein hsa-miR-103a-3p was one of the representative mirnas up-regulated following high sugar stimulation [ log2 (HG/ng=5.51, p=0, q=0 ].
2. Sequencing results of miR-103a-3p are analyzed by utilizing a multi-set of chemical systems (https:// biosys.bgi.com /) of Shenzhen Dada, and mainly comprise sample quality control, differential expression miRNA enrichment, miRNA target, GO enrichment, KEGG channel analysis and the like.
And screening to obtain a target miRNA molecule miR-103a-3p, wherein the KEGG signal related to the miR-103a-3p target gene is shown as A in figure 6.
KEGG signal path enrichment analysis is carried out on the target genes of hsa-miR-103a-3P by means of Phyper in an R language packet built in a multi-group system of Shenzhen Huada company, and the Bonferroni method corrects candidate genes which accord with corrected P-value less than or equal to 0.05 to be obviously enriched. As can be seen from FIG. 6A, hsa-miR-103a-3p target gene is involved in a number of KEGG signaling pathways, which are closely related to the present invention, insulin resistance (Insulin resistance), cell senescence (Cellular senescence), insulin signaling pathway (Insulin signalingpathway), type II diabetes (Type 2Diabetes Mellitus) and the like.
3. Experimental verification is carried out on the screened target miRNA molecule, namely miR-103a-3p
In vitro high sugar (30 mmol/L dextrose) DMEM medium (containing 10% additional fetal bovine serum) cultures H9C2 and AC16 cells for 48H. After the culture is completed, RNA in cells is respectively extracted, and the tail-adding method is adopted for carrying out miRNA reverse transcription: reference is made to the kit instructions (https:// www.yeasen.com/products/details/2044). And detecting the expression of miR-103a-3p in the cells by adopting qRT-PCR. The reaction system and PCR cycling parameters for qRT-PCR detection are described in reference example 1.
Primers for detecting miR-103a-3p expression in cells are shown in Table 3.
TABLE 3 primers for detecting miR-103a-3p expression in cells
/>
The qRT-PCR detection results are shown as B in FIG. 6.
As can be seen from B in fig. 6, miR-103a-3P expression in high-sugar cultured rat H9C2 and human AC16 cardiomyocytes was significantly elevated compared to NG group, unpaired t-test, P <0.001.
4. Public database NCBI, miRDB, miRBase queries the sequences of human and rat miR-103a-3p and its precursors.
The miR-103a-3p sequence compositions of the human, rat and mouse are queried through a public database NCBI, miRDB, miRBase, so that the miR-103a-3p sequence compositions of the human, rat and mouse are completely identical. The nucleotide composition of human, rat and mouse miR-103a-3p sequences is shown in SEQ ID NO. 3.
The nucleotide composition of the rat miR-103a-3p precursor miR-103a-1 sequence is shown in SEQ ID NO. 19. The nucleotide composition of SEQ ID NO.19 is:
5’-UUCUUACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUACAG GGCUAUGAAGGCAUUGAGAC-3’。
the nucleotide composition of the rat RND33' UTR sequence is shown in SEQ ID NO. 20.
The nucleotide composition of SEQ ID NO.20 is:
note that: to verify the specificity of miR-103a-3p binding to rat RND33'UTR, a segment of the key sequence TGCTGC in the box of miR-103a-3p binding to rat RND33' UTR was mutated to GTAGTA. The principle of mutation is to select key sites for altered binding, reducing the likelihood of base complementary pairing.
The nucleotide composition of the mutant sequence of the rat RND33' UTR is shown in SEQ ID NO. 21.
The nucleotide composition of SEQ ID NO.21 is:
note that:the bases in the black boxes are mutation sites.
5. By inquiring the NCBI, miRDB, miRBase database, the combination condition of miR-103a-3p and the 3' UTR sequence of the RND3 gene is determined. The results are shown as C in fig. 6.
By comparing the base sequences of miR-103a-3p and RND33' UTR, from C in FIG. 6, miR-103a-3p has 1 binding site for 3' UTR of human RND3 gene at 1379 and 2 binding sites for 3' UTR of rat RND3 gene at 579 and 719, respectively.
EXAMPLE 7 exploration of how miR-103a-3p affects expression of RND3 Gene
Construction of a rat RND3 Gene 3' UTR overexpression promoter plasmid.
The target gene fragment of 3' UTR of RND3 gene is artificially designed and synthesized by the Shanghai Ji Kai Gene chemical technology Co., ltd, and the target gene fragment is treated with recombinase ExnaseT M Under the action of II, the vector is exchange-linked to the linear GV272 vector after XbaI digestion, and the GV272 structure is shown in FIG. 7. Competent cells are transformed, positive clones are selected for PCR and sequencing identification, and a rat RND3 gene 3' UTR over-expression promoter plasmid is constructed.
Construction of overexpression promoter plasmid for rat RND3 Gene 3' UTR mutant sequence
The target gene mutant sequence containing 3' UTR of RND3 gene is designed and synthesized manually by Shanghai Ji Kai Gene chemical technology Co., ltd, and the target gene fragment is treated with recombinase Exnase TM And II, under the action of II, exchanging and linking into a linear GV272 vector subjected to XbaI digestion, transforming competent cells, selecting positive clones, performing PCR and sequencing identification, and constructing a rat RND3 gene 3' UTR mutant sequence over-expression promoter plasmid.
Construction of an overexpression plasmid of rat miR-103a-1 (miR-103 a-3p precursor).
The method comprises the steps of artificially designing and synthesizing miR-103a-1 target gene fragment by entrusting Shanghai Ji Kai gene chemical technology Co., ltd, and putting the target gene fragment into recombinase TM Under the action of II, the exchange link is connected with a linear GV268 vector after XhoI/KpnI digestion, and the GV268 structure is shown in FIG. 8. And transforming competent cells, selecting positive clones for PCR and sequencing identification, and constructing the rat miR-103a-1 overexpression plasmid.
Human embryonic kidney 293T cells were co-transfected with a rat RND3 gene 3' UTR over-expression promoter plasmid (0.1. Mu.g), a rat miR-103a-1 (miR-103 a-3p precursor) over-expression plasmid (0.4. Mu.g) and Renilla plasmid pRL-TK (as an internal reference, 0.02. Mu.g); the 3' UTR mutant sequence of the rat RND3 gene was co-transfected with the overexpressed promoter plasmid (0.1. Mu.g), the overexpressed plasmid (0.4. Mu.g) of the rat miR-103a-1 (miR-103 a-3p precursor) and the Renilla plasmid pRL-TK (0.02. Mu.g as an internal control) into 293 cells; meanwhile, a negative control group is arranged, and no treatment is performed; a positive control group was set up, and 293 cells were co-transfected with purchased human TRAF6 gene 3' UTR overexpression plasmid (0.1. Mu.g), has-miR146a overexpression plasmid (0.4. Mu.g) and Renilla plasmid pRL-TK (0.02. Mu.g as an internal control) as positive controls for the experimental system. Renilla plasmid pRL-TK was purchased from Shanghai Ji Kai Gene chemical technology Co.
Human embryonic kidney cells 293T seeded 24-well plate (10) 5 Number/well), the plasmid was transfected into cells with X-tremegene HP transfection reagent (Roche, cat. No. 06366236001), and after 48h Dual- ReporterAssay System A luciferase (Promega Co., ltd., cat. E1910) test was carried out. Promoter activity is expressed as the ratio of Firefly/Renilla luminescence.
Promoter luciferase activity assay results are shown as D in fig. 6, and the data obtained were subjected to unpaired t-test with P <0.0001.
The miR-103a-1 precursor will produce mature miR-103a-3p in the cell. As can be seen from D in FIG. 6, the luciferase activity was significantly decreased after the 3' UTR promoter plasmids of the miR-103a-1 and RND3 genes were simultaneously overexpressed (group 2) compared to the control (group 1), while the luciferase activity was significantly decreased compared to group 1 after the 3' UTR promoter plasmids of the miR-103a-1 and RND3 genes were simultaneously transfected (group 3), and the binding site mutation of the 3' UTR of the miR-103a-1 and RND3 genes was not yet fully suggested to be increased to some extent in the control group 2. The reliability of the experimental system was confirmed by the combination of group 4 and group 5 as positive controls in the present experiment.
Example 8 validation test of in vitro Down-Regulation of miR-103a-3p to restore RND3 expression and to alleviate high sugar-induced cardiomyocyte senescence
The inhibitor molecule (inhibitor) complementary with the miRNA sequence can be combined with the mature miRNA sequence in a competitive mode, so that the gene silencing effect of the endogenous miRNA is weakened, and the expression quantity of the downstream target gene protein is improved. Considering that miR-103a-3p can be combined with RND3-3' UTR to inhibit the expression of RND3, an inhibitor of the chemically synthesized miR-103a-3p is designed to inhibit the expression of miR-103a-3p induced by high sugar stimulation, so that the reverse effect of RND3 expression and the phenotype related to myocardial cell aging is analyzed.
The nucleotide composition of the sequence of the antisense oligonucleotide of the rat miR-103a-3p_inhibitor, namely miR-103a-3p, is shown in SEQ ID NO. 3.
The antisense oligonucleotide of miR-103a-3p is synthesized by the Guangzhou Ruibo company, and a Negative Control (NC) sequence of an irrelevant sequence is synthesized, wherein the nucleotide composition of the negative control sequence is shown as SEQ ID NO.32 (GCGACAGAUGCAAUUUUUGUACUAC). The antisense oligonucleotide and NC sequence of the synthesized miR-103a-3p are respectively added into DEPC water to prepare 20 mu M mother liquor, and the mother liquor is diluted to 100nM by using the DMEM culture solution without double antibodies for cell culture, and the mother liquor is respectively used as culture solutions of an experimental group and a control group.
After 30mmol/L of dextrose was added to each of the culture solutions of the experimental group and the control group, H9C2 cells were cultured for 48 hours. After the completion of the culture, the cells were harvested.
qRT-PCR was performed on cells cultured for 48 hours, and the expression of RND3 and SASP-related genes was detected, respectively. Primers for rat RND3 and β -actin are as in table 2; PCR primers for SASP-related genes are shown in Table 4. The cells cultured for 48h are subjected to western blot detection to detect SASP related proteins such as p16, p53, MCP-1, IL6,Expression of GDF-15 and IL 1. Alpha. Detection of gamma H by immunofluorescent staining of cells cultured for 48H 2 AX was expressed to clarify the damage to DNA by the interaction of high sugar (HG, 30mmol/L dextrose) with antisense oligonucleotides of miR-103a-3 p. The aging change trend of the cells cultured for 48 hours is defined by adopting aging related index beta-gal enzyme activity staining.
TABLE 4 PCR primers for SASP-related genes
Primer name Sequence number Nucleotide composition
Rat IL-6 upstream primer SEQ ID NO.22 ACTTCCAGCCAGTTGCCTTCTTG
Rat IL-6 downstream primer SEQ ID NO.23 TGGTCTGTTGTGGGTGGTATCCTC
Rat MCP1 upstream primer SEQ ID NO.24 CCCTGCTGCCCTTTCTA
Rat MCP1 downstream primer SEQ ID NO.25 CCAATCTGGGGTCACACT
Rat IL-1 alpha upstream primer SEQ ID NO.26 CCACATCCCTGTTACCTGA
Rat IL-1 alpha downstream primer SEQ ID NO.27 TGACACCCTGGTTTGAGAA
Rat p53 upstream primer SEQ ID NO.28 GCGTTGCTCTGATGGTG
Rat p53 downstream primer SEQ ID NO.29 CCGAAAAGTCTGCCTGTC
The qRT-PCR detection result and the western blot detection result are shown in FIG. 9. Wherein a in fig. 9 is the effect of qRT-PCR detection of miR-103a-3P inhibitor on RND3 and SASP-related gene mRNA levels in high glucose stimulated H9C2 cells, unpaired t-test, <0.05, <0.01; b in FIG. 9 is a western blot detection of the effect of miR-103a-3p inhibitors on the expression of RND3 and SASP-related gene proteins in high-sugar stimulated H9C2 cells; c in fig. 9 is the quantitative analysis result of RND3 and SASP related gene protein expression, unpaired t test, P <0.05, P <0.01.
The immunofluorescent staining results and beta-gal staining results for marker protein γh2ax are shown in fig. 10. Wherein a in fig. 10 is immunofluorescent staining of DNA damage marker protein γh2ax, unpaired t-test, ×p <0.001, scale = 300 μm; b in fig. 10 is senescence-associated β -gal enzyme staining, unpaired t-test, × P <0.0001, scale = 100 μm.
As can be seen from fig. 9 and 10, antisense oligonucleotides of miR-103a-3p significantly increased expression of RND3 in high-sugar stimulated H9C2 cells, while also reducing expression of SASP-related genes such as il1α, IL6, MCP-1 and p53 at the mRNA and protein levels, relative to NC groups. Meanwhile, the gamma H2AX immunofluorescence staining result shows that the antisense oligonucleotide of miR-103a-3p reduces gamma H2AX positive cell rate, and beta-gal enzyme activity staining shows that the antisense oligonucleotide of miR-103a-3p can effectively reduce ageing-related beta-gal positive cell rate. The results indicate that the application of miR-103a-3p_inhibitor in vitro can reduce myocardial cell aging and DNA damage caused by high sugar stimulation.
Example 9
AAV9 virus particles that inhibit miR-103a-3p expression are prepared as follows:
the invention designs a miR-103a-3p sponge which is a miR-103a-3p sponge aiming at the specific combination of miR-103a-3p and a 3'UTR combining site of an RND3 gene, wherein the miR-103a-3p sponge comprises 6 repeated miR-103a-3p and the 3' UTR combining site of the RND3 gene.
Introducing miR-103a-3p sponge into a linearized AAV9 virus vector GV387, wherein the structure of the GV387 is shown in figure 11, so as to obtain a miR-103a-3p sponge expression vector;
the method comprises the following steps: the miR-103a-3p sponge is synthesized by Shanghai Ji Kai gene chemical technology Co., ltd, and the sequence of the miR-103a-3p sponge is shown as SEQ ID NO. 4. Reacting the synthesized target gene with the linearized GV387 vector in an exchange reaction system at 37 ℃ for 30min, adding 10 mu L of the exchange reaction product into 100 mu L of Stbl3 TM (Invitrogen, mesh # C7373-03) competent cells, the number of flick walls was mixed well, and placed on ice for 30min. Heat shock at 42 ℃ for 90s and ice-water bath incubation for 2min. 500. Mu.L of LB medium was added and the mixture was subjected to shaking culture at 37℃for 1 hour. And (3) uniformly coating a proper amount of bacterial liquid on a flat plate containing the corresponding antibiotics, inversely culturing for 16 hours in a constant temperature incubator, selecting positive transformants, determining correct sequence by sequencing, and performing amplification culture and extraction on the correct clone bacterial liquid to obtain a high-purity plasmid, namely the miR-103a-3p sponge expression vector.
The preparation process of expressing the AAV9 by the overexpression of the RND3 in the embodiment 4 is referred to in the specific steps and is not repeated herein, and the AAV9 virus particles expressing the miR-103a-3p sponge, namely the AAV9 virus particles inhibiting the expression of the miR-103a-3p, are packaged by co-transfecting AAV9-293 cells with the miR-103a-3p sponge expression vector, an AAV auxiliary packaging plasmid pAAV-RC and pHelper.
Finally, the AAV9 virus particles expressing miR-103a-3p sponge are adjusted to have the titer of 5 multiplied by 10 11 After vg/ml, split charging and preserving at-80 ℃ for standby.
Example 10 miR-103a-3p sponge improves heart function and inhibits cardiomyocyte senescence in diabetic rats.
Male wild SD rats (6 weeks old) were purchased from Changsha Schrad. SD rats were fed with a high fat diet for 1 month (wherein the high fat diet formulation contained 54.6g of breeding mouse feed per 100g of diet, 16.9g of lard, 14g of sucrose, 10.2g of casein, 2.1g of premix, 2.2g of maltodextrin), and were given by intraperitoneal injection of streptozotocin (STZ, 40 mg/kg), and blood glucose concentration was continuously measured 3 days after STZ injection, with a fasting blood glucose value of 16.7mmol/L or more, and T2DM molding was considered successful.
Rats successfully modeled with T2DM were divided into 2 groups, with 5 samples per group, with tail vein injection of AAV9 virus (AAV 9-NC) and tail vein injection of AAV9 (AAV 9_mir103 a-3p_points) over-expressing miR-103a-3p sponge, respectively. The virus injection amount was 5X 10 virus titer per 100. Mu.L of mice injected 11 The vg/mL virus solution is injected once.
The routine feeding was continued for 8 weeks after virus injection and M-mode ultrasound was used to detect cardiac function, including Ejection Fraction (EF), shortening Fraction (FS), and E/A peak under isoflurane anesthesia. Groups of rats were sacrificed, heart tissue was isolated, and a portion of left ventricular wall tissue was used to extract RNA and protein for detection of RND3 and SASP related gene expression. And detecting the expression condition of RND3 and SASP related genes by adopting a qRT-PCR method and a western blot method.
The primers used for qRT-PCR detection are the same as above.
The results of the M-type ultrasonic detection, qRT-PCR detection and western blot detection are shown in FIG. 12. A in fig. 12 is an index of cardiac function such as M-type ultrasonic detection of ejection fraction, shortness fraction and E/a peak of diabetic rats, unpaired t test, P <0.05; b in fig. 12 is qRT-PCR detection of mRNA expression of RND3 and SASP factors in heart tissue, unpaired t-test, <0.05, <0.01; c in FIG. 12 is the western blot for detecting the expression of RND3 and SASP-related marker gene proteins in heart tissue.
T2DM rat models were successfully constructed by high-fat diet supplemented with intraperitoneal injection of STZ. As can be seen from a in fig. 12, diabetic rats Ejection Fraction (EF), shortening Fraction (FS) and E/a peak of AAV9 virus particles injected with miR-103a-3P sponge were significantly improved compared to the control AAV9-NC group injection (P < 0.05), demonstrating that administration of AAV9 virus particles injected with miR-103a-3P sponge can improve heart function in diabetic rats.
As can be seen from B and C in FIG. 12, qRT-PCR and western blot results of heart tissue suggest that over-expression of miR103a-3p sponge can effectively relieve the inhibition of RND3 expression in heart tissue by T2DM, and simultaneously reduce the expression of SASP related marker genes such as RND3, GDF-15, IL1 alpha, IL6, p16 and the like. In conclusion, inhibiting miR-103a-3p and then restoring RND3 expression is an effective means for antagonizing diabetic myocardial aging.
Example 11
The expression state of miR-103a-3p in blood serum of a clinical diabetes patient group is explored. On the premise of meeting the clinical ethical requirements, as described in example 1, serum samples of 17 other normal control populations and 22T 2DM populations are collected, RNA is extracted, total RNA is obtained, and the reverse transcription of miRNA is performed by adopting an A tail addition method: the expression of miR-103a-3p was detected by qPCR after reverse transcription, with reference to the kit instructions (https:// www.yeasen.com/products/detail/2044). PCR primers for miR-103a-3p and U6 are as shown in Table 3.
The results of the correlation analysis of the qRT-PCR detection result data and clinical parameter data such as blood glucose level of the human subject group are shown in FIG. 13. A in fig. 13 is qPCR detection of miR-103a-3P expression in serum of T2DM and control population, mann-Whitney assay, P <0.0001; b in FIG. 13 is the linear relationship between the expression of serum miR-103a-3p and blood glucose; c in FIG. 13 is the Spearman correlation of expression of serum miR-103a-3p with blood glucose, TC and LDL.
As can be seen from fig. 13, the expression level of miR-103a-3p in peripheral blood of T2DM population was significantly increased. The Spearman correlation analysis result shows that the expression level of human serum miR-103a-3p is positively correlated with the blood sugar (glu) of a human population, total Cholesterol (TC) and low-density lipoprotein (LDL). This result suggests that the levels of human miR-103a-3p are associated with cardiovascular adverse events such as blood glucose and blood lipid levels.
In conclusion, the specific over-expressed RND3 and/or miR-103a-3p inhibitor can effectively treat myocardial aging, especially diabetic cardiomyopathy, can obviously raise the expression of RND3 in myocardial cells, and can also effectively reverse the aging phenotype of cells and restore heart functions.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims (10)

1. Application of RND3 gene overexpression reagent in preparation of medicines for treating myocardial aging is provided.
2. The use according to claim 1, wherein the myocardial aging comprises physiological advanced myocardial aging and/or diabetic cardiomyopathy.
3. The use according to claim 2, wherein the diabetic cardiomyopathy comprises a type one diabetic cardiomyopathy and/or a type two diabetic cardiomyopathy.
4. The use according to claim 1, wherein the nucleotide sequence of the RND3 gene is shown in SEQ ID No. 1.
5. The use according to claim 1, wherein the over-expression agent comprises a viral vector over-expressing RND3 gene and/or a miR103a-3p inhibitor.
6. The use of claim 5, wherein the miR-103a-3p inhibitor comprises an antisense oligonucleotide to miR-103a-3p and/or a miR-103a-3p sponge.
7. The use of claim 5, wherein the miR-103a-3p inhibitor comprises a viral vector that inhibits miR-103a-3p expression.
8. An AAV9 viral particle overexpressing an RND3 gene, wherein the method of preparing an AAV9 viral particle overexpressing an RND3 gene comprises the steps of:
Cloning RND3 gene into AAV9 virus vector to obtain RND3 gene expression vector;
AAV9 virus particles expressing RND3 gene were packaged by cotransfecting AAV9-293 cells with RND3 gene expression vector, pAAV-RC plasmid and pHelper plasmid.
9. An AAV9 viral particle that inhibits miR-103a-3p expression, comprising the steps of:
cloning miR-103a-3p sponge into an AAV9 virus vector to obtain an miR-103a-3p sponge expression vector; the nucleotide sequence of the miR-103a-3p sponge is shown in SEQ ID NO. 4;
and co-transfecting the miR-103a-3p sponge expression vector, the pAAV-RC plasmid and the pHelper plasmid into AAV9-293 cells, and packaging AAV9 virus particles for expressing the miR-103a-3p sponge.
Application of RND3 gene overexpression reagent in preparation of medicine for treating diabetes; the RND3 gene overexpression reagent comprises a viral vector for over-expressing the RND3 gene and/or a miR103a-3p inhibitor.
CN202310580007.4A 2023-05-22 2023-05-22 Application of RND3 gene overexpression reagent in preparation of medicines for treating myocardial aging Pending CN116650670A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310580007.4A CN116650670A (en) 2023-05-22 2023-05-22 Application of RND3 gene overexpression reagent in preparation of medicines for treating myocardial aging

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310580007.4A CN116650670A (en) 2023-05-22 2023-05-22 Application of RND3 gene overexpression reagent in preparation of medicines for treating myocardial aging

Publications (1)

Publication Number Publication Date
CN116650670A true CN116650670A (en) 2023-08-29

Family

ID=87723483

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310580007.4A Pending CN116650670A (en) 2023-05-22 2023-05-22 Application of RND3 gene overexpression reagent in preparation of medicines for treating myocardial aging

Country Status (1)

Country Link
CN (1) CN116650670A (en)

Similar Documents

Publication Publication Date Title
Liang et al. LncRNA PFL contributes to cardiac fibrosis by acting as a competing endogenous RNA of let-7d
Choong et al. Hypoxia-induced H19/YB-1 cascade modulates cardiac remodeling after infarction
Stewart et al. Evidence for transcriptional and post-transcriptional control of the cellular thymidine kinase gene
CN110484615B (en) Application of lncRNA in regulation and control of macrophage polarization in viral myocarditis
Gu et al. LncRNA promoted inflammatory response in ischemic heart failure through regulation of miR-455-3p/TRAF6 axis
Song et al. circPTPN12/miR-21–5 p/∆ Np63α pathway contributes to human endometrial fibrosis
CN106480037A (en) A kind of long non-coding RNA and the application in diagnosis preeclampsia and target drug treatment is prepared
CN111676222A (en) shRNA for inhibiting Mettl3 gene expression, recombinant adeno-associated virus thereof and application thereof
CN113862273B (en) HK2 low-expression breast cancer cell line and siRNA used by same
CN116650670A (en) Application of RND3 gene overexpression reagent in preparation of medicines for treating myocardial aging
CN113528528B (en) shRNA for promoting apoptosis of imatinib-resistant chronic myelocytic leukemia cell K562/G01 and application thereof
CN108239642B (en) Adipocyte differentiation related long non-coding RNA and application thereof
O'Connor et al. AGO HITS-CLIP reveals distinct miRNA regulation of white and brown adipose tissue identity
CN110904046B (en) Application of ISLR gene in preparation of medicine for treating obesity and improving insulin resistance
US8153764B2 (en) Biomarker specific to brain/nerve or specific to neuronal differentiation
CN116426633B (en) Application of apolipoprotein H in medicine for preventing and/or treating fatty liver and related diseases
WO2020248771A1 (en) Preparation method for diabetes early warning and/or diagnostic reagent kit based on hsa-mir-320a, medicament for preventing diabetes, screening method for medicament, and preparation method therefor
CN115807077B (en) Use of ETS1 in the preparation of a product for diagnosing or treating ciliated disorders
CN115786515B (en) Application of PDPN in HER2 positive gastric cancer diagnosis and treatment of lapatinib resistance
CN114272378B (en) Use of an agent that causes a loss of function of CTTNBP2NL in the manufacture of a medicament for the treatment of a disease
CN114788865B (en) Application of miR-378 as cholesterol steady-state regulation target point
US20230287427A1 (en) Inhibition of lncExACT1 to Treat Heart Disease
EP4009051A1 (en) Use of dkk1 inhibitor in prevention and/or treatment of tumor cachexia and diseases associated with diabetes
CN111617096A (en) Application of lncRNA AK124826 and related molecules thereof in diagnosis of polymyositis/dermatomyositis
CN115501341A (en) Application of Brachyury gene/protein promoter in preparation of medicines for preventing and/or treating intervertebral disc degeneration

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination