CN116602956A

CN116602956A - Regulation reagent of hexokinase 2 or c-Myc and application thereof in preparation of medicines for treating leukemia

Info

Publication number: CN116602956A
Application number: CN202310402184.3A
Authority: CN
Inventors: 宋佳蕾; 李艳梅; 刘务玲; 杨奕樱; 杨长福; 宋晶睿
Original assignee: Guizhou University of Traditional Chinese Medicine
Current assignee: Guizhou University of Traditional Chinese Medicine
Priority date: 2023-04-14
Filing date: 2023-04-14
Publication date: 2023-08-18

Abstract

The application relates to the technical field of cancer treatment medicines, in particular to a regulation reagent of hexokinase 2 (HK 2) or c-Myc and application thereof in preparation of medicines for treating leukemia. Research finds that c-Myc positively regulates the expression of HK 2; inhibition of HK2 with shRNA can block proliferation of cancer cells; toosendamide inhibits expression of c-Myc, HK2 and binding of c-Myc to HK 2. shRNA and chinaberry amide are used as regulating and controlling agents to treat related diseases taking HK2 as a target spot; or shRNA and chinaberry amide are used as c-Myc protein expression inhibitor, HK2 protein expression inhibitor, gene transcription inhibitor and c-Myc and HK2 binding retarder, and are applied to the mechanism research of occurrence and development of diseases as research tools. The technical scheme solves the technical problem that the prior art lacks medicines taking HK2 as a treatment target, and has ideal application prospect and popularization value.

Description

Regulation reagent of hexokinase 2 or c-Myc and application thereof in preparation of medicines for treating leukemia

Technical Field

The application relates to the technical field of cancer treatment medicines, in particular to a regulation reagent of hexokinase 2 (HK 2) or c-Myc and application thereof in preparation of medicines for treating leukemia.

Background

Hexokinase (HK), a key enzyme in aerobic glycolysis, plays a major role in the sugar metabolism of tumor cells, HK catalyzes the progress of the rate-limiting reaction of glycolysis, D-glucose to D-glucose-6-phosphate. There are four subtypes of HK in mammals, HK1, HK2, HK3 and HK4, respectively, with HK2 being the most active subtype in tumors. HK2 is selectively overexpressed in a variety of tumors with high glycolysis levels, including: liver cancer, non-small cell lung cancer, breast cancer, prostate cancer, leukemia, myeloma, etc. HK2 is not expressed in most adult tissues, especially liver and spleen, is expressed only in small amounts in bone marrow and peripheral blood, and exhibits high expression in cancer patient samples such as Acute Myeloid Leukemia (AML). HK2 affects several intermediary metabolic pathways, for example: glycogenesis, protein glycosylation, biosynthesis of essential nutrients (amino acids, nucleotides and fatty acids), metabolic energy balance, and the like. HK2 is also able to bind to the mitochondrial outer membrane and voltage dependent ion channels, preferentially gaining newly synthesized ATP, increasing the availability of glucose to glucose-6-phosphate conversion. Mitochondrial HK2 also protects cancer cells from deleterious stimuli by limiting the release of apoptotic factors from the mitochondrial inner membrane to the mitochondrial outer membrane, while maintaining the integrity of the mitochondrial outer membrane. HK2 is closely related to the specificity of various tumors which are actively glycolytic metabolism, and plays an important role in glycolysis, proliferation, drug resistance and other aspects of tumor cells. Studies have shown that knockout of HK2 can inhibit proliferation of liver cancer, KRas mutant non-small cell lung cancer, HER2 positive breast cancer cells, without side effects in adult mice. However, the research on the expression regulation mode of HK2in the prior art is not deep enough, and the development of drugs taking HK2 as a therapeutic target is hindered.

Disclosure of Invention

The application aims to provide a regulating reagent of HK2 or c-Myc to solve the technical problem that the prior art lacks medicines taking HK2 as a therapeutic target.

In order to achieve the above purpose, the application adopts the following technical scheme:

a modulator of HK2 and/or c-Myc, comprising shRNA and chinaberry amide.

Further, the sequence of the shRNA comprises at least one of the sequences shown as SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO. 12.

The technical scheme also provides application of the regulating reagent of HK2 and/or c-Myc in preparing a medicament taking HK2 as a therapeutic target.

Further, the medicament is a medicament for treating leukemia.

HK2 plays an important role in glycolysis, proliferation, drug resistance, etc. of various tumor cells, for example, liver cancer, non-small cell lung cancer, breast cancer, prostate cancer, leukemia, myeloma, etc. In order to facilitate the research, the technical scheme specifically selects human erythroleukemia cells (HEL cells) as a research object, takes HK2 as a drug action target spot, and researches various factors influencing the expression and transcription of the HK 2. Through bioinformatic analysis, luciferase experiments, chIP and point mutation experiments, the expression of HK2 is positively regulated by c-Myc; inhibition of HK2 expression using shRNA can block proliferation of cancer cells; the small molecule compound, chinaberry amide, inhibits the expression of c-Myc, HK2 and the binding of c-Myc to the HK2 binding domain, which impedes proliferation of cancer cells. Thus, by using shRNA or using chinaberry amide, the function of HK2 and/or c-Myc can be modulated. In particular, the use of specific shRNAs can inhibit gene transcription and protein expression of HK2, and the use of chinaberry amide can also inhibit gene transcription and protein expression of HK2, while simultaneously down-regulating expression of c-Myc protein and blocking binding between HK2 and c-Myc. Therefore, the technical scheme provides shRNA and chinaberry amide as the regulating and controlling reagent of HK2 and/or c-Myc, and the two substances can be further applied to the treatment of the related diseases taking HK2 as a target point; or shRNA and chinaberry amide are applied to the mechanism research of the occurrence and development of the diseases related to HK2, and serve as a basic scientific research tool. For example, shRNA and chinaberry amide are used for specifically inhibiting the expression of HK2, so that the change condition of the HK2 related signal channel and the response condition of cancer cells or organisms are observed. In addition, the chinaberry amide is used as a small molecular compound, is easier to administer relative to shRNA, can be directly applied, simplifies the complexity of the operation process of scientific research and study, and has more advantages.

In order to select proper shRNA, the inventor performs a large number of screening experiments, and finally discovers that one shRNA (HK 2shRNA 1) has the optimal HK2 inhibition effect. Melinamide (rocA) is isolated from plants of Meliaceae and can be used for cough, injury, asthma and inflammatory dermatoses. Toosendamide is also a potent NF- κB activation inhibitor in T cells, and is a potent selective heat shock factor 1 (HSF 1) activation inhibitor. However, in the prior art, no report about the relation between the chinaberry amide and the HK2 exists, and the chinaberry amide is a novel HK2 inhibitor.

The technical scheme also provides a leukemia cell strain using tetracycline to induce stable silencing HK2, which is obtained by transfecting human erythroleukemia cells with the shRNA.

Further, it is prepared by the following method: a double-plasmid lentivirus packaging system is selected, and a packaging cell is transfected together with a lentivirus-induced silencing vector expressing the shRNA to form a recombinant lentivirus particle; infecting leukemia cells with recombinant lentiviral particles, and screening to obtain leukemia cell lines inducing stable silencing HK 2; the two-plasmid lentiviral packaging system includes plasmids pMD2.G and psPAX2.

By adopting the technical scheme, the aim of constructing and researching the HK2 leukemia cell strain with the function of HK2 and stable silencing induction can be achieved. Specifically, a double plasmid Lentivirus packaging system (pMD 2.G and psPAX 2) is selected, packaging cells are transfected together with Lentivirus (Lentivirus) induced silencing vectors expressing HK2shRNA and Scramble shRNA to form recombinant Lentivirus particles, then the Lentivirus is used for infecting leukemia cells, and stable silencing HK2 leukemia cell lines which are induced to express by using an inducer are obtained through screening. The stable silent HK2 leukemia cell strain can reduce the expression of HK2, retard the cell cycle of leukemia cells and reduce the proliferation of leukemia cells. The implementation of the scheme is helpful for researching the role of HK2in leukemia cell occurrence and development, and also is helpful for researching the application of an HK2 inhibitor in leukemia treatment, so that references are provided for application in leukemia or other human cancer treatment.

The technical scheme also provides application of the chinaberry amide in preparing the c-Myc protein expression inhibitor.

The technical scheme also provides application of the chinaberry amide in preparing an HK2 protein expression inhibitor and an HK2 gene transcription inhibitor.

The technical scheme also provides application of the chinaberry amide in preparing a combination retarder of c-Myc protein and HK2 genes.

Further, the chinaberry amide is used to block the binding of the c-Myc protein to the first intron of the HK2 gene.

The technical scheme is shown by biological information analysis, luciferase experiment, chIP and point mutation experiment: c-Myc binds to a binding site within the first intron of HK 2; the c-Myc overexpression vector, the c-Myc siRNA and the slow virus mediated HK2 are adopted to induce and silence leukemia cell lines, and the cell level is combined with a western blot and a luciferase experiment to prove that the c-Myc can positively regulate the expression of the HK2, and the HK2 cannot feed back and regulate the expression of the c-Myc; a small molecular compound, chinaberry amide, can inhibit the expression of c-Myc and HK2 and the combination of c-Myc and HK2 binding region, and inhibit the proliferation of leukemia cells.

Therefore, the melinamide can be used as a c-Myc protein expression inhibitor, an HK2 gene transcription inhibitor and a c-Myc protein and HK2 binding blocker, and is applied in the following aspects: disease treatment with c-Myc and HK2 as therapeutic targets; drug screening with c-Myc and HK2 as therapeutic targets; as a basic scientific research tool, after the combination of the c-Myc protein and HK2 is specifically inhibited, the physiological process of the organism is observed, and the occurrence and development mechanism of the disease is revealed. The combination of c-Myc and HK2 and the regulation of the expression of HK2 are related to various physiological processes, and are not limited by the occurrence and development of leukemia and the discovery of the action effect of the chinaberry amide, thus providing a novel research tool for related basic research.

Drawings

FIG. 1 shows the results of a c-Myc and HK2 binding site study experiment of example 1 (experimental data expressed as mean.+ -. Standard deviation, n=3, ^** P＜0.01, ^* P＜0.05)。

fig. 2 is a graph of ChIP experimental verification results (experimental data expressed as mean ± standard deviation, n=3, ^** P＜0.01, ^* P＜0.05)。

fig. 3 is the results of experimental studies of examples 3-7 in which c-Myc regulates HK2 expression and affects leukemia cell proliferation (experimental data expressed as mean ± standard deviation, n=3, ^** P＜0.01, ^* P＜0.05)。

fig. 4 shows experimental results of the effect study of the melinamide effect of example 8 (experimental data expressed as mean ± standard deviation, n=3, ^** P＜0.01, ^* P＜0.05)。

Detailed Description

The present application will be described in further detail with reference to examples, but embodiments of the present application are not limited thereto. Unless otherwise indicated, the technical means used in the following examples and experimental examples are conventional means well known to those skilled in the art, and the materials, reagents and the like used are all commercially available.

Example 1: binding site study of c-Myc and HK2

(1) Predicting HK2 sequence segments containing potential binding sites for c-Myc

In order to analyze the regulation mechanism of HK2 expression in leukemia cells, a JASPER database is adopted to predict that the first intron +518- +1042 of the human HK2 contains two c-Myc binding sites, and the binding sequence is CACGTG. NCBI BLAST analyzes the sequence of the HK2 first intron region of human, chimpanzee, mouse, rat, chinese hamster, both having two c-Myc binding sites (FIGS. 1A and 1B). In FIG. 1, A is the predicted c-Myc binding site in the first intron of human HK2 from the JASPER database, shown in gray boxes; b is NCBI BLAST analysis of the two c-Myc binding sites in the HK2 first intron region of human, chimpanzee, mouse, rat, chinese hamster, as indicated by the gray boxes.

Wherein the sequence of the +518- +1042 segment of the HK2 first intron is (SEQ ID NO. 1):

GTAAGTCAGCGCGGGCGGGGCGGCAGGCTGGGCTCTGGCAAAGTGGTCTGGCCTCCATCAGTCTCTTCCTCGACCCTGCGGGGACCCGCTTCCTCCCTACTCCGGGCCTGGGAGCGGAAAAAGTTTGGGCAGCCGGGACACTCCTGGGCGCCAGGAGCCACGTCCGCTAAGCACAGCCGGCGAGTGCGCGCGGGCGGGGAGCCGAGGTCGCGCTCCGCCGGGCGCCCTCCCTCCCTGAGCTCCGGCACGCGCTCACGCTCTCTCCCCCAGTCCCTTTTTCCCTGTTACTGGAGGGGCGGGTCACCCCGCAGGTAGTCAGGGATTGCTGCGCCCACGTGGGAGGGAGCCCCCTTCTGCAGCGCGAGTTCCGGCGAGAGCACGTGGAGAGAAT CGTGGCTGCGGGAGGCTGCTCCGCTGCCGCGTGGGGCCGCCGGGGGCCGTCCGCGCTCGCGGACCGCGTGTAGGAGACGAGCGGTTCCCTTCTCCTTCCCCGCGGCCCTGCGGGGGTGGGCTCGAGGAGAAGCTG。

(2) Luciferase reporter experiments to verify binding of c-Myc to HK2 binding sequence

First, in the +518- +1042 segment of the first intron of HK2, the HK2 wild-type luciferase vector pGL3basic-HK 2intron1 was constructed. Different amounts of c-Myc coding region expression vectors pcDNA3.1 (-) -c-Myc and a wild-type luciferase vector pGL3basic-HK 2intron1 are transferred into 293T cells, and after 48 hours of transfection, the binding condition of the c-Myc and the HK2 first intron is detected by a luciferase experiment, and the expression quantity of the c-Myc is analyzed by a Western bot.

The results showed that the luciferase activity of the wild type vector pGL3basic-HK 2intron1 increased with increasing expression of C-Myc (FIGS. 1C and 1D). In FIG. 1, C is the effect of luciferase assay to determine luciferase activity from varying amounts of C-Myc and pGL3basic-HK 2intron 1; d is the expression level of c-Myc after transfection of different levels of c-Myc and pGL3basic-HK 2intron1 by Western blot. In FIG. 1, c-Myc represents the expression vector pcDNA3.1 (-) -c-Myc of the c-Myc coding region; HK2 (HK 2intron 1) in the figure represents the wild-type luciferase vector pGL3basic-HK 2intron1 (integrated with the HK2 first intron +518- +1042 segment).

(3) ChIP experiments verify the binding of c-Myc to the first intron of HK2in leukemia cells

The reaction was terminated by cross-linking human erythroleukemia cells HEL cells with formaldehyde. The cell membrane is permeabilized with the lysate, releasing the cellular components, precipitating the nucleus. The micrococcus nuclease digested chromatin fragments 150-900 bp. The c-Myc antibody (Cell Signaling Tchnology, # 9402) binds to immunomagnetic beads immunoprecipitates the target protein in the capture protein-DNA complex. Normal Rabbit IgG (Cell Signaling Tchnology, # 2729) as a negative control antibody. The chromatin-antibody-magnetic bead complex was cross-linked with 5M NaCl and Proteinase K in a water bath at 65℃and the DNA was purified by centrifugation. Real time PCR quantifies HK2intron1 in DNA and PCR detects HK2intron1 in DNA.

Wherein, the primer sequence is designed in the +825 to +911 segment (HK 2 first intron +518 to +1042 segment):

HK2 ChIP forward primer: GCAGGTAGTCAGGGATTGCT (SEQ ID NO. 2);

HK2 ChIP reverse primer: ACGATTCTCTCCACGTGCTC (SEQ ID NO. 3).

The primer sequences were designed in the-1818 to-1674 region (HK 2 first intron +518 to +1042 outwards) as follows:

HK2 ChIP Up forward primer: GGAACGTCAATGAGGAGGAA (SEQ ID NO. 4);

HK2 ChIP Up reverse primer: TGCTTGGCATTCACACTAGC (SEQ ID NO. 5).

The results indicate that C-Myc is able to bind the +825 to +911 segment within the HK2 first intron, but not the-1818 to-1674 segment outside the HK2 first intron (FIGS. 2C and 2D). In fig. 2, C and D show the following: chIP experiments detect the binding of c-Myc to +825- +911 sequences in HK2 and-1818-1674 sequences in HK2 as controls. Thus, c-Myc targets the +518 to +1042 segment downstream of the transcription initiation site of the binding HK2 promoter.

Example 2: research on influence of binding site on transcriptional control of c-Myc

This example investigated whether transcriptional regulation of HK2 by c-Myc depends on two binding sites within the first intron of HK 2. The first binding site of HK2, CACGTG, was mutated toGACATG, HK2 second binding sitePoint CACGTG mutation toGACCTG (fig. 2A). Mutant luciferase vectors pGL3basic-HK 2intron 1M 1 and pGL3basic-HK 2intron 1M 2 were constructed for the two point mutation binding sites. The point mutant type fluorogenic enzyme vector and the c-Myc expression vector pcDNA3.1 (-) -c-Myc are transiently transferred into 293T cells. Wild-type luciferase vector pGL3basic-HK 2intron1 served as a control. Luciferase assay the effect of HK2 binding sequence point mutation on c-Myc binding was examined.

The results showed that the luciferase activity of the mutant vectors pGL3basic-HK 2Intron 1M 1 and pGL3basic-HK 2Intron 1M 2 was significantly decreased compared to the wild-type luciferase vector pGL3basic-HK 2Intron1 (FIG. 2B). In FIG. 2B, c-Myc represents the c-Myc coding region expression vector pcDNA3.1 (-) -c-Myc; HK2 represents the wild-type luciferase vector pGL3basic-HK 2intron1 (incorporated with the HK2 first intron +518- +1042 segment); pcDNA3.1 represents pcDNA3.1 (-) vector; pGL3basic represents the luciferase vector pGL3 basic; HK 2M 1 represents pGL3basic-HK 2intron 1M 1 (incorporating the +518- +1042 segment of the first intron of HK2, wherein the first binding site is mutated to GACATG); HK 2M 2 represents pGL3basic-HK 2intron 1M 2 (incorporating the +518- +1042 segment of the HK2 first intron, wherein the second binding site is mutated to GACCTG). In the absence of added chinaberry amide, c-Myc and HK2intron1 bind and show stronger fluorescence intensity. While pcDNA3.1 without the c-Myc coding region showed a significant decrease in fluorescence intensity upon co-transformation with HK2intron 1.

The primer sequences used to construct the mutant vectors HK 2M 1 and HK 2M 2 for the two binding sites of HK2 were:

HK 2M 1 forward primer: TCAGGGATTGCTGCGCCGACCTGGGAGGGAGCCCCCTTCT (SEQ ID NO. 6);

HK 2M 1 reverse primer: AGAAGGGGGCTCCCTCCCAGGTCGGCGCAGCAATCCCTGA (SEQ ID NO. 7);

HK 2M 2 forward primer: GCGAGTTCCGGCGAGAGGACCTGGAGAGAATCGTGGCTGC (SEQ ID NO. 8);

HK 2M 2 reverse primer: GCAGCCACGATTCTCTCCAGGTCCTCTCGCCGGAACTCGC (SEQ ID NO. 9).

Example 3: screening and identification of shRNA effective to silence HK2in leukemia cells

(1) HK2shRNA sequence

The HK2shRNA sequence designed by the application is as follows:

CCAAAGACATCTCAGACATTGTTCAAGAGACAATGTCTGAGATGTCTTTGGTTTTTT(SEQ ID NO.10)；

CGAGCCATCCTGCAACACTTATTCAAGAGATAAGTGTTGCAGGATGGCTCGTTTTTT(SEQ ID NO.11)；

GCGCATCAAGGAGAACAAAGGTTCAAGAGACCTTTGTTCTCCTTGATGCGCTTTTTT(SEQ ID NO.12)；

the sequences are synthesized by Shandong vitamin Biotechnology company and are named as HK2shRNA 1, HK2shRNA 2 and HK2shRNA3 in sequence.

The lentivirus silencing vector is pLent-U6-shRNA-CMV-copGGFP-P2A-Puro, which is provided by Shandong Uygur biotechnology company, and the construction of the HK2shRNA lentivirus expression vector is completed.

(2) Scram shRNA sequence

The sequence of the Scram shRNA designed by the application is as follows:

GCACCCAGTCCGCCCTGAGCAAATTCAAGAGATTTGCTCAGGGCGGACTGGGTGCTTTTT(SEQ ID NO.13)；

GGCGACACCCTGGTGAACCGCATTTCAAGAGAATGCGGTTCACCAGGGTGTCGCCTTTTT(SEQ ID NO.14)；

GGCGTGCAGTGCTTCAGCCGCTATTCAAGAGATAGCGGCTGAAGCACTGCACGCCTTTTT(SEQ ID NO.15)；

GCCCACCCGCGTGACCACCCTGATTCAAGAGATCAGGGTGGTCACGAGGGTGGGCTTTTT(SEQ ID NO.16)。

the sequences are synthesized by Shandong Uygur biotechnology company and named as Scra shRNA, and are constructed in a lentiviral vector pLent-U6-shRNA-CMV-copGGFP-P2A-Puro.

(3) Drug screening for stable infected cells

After conventional lentivirus packaging and cell infection, 1 mug/mL puromycin is added for screening for 2-3 weeks, and the stable and silent HK2 leukemia cell HEL is obtained and named as HK2shRNA HEL.

(4) Identification of HK2shRNA silencing HK2 Effect

(4.1) Real time PCR identification of the Effect of HK2shRNA silencing HK2

Extracting total RNA of HK2shRNA HEL cells by a Trizol method, and carrying out reverse transcription to obtain cDNA. The relative expression level of HK2 gene in HK2shRNA HEL is detected by Real time PCR, and beta-actin gene is used as an internal reference gene.

The primers used were specifically as follows:

primer pair for amplifying HK 2:

an upstream primer: GATTTCACCAAGCGTGGACT (SEQ ID NO. 17);

a downstream primer: ACAGGTGCTCTCAAGCCCTA (SEQ ID NO. 18);

primer pairs for amplifying beta-actin:

an upstream primer: GTGACGTTGACATCCGTAAAGA (SEQ ID NO. 19);

a downstream primer: GCCGGACTCATCGTACTCC (SEQ ID NO. 20);

primer pair for amplifying HK 1:

an upstream primer: TCCTCGTCAAGACAGTGTGC (SEQ ID NO. 21);

a downstream primer: ACATTCAGACGGTCCAGTCC (SEQ ID NO. 22).

The Real time PCR results showed that HK2shRNA 1 and HK2shRNA3 significantly inhibited the mRNA levels of HK2 compared to the Scra shRNA, with HK2shRNA 1 inhibiting HK2 mRNA levels most effectively (fig. 3A). FIG. 3A shows the silencing effect of Real time PCR analysis of HK2shRNA 1, HK2shRNA 2, HK2shRNA3 in leukemia cells, wherein the statistical columns are Scra shRNA, HK2shRNA 1, HK2shRNA 2 and HK2shRNA3 in sequence from left to right.

(4.2) Western blot identification of interference effect of HK2shRNA on HK2 protein

The total protein of HK2shRNA HEL is extracted by the RIPA method, and the protein concentration, denaturation, SDS-PAGE electrophoresis and immunoblotting after electrophoresis are measured by the BCA method. Western blot results showed that HK2shRNA 1 and HK2shRNA3 significantly inhibited the protein level of HK2 compared to the Sca shRNA, with HK2shRNA 1 inhibiting the protein level of HK2 being the best (FIG. 3B). FIG. 3A shows in particular the silencing effects of HK2shRNA 1, HK2shRNA 2, HK2shRNA3 in leukemia cells by Western blot analysis (Sca shRNA as control, beta-actin as internal control).

Example 4: establishment of induced stable silenced HK2 leukemia cell lines

The HK2shRNA 1 sequence designed by the application is selected as the HK2shRNA sequence of an induction expression system to construct an induced stable silencing HK2 leukemia cell strain.

The Scram shRNA sequence of the induction expression system designed by the application is as follows:

AAGGCAGAAGTATGCAAAGCATTAGTGAAGCCACAGATGTAATGCTTTGCATACTTCTGCCTG(SEQ ID NO.23)。

the lentivirus-induced silencing vector is pLent-TRE3G-ZsGreen-mir30-hPGK-rtTA-SV40-Puro, which is provided by Shandong vitamin Biotechnology company, and the construction of HK2shRNA and Scram shRNA lentivirus-induced expression vectors is completed.

Lentiviral packaging and cell infection are conventional means in the prior art, and HK2shRNA lentiviral induction expression vector, pMD2.G plasmid, psPAX2 plasmid, lipffectamine 2000 are mixed in serum-free DMEM and added to 293T. After 48 hours of transfection, the virus-containing cell supernatant was collected into a centrifuge tube. The ratio of virus supernatant to complete medium was 1:1 onto leukemic cells, and addition of polyamine to a final concentration of 10. Mu.g/mL.

After conventional lentivirus packaging and cell infection (the third day after virus infection), 1 mug/mL puromycin is added for screening for 2-3 weeks, and the stable induction silencing HK2 leukemia cell HEL is obtained and named inHK 2shRNA HEL. The stably induced silencing control leukemia cell line was designated as inSca shRNA HEL. After induction expression time is 48 hours or 72 hours, 0.5 mug/mL tetracycline, and the effects of inHK 2shRNA HEL silencing HK2 are identified by fluorescence microscope observation, real time PCR and western blot.

Fluorescence microscopy shows that the stable silencing HK2 leukemia cell strain is successfully constructed, and green fluorescence appears after tetracycline induction for 72 hours. The mRNA and protein levels of HK2in inHK 2shRNA HEL were significantly reduced compared to inScra shRNA HEL (fig. 3D and 3G). In FIG. 3, D is the real time PCR assay of the mRNA level of HK2in inHK 2shRNA HEL cells without tetracycline induction or after 48 hours of tetracycline induction; g is the protein levels of HK2, HK1 and c-Myc in inHK 2shRNA HEL cells that were not tetracycline-induced and that were tetracycline-induced for 72 hours were determined by Western blot.

Example 5: determination of proliferation Rate of stably silenced HK2 leukemia cells

The absorbance was measured by MTT after 24 hours, 48 hours, 72 hours of proliferation of the plating stably silenced HK2 leukemia cells. The MTT assay examined the growth rate of the stably silenced HK2 leukemia cells, and the results indicate that HK2shRNA significantly inhibited the growth rate of leukemia cells (3C) compared to the Sca shRNA. The growth rate of inHK 2shRNA HEL induced by tetracycline was significantly slower than that of inScra shRNA HEL cells (3H). In fig. 3, C is the experimental result of the effect of HK2shRNA 1 on leukemia cell proliferation; h is a growth curve that induces stable silencing of HK2 leukemia cell lines.

Example 6: determination of HK2 leukemia cell cycle inducing stable silencing

After stable silencing HK2 leukemia cells are induced by tetracycline for 72 hours, the cells are collected, precooled 70% ethanol is fixed overnight, the cells are stained by PI method, a Novocyte 2040R flow cytometer is put on, software parameters of the flow cytometer are set, and the cell proportion of each stage of the cells is measured. Flow cytometry results showed that inHK 2shRNA HEL cell cycle was significantly retarded to the G0/G1 phase compared to inScramble shRNA HEL (fig. 3I). FIG. 3I shows the change in cell cycle of inHK 2shRNA HEL after 72 hours of tetracycline induction, inSca shRNA HEL as a control.

Example 7: regulation relation research of c-Myc and HK2

The construction of lentivirus-mediated HK 2-induced silent leukemia strains, after 72 hours of tetracycline induction, showed that the expression of HK2 was significantly down-regulated and the expression of HK1, c-Myc was not greatly changed (FIG. 3G). After 48 hours of tetracycline induction, real time PCR results showed significant downregulation of HK2 expression, with little change in HK1, c-Myc expression (FIG. 3D-F).

The c-Myc siRNA was transferred into leukemia cells, and the western blot results showed that the protein expression levels of c-Myc and HK2 were reduced (FIG. 3J). The c-Myc coding region expression vector pcDNA3.1 (-) -c-Myc is transferred into leukemia cells, and the western blot results show that the protein expression amounts of c-Myc and HK2 are increased (figure 3K).

In FIG. 3, G is the protein levels of HK2, HK1 and c-Myc in inHK 2shRNA HEL cells that were not tetracycline-induced and were tetracycline-induced for 72 hours; D-F is the real time PCR assay of mRNA levels of HK2 (D), HK1 (E) and c-Myc (F) in inHK 2shRNA HEL cells without tetracycline induction or after 48 hours of tetracycline induction; j is Western blot to determine the effect of c-Myc siRNA on expression of c-Myc, HK2 and HK1 after 72 hours of acting on HEL cells. K is the expression change of HK2 and HK1 after the c-Myc in HEL cells is over-expressed for 72 hours by Western blot measurement.

Example 8: effect research of chinaberry amide

Through researches, the melinamide has the effects of inhibiting the protein expression of c-Myc, reducing the expression level of HK2 and blocking the combination of c-Myc and the first intron of HK2, thereby inhibiting the expression of HK2 regulated by the c-Myc channel. The chinaberry amide can be used as a c-Myc and HK2 binding inhibitor, and further can be applied to the research of c-Myc and HK2 binding regulation pathogenic mechanism or used for treating related diseases. c-Myc binds to HK2 and modulates HK2 expression in association with a variety of physiological processes, such as vascular repair, tumors, and the like. The melinamide can inhibit the combination of c-Myc and HK2, and can be used as a potential drug for diseases related to the combination of c-Myc and HK 2. The present embodiment specifically exemplifies the inhibition of proliferation of leukemia cells, and describes the effects in detail. The melinamide can also be used as a binding inhibitor of c-Myc and HK2, and is used as a basic research tool applied to the related basic research field to explore the change condition of the associated signal path (not limited to leukemia related cells) after the binding effect between c-Myc and HK2 is inhibited, so as to further reveal the occurrence and development mechanism of diseases.

(1) Real time PCR showed that the Toosendamide (structural formula see FIG. 4A) down-regulates the mRNA level of HK2, whereas the regulation of HK1 and c-Myc was not apparent (FIGS. 4B-D). Western blot results showed that the chinaberry amide down-regulates the protein levels of c-Myc and HK2, and not HK1 (FIG. 4E). In FIG. 4, B-D is the effect of real time PCR detection of Toosendamide on HK2 (B), HK1 (C) and C-Myc (D) expression; e is Western blot to detect the effect of chinaberry amide on c-Myc, HK2 and HK1 expression.

The primer sequences used were as follows:

c-Myc forward primer: CCTACCCTCTCAACGACAGC (SEQ ID NO. 24);

c-Myc reverse primer: ACTCTGACCTTTTGCCAGGA (SEQ ID NO. 25);

HK2 forward primer: GATTTCACCAAGCGTGGACT (SEQ ID NO. 26);

HK2 reverse primer: ACAGGTGCTCTCAAGCCCTA (SEQ ID NO. 27).

(2) Melinamide inhibits binding of c-Myc to HK2in leukemia cells

The expression vector pcDNA3.1 (-) -c-Myc of the c-Myc coding region and the wild type luciferase vector pGL3basic-HK 2intron1 were transferred into 293T cells at a rate of 1.25. Mu.g/well of a 6-well plate, respectively, and the cells were transfected for 48 hours, and the cells were subjected to luciferase experiments after 16 hours of action of the Toosendamide added during transfection. The results indicated that luciferase activity was reduced after 100nM of chinaberry amide treatment of 293T cells relative to the non-chinaberry amide treated group (FIG. 2B). FIG. 2B, among other things, shows that luciferase assay detects the effect of HK2 binding sequence point mutation on c-Myc binding and that Toosendamide inhibits binding of c-Myc to HK2 binding sequence. In the case where no chinaberry amide was added, c-Myc and HK2intron1 bound and showed stronger fluorescence intensity, but after treatment with chinaberry amide, c-Myc and HK2intron1 bound and fluorescence intensity was significantly reduced. It is proved that the chinaberry amide can be used as a binding blocker of c-Myc protein and HK2 gene.

The ChIP experiments showed a significant decrease in c-Myc binding to HK2intron1 after 1 hour of 100nM of chinaberry amide treated HEL cells relative to the non-chinaberry amide treated group (fig. 4F and G). In combination with the above experimental results, it was demonstrated that the Toosendamide may cause down-regulation of HK2 by down-regulating expression of c-Myc, inhibiting binding of c-Myc to HK 2. In FIG. 4, F and G are ChIP experiments to examine the effect of treatment of chinaberry amide on binding of c-Myc to HK2intron1 in HEL.

(3) Melinamide inhibits proliferation of leukemia cells

The leukemia cells were treated with various concentrations of chinaberry amide for 1-3 days, and the experimental results showed that chinaberry amide inhibited proliferation of leukemia cells in a concentration-dependent and time-dependent manner (FIG. 4H). FIG. 4H is a growth curve of HEL cells treated with 3.125nM to 100nM of the Toosendan amide for 1-3 days. FIG. 4I shows inhibition and IC of HEL cells treated with Toosendan amide at 3.125nM to 100nM for 3 days ₅₀ 。

The foregoing is merely exemplary of the present application, and specific technical solutions and/or features that are well known in the art have not been described in detail herein. It should be noted that, for those skilled in the art, several variations and modifications can be made without departing from the technical solution of the present application, and these should also be regarded as the protection scope of the present application, which does not affect the effect of the implementation of the present application and the practical applicability of the patent. The protection scope of the present application is subject to the content of the claims, and the description of the specific embodiments and the like in the specification can be used for explaining the content of the claims.

Claims

A regulatory reagent for hk2 and/or c-Myc, comprising shRNA and chinaberry amide.
2. The HK2 and/or c-Myc regulatory reagent according to claim 1, wherein the sequence of shRNA comprises at least one of the sequences shown as SEQ ID No.10, SEQ ID No.11 and SEQ ID No. 12.
3. Use of a regulatory agent of HK2 and/or c-Myc according to claim 1 or 2 for the preparation of a medicament for targeting HK 2.
4. Use of a modulating reagent of HK2 and/or c-Myc according to claim 3 for the preparation of a medicament for the treatment of leukemia with HK2 as therapeutic target.
5. Leukemia cell line stably silenced using tetracycline induction prepared using the modulating reagent of HK2 and/or c-Myc as claimed in claim 1 or 2, characterized in that it is obtained from transfection of human erythroleukemia cells with the shRNA.
6. The leukemia cell line of claim 5, wherein the stable tetracycline-induced silencing HK2 is prepared by: a double-plasmid lentivirus packaging system is selected, and a packaging cell is transfected together with a lentivirus-induced silencing vector expressing the shRNA to form a recombinant lentivirus particle; infecting leukemia cells with recombinant lentiviral particles, and screening to obtain leukemia cell lines inducing stable silencing HK 2; the two-plasmid lentiviral packaging system includes plasmids pMD2.G and psPAX2.
7. Application of chinaberry amide in preparing c-Myc protein expression inhibitor is provided.
8. Application of chinaberry amide in preparing HK2 protein expression inhibitor and HK2 gene transcription inhibitor.
9. Application of chinaberry amide in preparing binding blocker of c-Myc protein and HK2 gene.
10. The use of the chinaberry amide according to claim 9 for preparing a binding blocker of c-Myc protein to HK2 gene, wherein chinaberry amide is used for blocking the binding of c-Myc protein to the first intron of HK2 gene.