CN116640754B - Streptococcus prophage lyase lys224 and application thereof - Google Patents

Streptococcus prophage lyase lys224 and application thereof Download PDF

Info

Publication number
CN116640754B
CN116640754B CN202310896088.9A CN202310896088A CN116640754B CN 116640754 B CN116640754 B CN 116640754B CN 202310896088 A CN202310896088 A CN 202310896088A CN 116640754 B CN116640754 B CN 116640754B
Authority
CN
China
Prior art keywords
streptococcus
lyase
lys224
prophage
bacteria
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202310896088.9A
Other languages
Chinese (zh)
Other versions
CN116640754A (en
Inventor
马俊飞
张兴林
牛建蕊
李兴帅
张玲玲
徐立楠
杨祥朋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Linyi University
Original Assignee
Linyi University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Linyi University filed Critical Linyi University
Priority to CN202310896088.9A priority Critical patent/CN116640754B/en
Publication of CN116640754A publication Critical patent/CN116640754A/en
Application granted granted Critical
Publication of CN116640754B publication Critical patent/CN116640754B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/14—Drugs for genital or sexual disorders; Contraceptives for lactation disorders, e.g. galactorrhoea
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention discloses a streptococcus prophage lyase lys224 and application thereof, belonging to the technical field of preventing and treating related diseases of streptococcus, wherein the amino acid sequence of the lyase lys224 is shown as SEQ ID NO.1, and the encoding gene of the lyase can be prepared into recombinant vectors or engineering bacteria, thus providing a foundation for further application of the lyase lys224; the lyase has broad-spectrum antibacterial activity on streptococcus and other bacteria related to dairy cow mastitis, and provides a theoretical basis for preventing and treating the dairy cow mastitis.

Description

Streptococcus prophage lyase lys224 and application thereof
Technical Field
The invention relates to the technical field of preventing and treating streptococcal related diseases, in particular to a streptococcal prophage lyase lys224 and application thereof.
Background
Streptococcus (streptococci) bacteria belong to the gram-positive group, and are widely distributed in the nature, in human and animal faeces and in the nasopharynx of healthy people, among which are a wide variety of pathogenic bacteria. Human pathogenic bacteria include Streptococcus pneumoniae, streptococcus pyogenes, streptococcus faecalis, etc., which can cause clinical diseases such as septicemia, arthritis, meningitis, endocarditis, encephalitis, rheumatic fever, scarlet fever, etc.; the streptococcus agalactiae, streptococcus agalactiae and streptococcus uberis infected with cattle can cause the symptoms of cow mastitis and the like; streptococcus suis can cause meningitis, septicemia, pneumonia, etc. in swine humans; streptococcus equi infection can cause horse to develop horse adenomatosis, cause human wound infection, bacteremia and the like. Streptococcal disease causes great harm to human health and causes great loss to livestock breeding. The presence of antibiotics allows for a certain control of streptococcal infection. However, as antibiotics are used in non-standard manner in human medicine and livestock breeding industries, the resistance of the antibiotics is gradually increased, and thus the emerging multi-drug resistant bacteria have no available antibiotic treatment, so that development of a new class of antibacterial drugs or antibacterial agents for preventing and controlling streptococcus infection is urgently needed.
Phage is a virus capable of infecting a prokaryotic microorganism such as bacteria, archaea, etc., which can rapidly lyse bacteria through a "perforin-lyase" binary system, so that phage and its derived lyase can be used as an alternative antimicrobial agent for antibiotics. Phage lysis spectra are generally narrow and limited in their use because bacteria can rapidly evolve resistance to surface receptors. The lyase derived from phage has a relatively wide cleavage spectrum, can be used as a high-efficiency and safe natural antibacterial agent for preventing and controlling drug-resistant pathogenic bacteria.
The phage lyase is used as an antibacterial agent, can specifically and rapidly kill host bacteria, and the peptidoglycan acted on the surface of the bacteria by the lyase has high in-seed conservation because the peptidoglycan is a key component of the cell wall, so the lyase shows broader cleavage activity and also determines that the bacteria are more difficult to generate resistance to the lyase; meanwhile, when the lyase is used for treating animals infected by pathogenic bacteria, the host animals can generate antibodies against the lyase, but the active center of the lyase is not exposed on the surface epitope generally, so the antibodies against the lyase cannot impair the lysis sterilization effect of the lyase; moreover, the combination of the lyase and other antibacterial agents such as antibiotics has a synergistic antibacterial effect, so that the cleavage spectrum can be widened, the antibacterial activity can be effectively exerted, and the probability of generating resistance of bacteria is reduced.
Aiming at various streptococcus infections related to cow mastitis and diseases caused by other streptococcus such as streptococcus suis, streptococcus equi, streptococcus pneumoniae, streptococcus pyogenes and the like, a broad-spectrum effective streptococcus phage lyase is not developed at present, and is applied to prevention and control of streptococcus infection.
Thus, how to provide a streptococcal phage lyase against the spectrum of streptococci is a problem that needs to be addressed by those skilled in the art.
Disclosure of Invention
In view of the above, the invention provides a streptococcus prophage lyase lys224, which has spectral antibacterial activity on streptococcus related to cow mastitis, and provides a theoretical basis for preventing and treating cow mastitis.
In order to achieve the above purpose, the present invention adopts the following technical scheme:
a streptococcus prophage lyase lys224, wherein the amino acid sequence of the lyase lys224 is shown in SEQ ID NO. 1.
Preferably, the domain of streptococcal prophage lyase lys224 comprises an N-terminal Amidase-5 cleavage domain, a CW7 binding domain and a C-terminal glucosamidase cleavage domain.
Preferably, the N-terminal Amidase-5 cleavage domain is amino acids 4 to 148, the 2 CW7 domains are amino acids 155 to 190 and 199 to 235, respectively, and the C-terminal Glucoaminodase cleavage domain is amino acids 297 to 433.
Preferably, the nucleotide sequence encoding the streptococcal prophage lyase lys224 is shown in SEQ ID No. 2.
Preferably, the primer sequence for amplifying the nucleotide sequence is shown as SEQ ID NO. 3-SEQ ID NO. 4.
As the same invention concept as the technical scheme, the invention also claims the application of the streptococcus prophage lyase lys224 in preparing related medicines for splitting streptococcus, staphylococcus, enterococcus faecalis, pneumococcus, listeria monocytogenes or pseudomonas aeruginosa.
Preferably, the streptococcus comprises: streptococcus agalactiae, streptococcus dysgalactiae, streptococcus uberis, streptococcus suis, streptococcus equi, human streptococcus pneumoniae and streptococcus pyogenes.
As the same invention conception as the technical scheme, the invention also claims the application of the streptococcus prophage lyase lys224 in preparing an antibacterial agent for treating cow mastitis.
As the same inventive concept as the technical scheme, the invention also claims the application of the streptococcus prophage lyase lys224 in preparing biological materials of streptococcus pyogenes, staphylococcus, enterococcus faecalis, pneumococcus, listeria monocytogenes or pseudomonas aeruginosa, which is characterized in that the biological materials comprise recombinant expression vectors and recombinant engineering bacteria; the recombinant expression vector is formed by recombining an expression vector and a nucleotide sequence of lyase lys224; the recombinant engineering bacteria are formed by transforming the recombinant expression vector into host escherichia coli.
The invention also provides a preparation method of the streptococcus prophage lyase lys224, which comprises the following specific steps:
(1) Amplifying the nucleotide sequence of prophage lyase lys224 with streptococcus agalactiae 4-4 genome as template;
(2) Cloning the nucleotide sequence obtained in the step (1) into an expression vector to obtain a recombinant expression vector;
(3) Transforming the recombinant expression vector obtained in the step (2) into competent cells of escherichia coli to obtain recombinant engineering bacteria;
(4) Inducing and expressing lyase lys224 by using recombinant engineering bacteria;
(5) Extracting and purifying the lyase lys224 obtained in the step (4).
Preferably, the cleavage method used in the cloning of the nucleotide sequence of lysase lys224 is BamHI and KpnI double cleavage.
Preferably, the expression vector is pEC, C-terminally with a 6xHis tag; with T7 lac promoter, ni was used + And (5) purifying by affinity chromatography. The vector may be any other vector suitable for expressing a foreign gene in E.coli, such as pET series, pGEX series, pMAL series or pBAD series.
Preferably, the engineering bacteria are escherichia coli BL21 (DE 3) or escherichia coli Rosseta and other expression host bacteria.
Preferably, the inducer used for inducing expression is IPTG, the induction concentration is 0.5mmol/L, and the induction time is 16 h.
Preferably, the culture temperature of the engineering bacteria is 37 ℃ and the induction expression temperature is 25 ℃.
Compared with the prior art, the pre-phage lyase lys224 is obtained by cloning from the streptococcus dysgalactiae 4-4 genome, and the soluble lyase is induced and expressed by adopting a prokaryotic expression mode. The lyase lys224 has broad-spectrum antibacterial effect on streptococcus agalactiae, streptococcus dysgalactiae, streptococcus uberis, streptococcus suis, streptococcus equi, streptococcus pneumoniae, streptococcus pyogenes and other bacteria in streptococcus, such as enterococcus faecalis, pneumococcus, staphylococcus epidermidis, staphylococcus aureus, listeria monocytogenes, pseudomonas aeruginosa and the like, and lays a foundation for preventing and treating diseases infected by the bacteria. The invention can obtain a large amount of products with lyase activity and physicochemical properties, has low production cost and strong product activity, and can meet the production requirements of popularization and application.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments or the description of the prior art will be briefly described below, and it is obvious that the drawings in the following description are only embodiments of the present invention, and that other drawings can be obtained according to the provided drawings without inventive effort for a person skilled in the art.
FIG. 1 is a diagram showing SDS-PAGE results of prokaryotic expression and purification of the lyase protein lys224; wherein M is a standard protein molecular weight marker; 1 is engineering strain whole protein for transforming recombinant expression plasmid; 2 is the recombinant engineering strain total protein of the transformed empty vector plasmid; 3 is the result of purification of the lyase protein lys224;
FIG. 2 is a schematic diagram of the sequence structure of lysase lys224 protein; wherein Amidase-5 is the 1 st cleavage domain, glucosaminidase is the 2 nd cleavage domain, and the middle CW7 is the binding domain;
FIG. 3 is a perspective view of the pre-streptococcal phage lyase lys224 predicted by alpha fold;
FIG. 4 is a graph showing the in vitro bacteriostatic effects of lysase lys224 at various concentrations on Streptococcus dysgalactiae;
FIG. 5 is a graph showing the results of pH stability detection of lysase lys224;
FIG. 6 is a graph showing the results of temperature stability of lysase lys224.
Detailed Description
The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
Example 1 genomic sequence amplification and recovery
Whole genome sequencing of streptococcus agalactiae 4-4 isolated from cow mastitis milk sample, positioning prophage genome in genome by letter analysis, and searching full-length nucleotide sequence of lyase lys224 in prophage.
The nucleotide sequence shown as Seq ID No.2 was amplified using the primer pair lys 224-F/R.
The upstream primer lys224-F:
5 ， -aggagatataccatgggatccatggcaatagagactgaaaa-3 ， as shown in SEQ ID NO. 3;
the downstream primer lys224-R:
5 ， -aaaatacaggttttcggtaccaactggtttcttagagattg-3 ， as shown in SEQ ID NO. 4;
the primer sequence contains homologous arm fragments at the connecting sites of the expression vector, and the underlined part of the base sequence is the homologous arm fragments.
The reaction system is shown in Table 1.
Table 1: PCR reaction system
Reaction conditions:
after the amplification is completed, the PCR amplification product is detected by 1% agarose gel electrophoresis, and the target fragment amplified by PCR is recovered by using a Noruzan rubber cutting recovery kit.
Example 2 ligation and transformation of recombinant expression plasmids competent cells:
1) The expression vector was subjected to double cleavage, and the cleavage system is shown in Table 2.
Table 2: enzyme cutting system
The enzyme digestion process is as follows: and (3) carrying out water bath for 4 hours at 37 ℃, verifying the enzyme digestion system by 1% agarose gel electrophoresis, and recovering the gel to obtain the carrier with the sticky end.
Based on the target gene PCR gel recovery product and plasmid concentration after cleavage, 20. Mu.L of one-step cloning ligation system was determined as shown in Table 3.
Table 3: connection system
2) The ligation systems in Table 3 were mixed and ligated for 30min at 37 ℃. mu.L of the ligation product was added to 100. Mu.L of E.coli DH 5. Alpha. Competent cells, gently mixed and left on ice for 30min. Then rapidly placed on ice for 2min after heat shock at 42 ℃ for 90 s. 890. Mu.L of LB medium was added thereto, and the culture was continued at 37℃for 1 hour with shaking. After centrifugation at 5000rpm for 5min, 900. Mu.L of the supernatant was discarded, and the remaining 100. Mu.L of the resuspended broth was used and spread evenly on a solid LB medium containing Kan (final concentration 50. Mu.g/mL) and incubated in an incubator at 37℃overnight with inversion.
3) And (3) selecting a single colony on a Kan plate, inoculating the single colony into an LB liquid culture medium containing Kan for culture, identifying positive bacterial liquid through PCR after bacterial suspension is obtained, simultaneously sending a PCR identification system to Shanghai biological stock company for sequencing, and comparing a sequencing result with a target gene sequence. After overnight incubation of the properly sequenced recombinant DH 5. Alpha. Strain, the recombinant plasmid was extracted using the Norfluzamide plasmid extraction kit.
4) 10. Mu.L of the recombinant plasmid was added to 100. Mu.L of competent cells of E.coli BL21, and the mixture was left on ice for 30min after mixing. Then rapidly placed on ice for 2min after heat shock at 42 ℃ for 90 s. 890. Mu.L of LB medium was added thereto, and the culture was continued at 37℃for 1 hour with shaking. 100. Mu.L of the bacterial liquid was uniformly spread on a solid LB medium containing Kan (final concentration: 50. Mu.g/mL), and cultured in an incubator at 37℃overnight with inversion.
EXAMPLE 3 prokaryotic expression and purification of the lyase protein lys224
And (3) picking a single colony on a Kan plate, inoculating the single colony into an LB liquid culture medium containing Kan for culture, and identifying positive bacterial liquid through PCR after bacterial suspension is obtained. Transferring positive bacterial liquid into LB liquid culture medium, shake culturing at 37deg.C to OD 600 After about 0.6-0.8, IPTG was added at a final concentration of 0.5mmol/L and expression was induced by shaking overnight at 25 ℃. An expression engineering bacterium transformed into an empty plasmid was used as a negative control. After the recombinant engineering bacteria are subjected to expansion culture and induced expression, the bacteria are cracked by ultrasonic crushing. Centrifuging at 12000rpm and 4deg.C for 10min, removing supernatant, and collecting supernatantAnd performing SDS-PAGE electrophoresis analysis. As a result, as shown in FIG. 1, the recombinant engineering bacteria showed a thicker band at 53kDa (lane 1) than the empty plasmid engineering bacteria (lane 2).
The cells were resuspended in 50mM imidazole wash, sonicated and lysed, and the supernatant was taken using Ni + The affinity chromatography column is used for purifying the lyase protein. Balancing the chromatographic column with balancing solution for 2-3 times, and loading the supernatant onto the column for multiple times to make target protein and affinity chromatography Ni + The filler was fully bound and washed 6 times with 50mM imidazole to wash off the contaminating proteins. The target protein was then eluted using 200mM imidazole and the results of protein purification are shown in FIG. 1, lane 3. The amino acid sequence of the purified lyase protein lys224 is shown as SEQ ID NO.1, and the encoding gene is shown as SEQ ID NO. 2.
MAIETEKAIS WMVARQGAVS YSMDYRNGPS SYDCSSAIYY ALMSAGAISA GWAVNTEYMH DWLIKNGYVL IAENQDWNSQ RGDVVIWGLR GQSAGAGGHV VMFVDSDNII HCNYANNGIT INNYNQTAAS AGWMYSYVYR LANQSSTSTA GKSLDTLVKE TLAGIYGNGD TRKAALGNQY EAVMAVINGK ATTPKKTIDQ LAQEVIAGKH GNGDERKKSL GSDYDAVQKR VTEILKSGTP SNAPKTPSDK PKSEVVNSTT EPKKAEIEAT GKATDTKITK EAGDLSFNGV VLKKSVLDII LAKCKEHDIL PSYAITVLHF EGLWGASAVG KADNNWGGMT WTGKGERPSG VTVTQGTARP SNEGGYYMHY SSVDDFLTDW FYLLRAGGSY KVSGAKTLSE AVKGMFMVGG STYDYAASGY DNYIVGMSSR LKAIEAENGS IAKFDVGTVG NVGSTDKIEV NIEGIEISIN GVTYTISKKP V, as shown in SEQ ID NO. 1.
atggcaatag agactgaaaa agccatttct tggatggtag ctaggcaagg ggctgtttct tattccatgg attaccgaaa tggtccaagc tcctatgact gctcaagtgc tatttattat gctttgatgt cagcaggtgc tatctctgct ggctgggctg taaatacaga atatatgcatgattggctta tcaaaaatgg atatgtattg attgcagaaa atcaagattg gaatagccaa aggggtgatg ttgttatttg ggggctacgt ggtcagtctg ctggagctgg tggtcatgtc gtaatgtttg tggattcaga caacatcatt cactgtaatt atgccaataa tggcattacc atcaataact acaatcagac cgctgctagc gctggctgga tgtattctta tgtttaccgt ttagctaatc agtcatcaac ctcaacggct ggaaaaagcc ttgacacctt agttaaagag accttggcag gtatttacgg taacggagat acccgcaagg cagctcttgg caatcaatat gaggctgtca tggcagtcat caatggcaaa gctacgacac ctaaaaaaac aattgaccaa ttggctcaag aggtaattgc aggtaaacat ggtaacggtg acgaacgtaa aaaatcacta ggctctgatt atgatgcggt gcaaaagcga gttactgaaa ttctaaaaag tggcacaccctctaatgccc ctaaaacgcc ctctgacaag ccaaaaagtg aggtggtaaa ttccaccaca gaacctaaaa aagcagaaat tgaggcaact ggtaaagcga cagataccaa aatcacaaaa gaagctggag atttgtcgtt taatggggta gttttgaaaa aatctgtact tgatattatc cttgctaaat gcaaagaaca tgacatcttg ccaagctatg ctattacagt cctgcacttt gagggactat ggggtgcatc cgcagtaggt aaagctgata acaactgggg cggcatgact tggacaggta aaggagagcg cccaagtggt gtcactgtta cccaaggtac agcccgccca tctaatgagg gtggttatta catgcactat tcaagtgttg atgatttcct tacagattgg ttttacttgc tacgtgctgg aggctcttac aaggtcagcg gtgctaagac tttatctgag gctgtaaaag gcatgtttat ggtcggaggt tccacctatg actatgcagc cagtggctat gataactaca ttgtaggcat gtctagccgt ttgaaagcta ttgaggctga aaatggctca atagctaagt ttgatgttgg taccgtcggt aatgtcggta gcacggataa gattgaggtc aacattgagg gtattgaaat ttctatcaat ggtgtcacct atacaatctc taagaaacca gtt, as shown in SEQ ID NO. 2.
Example 4 cleavage enzyme lys224 Structure prediction
The amino acid sequence of the lyase lys224 (SEQ ID NO. 1) was submitted to the Pfam online server (http:// Pfam. Xfam. Org /) to predict the domain, as shown in FIG. 2; as can be seen from FIG. 2, amidase-5 starts at value 4 and ends at value 148 in the protein sequence; 2 CW7 are in the protein sequence, the first CW7 starting at value 155 and ending at value 190; the second CW7 starts at value 199 and ends at value 235; glucosaminidase starts at value 297 and ends at value 433 in the protein sequence.
Three-dimensional structure prediction of streptococcal prophage lyase lys224 was performed using the AlphaFold Colab website (https:// Colab. Research. Google. Com/gitub/sokrypton/ColabFold/blob/main/AlphaFold 2.Ipynb #scrollto=azikiidicacan), its amino acid sequence (SEQ ID No. 1) was submitted, and its domain was mapped using pymol software after downloading the prediction results, and the results are shown in fig. 3.
EXAMPLE 5 analysis of physicochemical Properties of lysase lys224
Amino acid number 481
Relative molecular mass 51620.87
Theoretical pI 6.22
Amino acid number ratio
Ala (A) 47 9.8%
Arg (R) 12 2.5%
Asn (N) 28 5.8%
Asp (D) 26 5.4%
Cys (C) 3 0.6%
Gln (Q) 11 2.3%
Glu (E) 24 5.0%
Gly (G) 52 10.8%
His (H) 7 1.5%
Ile (I) 31 6.4%
Leu (L) 24 5.0%
Lys (K) 35 7.3%
Met (M) 13 2.7%
Phe (F) 7 1.5%
Pro (P) 11 2.3%
Ser (S) 44 9.1%
Thr (T) 34 7.1%
Trp (W) 10 2.1%
Tyr (Y) 26 5.4%
Val (V) 36 7.5%
Pyl (O) 0 0.0%
Sec (U) 0 0.0%
(B) 0 0.0%
(Z) 0 0.0%
(X) 0 0.0%
Total number of negatively charged residues (Asp+Glu): 50
Total number of positively charged residues (Arg+Lys): 47
Atomic composition:
Carbon C 2274
Hydrogen H 3553
Nitrogen N 615
Oxygen O 725
Sulfur S 16
molecular formula C 2274 H 3553 N 615 O 725 S 16
Total atomic number 7183
Extinction coefficient 93865
Extinction coefficient at M -1 cm -1 In units, measured in 280nm water.
Absorbance 0.1% (=1 g/l) 1.818.
Estimated half-life:
the N-terminal of the protein sequence is methionine (Met).
The estimated half-life was 30 hours (mammalian reticulocytes, in vitro).
>20 hours (yeast, in vivo).
>10 hours (Escherichia coli, in vivo)。
Instability index:
the Instability Index (II) was calculated to be 33.19
This indicates that the protein classification is stable.
The Aliphatic index (Aliphatic index) is 76.07
The overall average hydrophilicity (GRAVY) is-0.304.
Example 6 in vitro bacteriostatic Activity assay of lyase lys224 and bacteriostatic Spectrometry
Streptococcus were cultured in BHI medium to logarithmic phase, the bacterial liquid was centrifuged, and the pellet was washed 2 times with Tris-HCI (pH 7.5), and then the bacterial cells were resuspended with Tris-HCI and OD was adjusted 600 About 0.6, and then concentrated to 1/2 of the original volume. mu.L of the concentrated bacterial solution was mixed with 100. Mu.L of lysase lys224 of various concentrations (0, 50, 100, 150, 200. Mu.g/mL) in a 96-well plate to adjust the OD of the mixture 600 The value is about 0.6, and the final concentration of the lyase is 0, 25, 50, 75 and 100 mug/mL respectively. Taking 100 μl of concentrated bacterial liquid and 100 μl of Tris-HCl mixed solution as control, placing 3 groups of the bacterial liquid in parallel, standing at 37deg.C in a multifunctional enzyme labeling instrument for culturing, and measuring OD every 10min 600 Numerical value, OD is plotted 600 A time-dependent curve.
As a result, as shown in FIG. 4, OD of the group treated with lysase lys224 at different concentrations 600 The value gradually decreases, and the bacterial liquid gradually becomes clearOD without addition of lyase 600 The numerical values are not changed basically. Wherein, the descending trend of the 25 mug/mL lyase group is slightly worse; OD when the concentration of the lyase is more than 50. Mu.g/mL 600 The decrease of the values tends to be consistent, which indicates that the application concentration of 50 mug/mL can achieve the best antibacterial effect.
A total of 18 strains from the group consisting of Streptococcus uberis, streptococcus dysgalactiae, streptococcus agalactiae, streptococcus suis, streptococcus equi, streptococcus pneumoniae, streptococcus pyogenes, staphylococcus aureus, staphylococcus epidermidis, enterococcus faecalis, aeromonas equine and Pseudomonas aeruginosa, respectively, were used for the determination of the cleavage spectrum of the lyase lys224. Culturing the strain to be tested at 37 ℃ to logarithmic growth medium phase, centrifuging the bacterial liquid, washing precipitate with Tris-HCI (pH 7.5) for 2 times, and then re-suspending the bacterial cells with Tris-HCI and adjusting OD 600 About 0.6, and then concentrated to 1/2 of the original volume. mu.L of the concentrated bacterial solution was mixed with 100. Mu.L of lysase lys224 at 100. Mu.g/mL in a 96-well plate to adjust the OD of the mixture 600 The value is about 0.6, the final concentration of the lyase is 50 mug/mL, 100 mu L of concentrated bacterial liquid and 100 mu L of Tris-HCl mixed liquid are used as a control, 3 groups of the concentrated bacterial liquid and the 100 mu L of Tris-HCl mixed liquid are parallel, and the mixture is placed in a multifunctional enzyme-labeled instrument for static culture at 37 ℃. OD was measured at 0h and 1h 600 Numerical value, calculate OD 600 Ratio of decrease in value, in OD 600 And > 20% shows that the protease lys224 can be cleaved to determine the cleavage spectrum of the protease lys224, and the result shows that the protease lys224 has a cleavage effect on all of streptococcus agalactiae, streptococcus dysgalactiae, streptococcus uberis, streptococcus suis, streptococcus equi, part of streptococcus pneumoniae, streptococcus pyogenes and the like in the 18 strains of streptococcus tested, and the result shows that the protease lys224 has a broader antibacterial capacity.
Table 4: cleavage Spectrum measurement results of lyase lys224
EXAMPLE 7 identification of the pH and temperature stability of the lyase lys224
Analysis of the pH stability of the lyase lys 224: streptococcus is cultivated in BHI culture medium to logarithmic phase, and bacterial liquid is divided into 8 groupsAfter centrifugation, the mixture was washed with buffers of different pH (50 mM NaCl, 50mM Na 2 HPO 4 The pH was adjusted to 4,5,6,7,8,9, 10, 11, respectively, and the pellet was washed 2 times, then resuspended in the corresponding pH buffer and OD was adjusted 600 About 0.6, and then concentrated to 1/2 of the original volume. 100. Mu.L of concentrated bacterial solutions under different pH conditions were mixed with 100. Mu.L of lyase lys224 (prepared by diluting the lyase with Tris-HCI having different pH) at the same pH in a 96-well plate, respectively, to obtain OD of the mixed solution 600 The value is about 0.6, and the final concentration of the lyase is 50 mug/mL. Mixing and rapidly placing in an enzyme-labeled instrument to determine initial A 630 The value is then put in the mixed solution of bacteria and lyase under different pH conditions for incubation at 37 ℃, and the final A is measured after 1h 630 Numerical value, and calculate ΔA 630 Numerical values. As a control, 100. Mu.L of concentrated bacteria and 100. Mu.L of Tris-HCl mixture were used, 3 of which were in parallel.
As a result of measurement, as shown in FIG. 5, the enzyme lys224 was used for ΔA at pH 6 630 The value is highest, the highest cleavage activity is achieved, and the cleavage enzyme activity decreases to different degrees with increasing or decreasing pH value. The lyase lys224 maintains higher enzyme activity at pH=5-10 and has better stability at pH=5-10.
Temperature stability analysis of lyase lys 224: streptococcus were cultured in BHI medium to logarithmic phase, the bacterial liquid was centrifuged, and the pellet was washed 2 times with Tris-HCI (pH 7.5), and then the bacterial cells were resuspended with Tris-HCI and OD was adjusted 600 About 0.6, concentrating to 1/2 of the original volume, standing the concentrated bacterial liquid at 4 ℃,16 ℃,25 ℃,37 ℃,42 ℃ and 56 ℃ for 30min respectively, and simultaneously carrying out the same treatment on lysase lys224 which needs to be added at the corresponding temperature. mu.L of the concentrated bacterial solution was mixed with 100. Mu.L of lysase lys224 at 100. Mu.g/mL in a 96-well plate to adjust the OD of the mixture 600 The value is about 0.6, and the final concentration of the lyase is 50 mug/mL. Mixing and rapidly placing in an enzyme-labeled instrument to determine initial A 630 Numerical value, then placing the mixed solution of bacteria and lyase under different temperature conditions for incubation, and measuring A after 1h 630 Final value, and calculate ΔA 630 Numerical values. At 100mu.L of concentrated bacterial solution and 100 mu.L of Tris-HCl mixture are used as control, and 3 groups are parallel.
As a result of measurement, as shown in FIG. 6, the enzyme lys224 was used for ΔA at a temperature of 16 ℃ 630 The value is highest, the highest cleavage activity is achieved, and the cleavage enzyme activity decreases to different degrees with increasing or decreasing temperature. The lyase lys224 has high enzyme activity at the temperature of 4 ℃,16 ℃,25 ℃ and 37 ℃ and has certain low temperature resistance.
In summary, the optimal enzymatic activity condition for lyase lys224 was ph=6, 16 ℃. And the lyase lys224 has better pH stability and low temperature resistance.
In the present specification, each embodiment is described in a progressive manner, and each embodiment is mainly described in a different point from other embodiments, and identical and similar parts between the embodiments are all enough to refer to each other.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims (1)

1. The use of streptococcus prophage lyase lys224 for the preparation of a medicament for the lysis of streptococcus agalactiae, streptococcus dysgalactiae, streptococcus suis, streptococcus equi, streptococcus pneumoniae ATCC 49619, streptococcus pyogenes ATCC 12344, staphylococcus epidermidis, staphylococcus aureus, enterococcus faecalis, aerococcus equi, listeria monocytogenes or pseudomonas aeruginosa, characterized in that the amino acid sequence of the streptococcus prophage lyase lys224 is shown in SEQ ID No. 1.
CN202310896088.9A 2023-07-21 2023-07-21 Streptococcus prophage lyase lys224 and application thereof Active CN116640754B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310896088.9A CN116640754B (en) 2023-07-21 2023-07-21 Streptococcus prophage lyase lys224 and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310896088.9A CN116640754B (en) 2023-07-21 2023-07-21 Streptococcus prophage lyase lys224 and application thereof

Publications (2)

Publication Number Publication Date
CN116640754A CN116640754A (en) 2023-08-25
CN116640754B true CN116640754B (en) 2023-10-10

Family

ID=87625064

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310896088.9A Active CN116640754B (en) 2023-07-21 2023-07-21 Streptococcus prophage lyase lys224 and application thereof

Country Status (1)

Country Link
CN (1) CN116640754B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103080307A (en) * 2010-01-25 2013-05-01 美艾利尔斯卡保罗有限公司 A25 bacteriophage lysin
CN105695440A (en) * 2016-01-14 2016-06-22 江苏大学 Bacteriostatic-activity enhanced streptococcus-suis bacteriophage elysin and preparing method thereof
US9545431B1 (en) * 2008-05-23 2017-01-17 The United States Of America, As Represented By The Secretary Of Agriculture Isolated recombinant cDNA
CN108578685A (en) * 2011-04-21 2018-09-28 洛克菲勒大学 The streptococcus bacteriophage lysin for detecting and treating for gram-positive bacteria

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8568714B2 (en) * 2008-05-23 2013-10-29 The United States Of America, As Represented By The Secretary Of Agriculture Lys K endolysin is synergistic with lysostaphin against MRSA
US8790639B2 (en) * 2012-03-28 2014-07-29 The United States Of America, As Represented By The Secretary Of Agriculture Enhanced antimicrobial lytic activity of a chimeric Ply187 endolysin
US8980614B2 (en) * 2012-09-06 2015-03-17 The United States Of America, As Represented By The Secretary Of Agriculture Staphylococcus haemolyticus prophage φSH2 endolysin is lytic for Staphylococcus aureus

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9545431B1 (en) * 2008-05-23 2017-01-17 The United States Of America, As Represented By The Secretary Of Agriculture Isolated recombinant cDNA
CN103080307A (en) * 2010-01-25 2013-05-01 美艾利尔斯卡保罗有限公司 A25 bacteriophage lysin
CN108578685A (en) * 2011-04-21 2018-09-28 洛克菲勒大学 The streptococcus bacteriophage lysin for detecting and treating for gram-positive bacteria
CN105695440A (en) * 2016-01-14 2016-06-22 江苏大学 Bacteriostatic-activity enhanced streptococcus-suis bacteriophage elysin and preparing method thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
A novel phage-encoded endolysin EN534-C active against clinical strain Streptococcus agalactiae GBS;Lucia Bocanova et al.,;Journal ofBiotechnology;第359卷;第48-58页 *
Streptococcus equi subsp. zooepidemicus Sz4is contig000001，whole genome shotgun sequence，ACCESSION JAUE01000033 REGION:76347..77792;da Piedade，I.，;Genbank;第1-2页 *

Also Published As

Publication number Publication date
CN116640754A (en) 2023-08-25

Similar Documents

Publication Publication Date Title
Swierczynski et al. Type III pilus of corynebacteria: pilus length is determined by the level of its major pilin subunit
CN111808837A (en) Staphylococcus aureus bacteriophage lyase and preparation method and application thereof
US20030170263A1 (en) Expression system
Mirza et al. Serine protease PrtA from Streptococcus pneumoniae plays a role in the killing of S. pneumoniae by apolactoferrin
Meehan et al. The fibrinogen-binding protein (FgBP) of Streptococcus equi subsp. equi additionally binds IgG and contributes to virulence in a mouse model
US10745450B2 (en) Peptides and uses thereof
CN110643612B (en) Trachinotus ovatus antimicrobial peptide NK-lysin gene and application thereof
Wang et al. Purified recombinant phage lysin LySMP: an extensive spectrum of lytic activity for swine streptococci
TWI609081B (en) USE OF LACTONE HYDROLASE AND METHOD OF DEGRADING α-ZEARALENOL USING LACTONE HYDORLASE
Rogers et al. Identification and analysis of a gene (abpA) encoding a major amylase-binding protein in Streptococcus gordonii
CN111235119B (en) Preparation and application of fusion antibacterial protein
Pilehchian et al. Fusion of Clostridium perfringens type D and B epsilon and beta toxin genes and it’s cloning in E. coli
US20180195055A1 (en) Characterization of Four Prophage Endolysins Specific for Clostridium perfringens
CN116355887A (en) Streptococcus prophage lyase lys733 and application thereof
CN116640754B (en) Streptococcus prophage lyase lys224 and application thereof
US20030113407A1 (en) Transglutaminase gene of Streptoverticillium ladakanum and the transglutaminase encoded therefrom
CN116640755B (en) Streptococcus prophage lyase lys1519 and application thereof
van der Merwe et al. Protein chimeras containing the Mycoplasma bovis GAPDH protein and bovine host-defence peptides retain the properties of the individual components
CN116855486A (en) Streptococcus prophage lyase lys1644 and application thereof
Hamilton et al. Characterization of acid phosphatase activities in the equine pathogen Streptococcus equi
CN116732014A (en) Streptococcus prophage lyase lys1459 and application thereof
JP2002503106A (en) Bacterial pheromone and its use
CN109293751B (en) Yersinia pestis virulence related protein sORF34 and coding gene and application thereof
CN111607575A (en) Transaminase PHTA, preparation method and application
AU1877900A (en) Outer surface proteins, their genes, and their use

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant