CN116590242A - Recombinant oncolytic adenovirus and application thereof - Google Patents

Abstract

The application discloses a recombinant oncolytic adenovirus and application thereof. The genome of the recombinant human adenovirus type 4 is obtained by three modifications on the basis of the genome of the human adenovirus type 4: inserting a DNA molecule I with an expression cassette of the gene A; gene a encodes a protein with the following functions: improving the immunity and/or killing ability of the organism to tumors; replacing the original promoter of E1A with a tumor cell specific promoter; replacing the E3 region or a partial segment of the E3 region with a DNA molecule II; the DNA molecule II is provided with an shRNA gene expression cassette; the shRNA gene is transcribed to obtain shRNA, and a target gene of the shRNA codes for a protein with the following functions: involved in the development and/or progression and/or invasion of tumors. Compared with the human adenovirus type 4 before transformation, the safety of the recombinant adenovirus type 4 is greatly enhanced, the killing capacity to tumor cells is greatly enhanced, and the recombinant adenovirus type 4 can be used as an excellent anti-tumor drug.

Description

Recombinant oncolytic adenovirus and application thereof

Technical Field

The application belongs to the field of biological medicine, and relates to a recombinant oncolytic adenovirus and application thereof.

Background

Oncolytic viruses are a class of viruses with replicative capacity that can specifically kill tumor cells. It can selectively infect and replicate in tumor cells, finally lyse and kill tumor cells, release progeny virus particles to further infect surrounding tumor cells, and has no killing effect on normal body cells. Oncolytic viruses can also be used as vectors to introduce other oncogenes, thereby playing the dual roles of oncolysis and tumor inhibition. After the tumor cells are killed by oncolytic viruses, a large amount of protein factors are released to excite an immune system, so that a cold tumor is changed into a hot tumor, the immunogenicity of the tumor microenvironment is enhanced, and a wide anti-tumor immune response is initiated. Thus, oncolytic viruses or recombinant oncolytic viruses are one of the promising approaches for clinical tumor therapy.

Currently, four oncolytic viruses are available in the world. The only oncolytic virus that is widely accepted worldwide and approved by the FDA is the advancing T-VEC. The marketing of T-VECs has a milestone significance for oncolytic viruses, greatly promoting global and commercial development of oncolytic viruses. The american cancer research institute (AACR) in 2019 classified oncolytic viruses as a new immunotherapeutic approach following surgery, radiation therapy, chemotherapy and targeted therapy in its annual anticancer report. In 2020, a review Clinical landscape of oncolytic virus research in 2020 published by Journal for ImmunoTherapy of Cancer analyzed 97 independent clinical trials published in oncolytic viruses from 2000 to 2020. As a novel approach to treating malignant tumors, oncolytic viruses have achieved a phased outcome in clinical studies of various cancer treatments.

At present, 22 oncolytic virus products accepted by a drug evaluation Center (CDE) are obtained in China, and mainly comprise adenovirus, herpesvirus, coxsackie virus and the like. Among various oncolytic viruses, oncolytic adenovirus (Oncolytic Adenovirus) is favored because adenovirus vectors have the advantage of high infection efficiency and do not integrate with host cells to induce cancer, and thus are most widely used in clinical tumor biotherapy.

Adenoviruses are icosahedral symmetric, non-enveloped, double-stranded DNA viruses. Adenovirus genome is transcribed to produce mRNA, and there are at least 5 known transcription units: the E1 region is positioned on the left side of the viral genome and can be further divided into E1A and E1B, which are related to cell transformation; the E2 region encodes a DNA binding protein involved in viral replication; the E3 region encodes a glycoprotein that is present on the surface of the host cell; the E4 region is positioned at the right end of the genome and is regulated and controlled by the DNA binding protein encoded by the E2 region; the 5 th transcription unit synthesizes protein in the mid-viral infection.

Adenoviruses are divided into seven groups A-G, with human adenovirus type 4 (HAdV-E4) being the only adenovirus of group E. The human adenovirus type 4 is derived from the genome recombination event of zoonotic diseases of the adenovirus type B and the adenovirus type chimpanzee, so that the human adenovirus type 4 has no innate immunity and is suitable for being used as a treatment carrier. In recent years, research shows that pre-existing immunity aiming at the type 5 adenovirus in a human body greatly reduces the application effect of the type 5 adenovirus vector, and epidemiological investigation shows that the situation that the human body is infected with the type 5 adenovirus is very common. The pre-stored immunity level of the human type 4 adenovirus is lower, and the individual proportion of the human type 4 adenovirus neutralizing antibody is higher than 200 in China at present, which is less than 10 percent. In addition, since 1971, long-term use of adenovirus type 4 in the united states as an oral live virus vaccine was immunized into a new world, which has been fully confirmed to have good safety.

Disclosure of Invention

The application aims to provide a recombinant oncolytic adenovirus and application thereof.

The recombinant human adenovirus type 4 provided by the application is named as AD 4-GHE, and is a novel oncolytic adenovirus.

The genome of the recombinant human adenovirus 4 provided by the application is sequentially shown as the following four sections: SEQ ID NO:1, positions 2-10000 of SEQ ID NO:4 at positions 1-10000 of SEQ ID NO:5, positions 1-10000 of SEQ ID NO: bits 1-4935 in 6.

The genome of the recombinant human adenovirus type 4 is obtained by carrying out three modifications of (a 1), (a 2) and (a 3) on the basis of the genome of the human adenovirus type 4 (specifically RI67 strain):

(a1) Inserting a DNA molecule I into the human adenovirus type 4 genome; the DNA molecule I is provided with an expression cassette of a gene A; the gene A codes protein A; the protein A has the following functions: improving the immunity and/or killing ability of the organism to tumors;

(a2) Replacing the original E1A promoter in the human adenovirus type 4 genome with a tumor cell specific promoter;

(a3) Substitution of the E3 region or E3 region segment in the human adenovirus type 4 genome with DNA molecule II;

the DNA molecule II has the following (b 1) or (b 2):

(b1) An expression cassette of gene B; the gene B codes for protein B; the protein B has the following functions: improving the immunity and/or killing ability of the organism to tumors;

(b2) shRNA gene expression cassettes; the shRNA gene is transcribed to obtain shRNA, and a target gene of the shRNA is gene C; the gene C codes protein C; the protein C has the following functions: involved in the development and/or progression and/or invasion of tumors.

Specifically, the protein A is hGM-CSF.

hGM-CSF, known collectively as human granulocyte macrophage colony-stimulating factor.

Specifically, the gene A is hGM-CSF gene.

hGM-CSF gene is shown in SEQ ID NO: bits 1054-1488 of 1.

The expression cassette of the gene A sequentially comprises the following elements: CMV enhancer, CMV promoter, gene a and SV40 poly (a).

CMV enhancer as set forth in SEQ ID NO: bits 511-814 in 1.

The CMV promoter is shown in SEQ ID NO: bits 815-1018 of 1.

SV40 poly (A) is shown in SEQ ID NO:1 at positions 1624-1745.

The expression cassette of the gene A is specifically shown as SEQ ID NO: bits 511-1745 of 1.

Specifically, the tumor cell specific promoter is TERTp.

TERTp, fully known as the human telomerase reverse transcriptase promoter.

TERTp is as shown in SEQ ID NO: bits 1754-2208 in 1.

Specifically, the protein C is PD-L1.

PD-L1, known as apoptosis-Ligand 1 (programmed cell death-Ligand 1).

Specifically, the shRNA is shPD-L1 RNA.

sequence of shPD-L1 RNA: UGAUACACAUUUGGAGGAGACGUAA.

Specifically, the shRNA gene is shPD-L1 gene.

The shPD-L1 gene is shown as SEQ ID NO: bits 29342-29408 in 5.

The shRNA gene expression cassette sequentially comprises the following elements: h1 promoter, shRNA gene, 5' LTR and SV40 poly (A).

The H1 promoter is shown in SEQ ID NO:5 from 2919 to 29335.

The 5' LTR is shown in SEQ ID NO: bits 29440-29620 in 5.

SV40 poly (A) is shown in SEQ ID NO: and positions 29692-29823 in 5.

Specifically, the insertion position of the DNA molecule I is upstream of E1A.

The application also protects a DNA molecule (designated DNA molecule III) or recombinant plasmid having the genomic DNA of the recombinant human adenovirus type 4.

Specifically, the recombinant plasmid is sequentially shown as the following four sections: SEQ ID NO: 1. SEQ ID NO: 4. SEQ ID NO:5 and SEQ ID NO:6.

specifically, the DNA molecule III is a large fragment (specifically 34942 bp) obtained by carrying out AsiSI enzyme digestion on the recombinant plasmid.

The application also protects recombinant human adenovirus type 4, which is obtained by carrying out virus rescue on the DNA molecule III.

The cells used for virus rescue may specifically be AD293 cells.

The application also protects the application of the DNA molecule III or the recombinant plasmid in preparing oncolytic adenovirus.

The application also protects the application of any recombinant human adenovirus type 4 in preparing medicines;

the application of the medicine is as follows (c 1) or (c 2):

(c1) For the treatment and/or prophylaxis of cancer;

(c2) Used for killing cancer cells.

The application also protects a medicine, the components of which comprise any one of the recombinant human adenovirus type 4;

the application of the medicine is as follows (c 1) or (c 2):

(c1) For the treatment and/or prophylaxis of cancer;

(c2) Used for killing cancer cells.

Specifically, the cancer is head and neck cancer, cervical cancer, melanoma or lung cancer.

Specifically, the cancer cells are human head and neck cancer cells, human cervical cancer cells, human melanoma cells, or human lung cancer cells.

Specifically, the head and neck cancer is laryngeal cancer.

Specifically, the laryngeal carcinoma is laryngeal squamous cell carcinoma.

Specifically, the cancer cells are human laryngeal cancer cells.

Specifically, the cancer cells are human laryngeal squamous cell carcinoma cells.

The inventor carries out various engineering modification on the genome of the human adenovirus type 4 to obtain the recombinant adenovirus type 4. Compared with the human adenovirus type 4 before modification, the replication capacity of the recombinant adenovirus is obviously stronger in tumor cells than that of normal cells, and the expression of the carried tumor killing genes is increased along with the increase of virus particles and the extension of the existing time in tumors. Compared with the human adenovirus type 4 before modification, the safety of the recombinant adenovirus type 4 is greatly enhanced (namely, the toxicity to normal tissues is reduced) and the killing capacity to tumor cells is greatly enhanced (namely, the anti-tumor activity is enhanced), so that the recombinant adenovirus type 4 can be used as an excellent anti-tumor medicament.

The recombinant human adenovirus 4 provided by the application is an oncolytic virus which can be specifically replicated in tumor cells on a large scale and kill the tumor cells, and has better safety and more outstanding antitumor effect. The virus has remarkable effect on head and neck tumors, cervical cancer and other tumors, can effectively kill melanoma cells, non-small cell lung cancer and other solid tumors, and has no obvious killing effect on normal cells. The administration route is preferably local route such as intratumoral injection, arterial infusion, thoracic/abdominal infusion and bronchial instillation, and systemic (intravenous) administration has certain possibility.

The engineering of the genome of human adenovirus type 4 in the present application includes the following:

(1) The E3 region of the adenovirus genome is deleted. The adenovirus E3 region is an adenovirus unnecessary coding region, the coded protein plays an important role in avoiding epidemic monitoring, maintaining efficient replication of viruses and release of virus particles, and the deletion of the E3 region can reduce the toxic and side effects of the viruses on human bodies.

(2) The original promoter of the E1A region gene in the adenovirus genome is replaced by TERTP, and the E1A region gene transcription is started by the TERTP. Proteins expressed by the E1A region gene are essential for controlling adenovirus replication. TERTp has high transcriptional activity only in telomerase positive tumor cells, and thus proliferates on a large scale in telomerase positive tumor cells. Therefore, the modification can reduce the toxicity of the recombinant virus to normal cells and realize the purpose of attenuation.

(3) The hGM-CSF gene expression cassette was inserted upstream of the E1 region in the adenovirus genome. hGM-CSF can enhance the functions of monocytes, granulocytes, eosinophils and macrophages, thereby improving the immunity and killing ability of the organism to tumors and improving the anti-tumor and anti-infection immunity of the organism.

(4) The deleted E3 region is inserted into the encoding gene of PD-L1 shRNA in adenovirus genome. The PD-1/PD-L1 signaling pathway composed of programmed death receptor 1 (PD-1) and its Ligand PD-L1 (programmed cell death-Ligand 1) plays an important role in immunoregulation in the processes of tumor occurrence, development and invasion and metastasis. The PD-L1 shRNA can specifically reduce the expression of PD-L1, enhance the immune killing effect of human CD8+T lymphocytes on tumor cells, reverse the immune escape phenomenon of the tumor cells and enhance the treatment effect of tumors.

Drawings

FIG. 1 is a schematic representation of the elements of plasmid pAD 4-GHE.

FIG. 2 is a schematic diagram of the genome of AD 4-GHE.

FIG. 3 shows the cell morphology of AD293 cells transfected with the DNA fragments and cultured as described in example 1.

FIG. 4 is an agarose gel electrophoresis of the cleavage product of example 1.

FIG. 5 shows the results of the GM-CSF expression assay of example 1.

FIG. 6 shows the result of detecting PD-L1 by Western Blot in example 1.

FIG. 7 shows the results of the AD 4-GHE selective proliferation assay of example 2.

FIG. 8 shows the results of an experiment for specific killing of tumor cells by AD 4-GHE in example 2.

FIG. 9 is the results of the animal test in example 3.

Detailed Description

The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified. Unless otherwise indicated, the quantitative tests in the examples below were all performed in triplicate, and the results averaged. MOI value: ratio of the number of infected viruses to the number of cells. CPE: viral lesions (Cytopathogenic effect). HNSCC: squamous cell carcinoma of the head and neck (head and neck squamous cell carcinomas). AD293 cells: human kidney epithelial cells. LO2 cells: normal human hepatocytes. 2BS cells: human embryonic lung fibroblasts. C33A cells: human cervical cancer cells. A375 cells: human melanoma cells. A549 cells: human lung cancer cells. The 2BS cells are telomerase negative cells known in the art. C33A cells, a375 cells, a549 cells, are all telomerase positive cells known in the art. Complete DMEM medium: comprises 10% (volume ratio) FBS, 1% (volume ratio) penicillin/streptomycin, and the balance of DMEM culture medium.

The primary cells of head and neck cancer are primary cells obtained from tumor tissue of HNSCC patients. A method of obtaining primary cells of head and neck cancer from tumor tissue: taking tumor tissue obtained from HNSCC patient operation, removing surface blood and fat, and necrotic tissue, and cutting to about 1mm ³ -2mm ³ Size, collagenase was added to digest dissociated tissue to obtain tumor cell suspension, then erythrocytes were lysed and cell debris removed, and the remaining cells were co-cultured with mitomycin C-treated 3T3-J2 cells (complete F medium, 5% CO at 37deg.C) ₂ In an incubator) until the epithelioid cells gradually replace spindle forming fibroblasts and are close to confluence, and removing the fibroblasts by a differential digestion method to obtain primary cells of the head and neck squamous cell carcinoma. Complete F medium: comprises 0.5mg/mL hydrocortisone, 5mg/mL insulin, 10 mug/mL epidermal growth factor, 10mM Y-27632 (Roc kinase inhibitor), 8.4 mug/mL cholera toxin, 2.4mg/mL adenine, 50mg/mL Primocin (primary cell broad-spectrum antibiotic), 1% (volume ratio) Glutamax additive, 24.5% (volume ratio) Ham's F-12 culture medium, and the balance being complete DMEM culture medium. Head and neck tumors include three major parts of neck tumors, otorhinolaryngological tumors, and oral, maxillofacial tumors. Neck tumors are more common thyroid tumors; tumors of the otorhinolaryngological family commonly include laryngeal carcinoma, paranasal sinus carcinoma, and the like. Oral, maxillofacial tumors are common in various oral cancers, such as tongue cancer, gum cancer, cheek cancer, and the like. More than 90% of head and neck tumors are squamous cell carcinoma of the head and neck. Tumor tissue of the throat region was obtained from two diagnosed laryngeal squamous cell carcinoma patients, head and neck cancer primary cells were prepared as described above, and head and neck cancer primary cells obtained from two patients were designated as 66T cells and 68T cells, respectively, for differentiation.

Example 1 preparation of oncolytic adenoviruses

1. Preparation of plasmids

The plasmid pBR322-Ad4-WT has the complete genome of the wild-type human adenovirus type 4. This wild type human adenovirus type 4 was designated Ad4-WT.

Two segment substitutions were made (the DNA segment shown in SEQ ID NO:2 was replaced with the DNA molecule shown in positions 458-2214 in SEQ ID NO:1, and the DNA segment shown in SEQ ID NO:3 was replaced with the DNA molecule shown in positions 9113-9839 in SEQ ID NO: 5) using the plasmid pBR322-Ad4-WT as a starting plasmid, and the other regions were kept unchanged, to obtain a recombinant plasmid designated plasmid pAD 4-GHE. The full sequence of plasmid pAD 4-GHE is shown in the following four segments: SEQ ID NO: 1. SEQ ID NO: 4. SEQ ID NO:5 and SEQ ID NO:6. the schematic representation of the elements of plasmid pAD 4-GHE is shown in FIG. 1.

The plasmid pAD 4-GHE has recombinant human adenovirus type 4 genome, which is shown in the following four segments: SEQ ID NO:1, positions 2-10000 of SEQ ID NO:4 at positions 1-10000 of SEQ ID NO:5, positions 1-10000 of SEQ ID NO: bits 1-4935 in 6. The recombinant human adenovirus type 4 is named as AD 4-GHE (GM-CSF, HERT-E1a, delta E3, shPD-L1), and is called as AD 4-GHE for short, which is a novel oncolytic adenovirus based on human adenovirus type 4. The genomic schematic of AD 4-GHE is shown in FIG. 2.

Compared with the Ad4-WT, the AD 4-GHE has the following transformation strategy: hGM-CSF gene expression cassettes including CMV enhancer, CMV promoter, hGM-CSF gene (encoding hGM-CSF protein) and SV40 poly (A) were introduced; replacing the original promoter of E1A with TERTP; the E3 region partial segment was deleted and a shPD-L1 gene expression cassette including an H1 promoter, shPD-L1 gene (encoding shPD-L1 RNA), 5' LTR and SV40 poly (A) was inserted at this position. hGM-CSF, known collectively as human granulocyte macrophage colony-stimulating factor. TERTp, fully known as the human telomerase reverse transcriptase promoter. The shPD-L1 RNA is shRNA taking PD-L1 gene as target gene. sequence of shPD-L1 RNA: UGAUACACAUUUGGAGGAGACGUAA. sequence of shPD-L1 gene:TGATACACATTTGGAGGAGACGTAACTTCCTGTCAGATTACGTCTCCTCCAAATGTGTATCATTTTT。

SEQ ID NO: 1: nucleotides 511-814 constitute the CMV enhancer, nucleotides 815-1018 constitute the CMV promoter, nucleotides 1054-1488 constitute the hGM-CSF gene, nucleotides 1624-1745 constitute the SV40 poly (A), and nucleotides 1754-2208 constitute the TERTP. SEQ ID NO: 5: nucleotides 9119-9335 constitute the H1 promoter, nucleotides 9342-9408 constitute the shPD-L1 gene, nucleotides 9440-9620 constitute the 5' LTR, and nucleotides 9692-9823 constitute the SV40 poly (A).

Plasmid pBR322-Ad4-WT and plasmid pAD 4-GHE were prepared separately.

2. Preparation of oncolytic adenovirus AD 4-GHE

1. Plasmid pAD 4-GHE was taken and digested with restriction enzyme AsiSI to yield two DNA fragments of 3811bp and 34942bp, and the 34942bp DNA fragment was recovered.

2. And 4 mu g of the DNA fragment obtained in the step 1 and 8 mu l p of the reagent are added into 100 mu l of opti-MEM culture medium, and the mixture is kept stand at room temperature for 5min to obtain the reagent A. 12. Mu.l of Lipo3000 reagent was added to 100. Mu.l of opti-MEM medium and left to stand at room temperature for 5min, thus obtaining reagent B. And (3) uniformly mixing the reagent A and the reagent B, and standing at room temperature for 20-25min to obtain the transfection reagent with 1 culture dish dosage. The p3000 reagent and the Lipo3000 reagent are both manufactured by Invitrogen corporation.

3. AD293 cells were inoculated into 35mm dishes and cultured until the cell fusion rate reached 80%.

4. The transfection reagent prepared in the step 2 is evenly dripped into a culture dish which completes the step 3, and is cultured for 6-8 hours, then the culture medium is replaced by DMEM culture medium containing 10% FBS, the culture is carried out until the cell morphology is observed to become swollen and round and CPE is produced (about 7 days of culture is needed, the cell morphology is shown in figure 3), the cells are collected and repeatedly frozen and thawed for 3 times, and then centrifugation is carried out at 1800rpm for 5 minutes, and the supernatant is collected, namely a virus stock solution.

5. The AD293 cells are infected by a primary toxic solution (MOI value=5), the cells are cultured by a DMEM medium containing 3% FBS until CPE is observed, the whole system is repeatedly frozen and thawed for 3 times, centrifuged at 1800rpm for 5min, and the supernatant is collected, thus obtaining the AD 4-GHE virus liquid. The AD 4-GHE virus solution was used in the subsequent steps and in the subsequent examples, and PBS buffer was used to adjust the virus concentration.

3. Preparation of oncolytic adenovirus Ad4-WT

Plasmid pBR322-Ad4-WT was used in place of plasmid pAD 4-GHE, and the procedure was performed with reference to step two to obtain Ad4-WT virus liquid. Ad4-WT virus solution was used in the subsequent steps and in the subsequent examples, with PBS buffer to adjust the virus concentration.

4. Identification of viruses

1. Enzyme digestion identification and sequencing identification

Extracting genome DNA from AD 4-GHE virus liquid, and respectively adopting restriction enzymes BrsG I, hind III, kpn I, sca I and Sph I for enzyme digestion identification.

Agarose gel electrophoresis of the digested product is shown in FIG. 4. The results indicate that the viral genome is correct and complete.

The characteristic bands in the electrophoresis gel were recovered and sequenced. Sequencing results were all consistent with theoretical expectations.

The results of the above identification indicate that the whole genome of AD 4-GHE is shown in the following four segments in sequence: SEQ ID NO:1, positions 2-10000 of SEQ ID NO:4 at positions 1-10000 of SEQ ID NO:5, positions 1-10000 of SEQ ID NO: bits 1-4935 in 6.

2. GM-CSF expression analysis

(1) Inoculating A549 cells (5×10) in cell culture plates ⁵ Cells/well) were cultured overnight with DMEM medium containing 10% FBS.

(2) After the completion of the step (1), the medium was replaced with DMEM medium containing 3% FBS, AD4-GHPE virus liquid (MOI value=5) was added, followed by culturing for 48 hours, and then cell culture supernatant was collected, and the content of hGM-CSF in the cell culture supernatant was measured.

The detection of hGM-CSF was performed using Human GM-CSF Precoated ELISA Kit (Shenzhen Daida Biotechnology Co., ltd., brand "Dayou", cat No. 1117302) according to the kit instructions.

The results are shown in FIG. 5 (Dilutiong buffer R is a kit component, as a control). The hGM-CSF content of the cell culture supernatant was 1617.8pg/ml. The results show that AD 4-GHE is capable of expressing hGM-CSF in large quantities and secreting into the cell culture supernatant.

3. shPD-L1 RNA expression and functional analysis

(1) Inoculating A375 cells (5X 10) ⁵ Cells/well) were cultured overnight with DMEM medium containing 10% FBS.

(2) After the completion of the step (1), the medium was changed to DMEM medium containing 3% FBS, AD4-GHPE virus liquid (MOI value=5) was added, and then cultured for 60 hours. Control treatment (Control) was set without addition of virus liquid.

(3) After step (2) is completed, cells are collected, cell lysis is performed, and then total proteins are extracted and Western Blot (GAPDA is used as an internal reference protein) is performed. The primary antibody used by Western Blot is PD-L1 antibody, product of Abcam company, product number ab213524.

The results are shown in FIG. 6. After A375 cells are infected with AD 4-GHE, the abundance of PD-L1 protein is obviously reduced, which proves that shPD-L1 RNA carried by AD 4-GHE can specifically reduce the level of PD-L1 on the surface of tumor cells.

Example 2 cell assay

1. Virus selective proliferation assay

Test cells: 2BS cells or a549 cells.

Test virus: AD 4-GHE. The test virus dilutions were obtained by dilution of AD 4-GHE virus solution with PBS buffer.

1. Inoculating test cells (5×10) in cell culture plates ⁵ Cells/well) were cultured overnight with DMEM medium containing 10% FBS.

2. After completion of step 1, the medium was replaced with DMEM medium containing 3% fbs, the test virus dilutions (MOI values were set to 100, 10, 1, 0.1, 0.01, 0.001, 0.0001, 0.00001, 0.000001, 0.0000001, 0.00000001 or 0.000000001, respectively) were added, and then the culture supernatant was discarded after culturing for 72 hours.

3. After completion of step 2, the mixture was washed with PBS buffer, then methanol was added for 30 minutes for fixation, and then methanol was discarded.

4. After the completion of step 3, the mixture was stained with 0.2% crystal violet solution for 5 minutes, washed with sterile water and photographed.

The photographs are shown in FIG. 7 (A and B correspond to 2BS cells, two replicates; C and D correspond to A549 cells, two replicates; 12 wells from left to right in each row represent 12 MOI values from large to small). AD 4-GHE can effectively proliferate and kill cells in A549 cells, and the proliferation of the AD 4-GHE is 100 times different from that of 2BS cells.

2. Specific killing experiment of virus on tumor cells

Test cells: 66T cells or 68T cells or C33A cells or LO2 cells.

1. Inoculating test cells (5×10) in cell culture plates ⁵ Cells/well) were cultured overnight with DMEM medium containing 10% FBS.

2. After completion of step 1, the medium was changed to DMEM medium containing 3% fbs, AD4-GHPE virus solution (MOI value=5) was added, and then cultured for 72 hours. A blank (i.e. MOI value=0) was set with an equal volume of PBS buffer instead of AD4-GHPE virus solution.

3. After completion of step 2, 100. Mu.L of CCK-8 working solution was added to each well, and the mixture was incubated for 1 hour, followed by detection of absorbance at 450nm using an ELISA reader. The CCK-8 working solution is obtained by diluting CCK-8 solution to 10 times of volume. The CCK-8 solution is a component of the cell proliferation-toxicity assay kit CCK-8 (Dong's chemical technology (Shanghai) Inc.).

Cell viability = OD490 of experimental group/OD 490 of blank group.

At least three replicates were set and the results averaged.

The results are shown in FIG. 8.AD 4-GHE showed a strong killing power to 66T cells, 68T cells and C33A cells, and a much lower killing power to LO2 cells.

Example 3 animal experiments

1. Preparation of model animals

BALB/c-nu nude mice (Vetong Lihua Co.) 6-8 weeks old, each injected subcutaneously 5X 10 once ⁶ Primary cells 68T of head and neck cancer (injection site: right side of back is close to thigh), and after normal feeding for 7-14 days, tumors can be observed to grow to about 8-10mm in diameter, namely PDX tumor-bearing mice, also called model animals.

2. Group administration

The model animals were divided into three groupsEach group had 6. The first group (expressed as E3P) was injected with AD 4-GHE virus solution (injection volume 50. Mu.l/dose, virus content 5X 10 in 50. Mu.l) ⁶ PFU), the second group (E3) was injected with Ad4-WT virus (50. Mu.l/dose, 5X 10 virus in 50. Mu.l) ⁶ PFU), a third group (control group, indicated by PBS) was injected with PBS buffer (50 μl/l only). The injection site is intratumoral injection, and the injection times are single injection.

Days were noted from completion of intratumoral injection.

Tumor volumes and animal weights were measured at time 0 of intratumoral injection, day 12 of intratumoral injection and day 18 of intratumoral injection, respectively. Tumor volume (V) =1/6×pi ab ² . a is the long diameter of the tumor body, and b is the short diameter of the tumor body. Tumor volumes are shown in B of fig. 9 (n=6). Animal body weight is shown in fig. 9 at C (n=6).

Photographs of animals at day 18 of intratumoral injection are shown in fig. 9 a.

Day 18 of intratumoral injection, animals were sacrificed and tumors were excised. Cutting tumor tissue into 1mm pieces, grinding, and adding protein lysate for 10min to obtain tumor lysate. The tumor lysate was extracted for total protein and Western Blot was performed (the internal reference protein was Tubulin protein). The primary antibody used by Western Blot is PD-L1 antibody, product of Abcam company, product number ab213524.

The results show that: compared with a control group, the AD 4-GHE has obvious inhibition effect on tumor growth after being injected for 18 days, and the inhibition capability is obviously better than that of the AD4-WT; the weights of the mice in each group are not obviously different, so that the AD 4-GHE has better safety; western Blot shows that AD 4-GHE inhibits tumor PD-L1 expression.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims (10)

1. The genome of the recombinant human adenovirus type 4 is shown as the following four segments in sequence: SEQ ID NO:1, positions 2-10000 of SEQ ID NO:4 at positions 1-10000 of SEQ ID NO:5, positions 1-10000 of SEQ ID NO: bits 1-4935 in 6.

2. Recombinant human adenovirus type 4, the genome of which is obtained by three modifications of (a 1), and (a 2) and (a 3) based on the genome of human adenovirus type 4:

(a1) Inserting a DNA molecule I into the human adenovirus type 4 genome; the DNA molecule I is provided with an expression cassette of a gene A; the gene A codes protein A; the protein A has the following functions: improving the immunity and/or killing ability of the organism to tumors;

(a2) Replacing the original E1A promoter in the human adenovirus type 4 genome with a tumor cell specific promoter;

(a3) Substitution of the E3 region or E3 region segment in the human adenovirus type 4 genome with DNA molecule II;

the DNA molecule II has the following (b 1) or (b 2):

(b1) An expression cassette of gene B; the gene B codes for protein B; the protein B has the following functions: improving the immunity and/or killing ability of the organism to tumors;

(b2) shRNA gene expression cassettes; the shRNA gene is transcribed to obtain shRNA, and a target gene of the shRNA is gene C; the gene C codes protein C; the protein C has the following functions: involved in the development and/or progression and/or invasion of tumors.

3. The recombinant human adenovirus type 4 of claim 2, wherein: the protein A is hGM-CSF; the protein C is PD-L1.

4. A recombinant human adenovirus type 4 according to claim 2 or 3, wherein: the insertion position of the DNA molecule I is upstream of E1A.

5. The recombinant human adenovirus type 4 according to claim 2, 3 or 4, wherein: the tumor cell specific promoter is TERTp.

6. A DNA molecule or recombinant plasmid having the genomic DNA of the recombinant human adenovirus type 4 of any one of claims 1 to 5.

7. Recombinant human adenovirus type 4 obtained by subjecting the DNA molecule of claim 6 to viral rescue.

8. Use of the DNA molecule or recombinant plasmid of claim 6 for the preparation of oncolytic adenoviruses.

9. Use of a recombinant human adenovirus type 4 according to claim 1 or 2 or 3 or 4 or 5 or 7 for the manufacture of a medicament;

the application of the medicine is as follows (c 1) or (c 2):

(c1) For the treatment and/or prophylaxis of cancer;

(c2) Used for killing cancer cells.

10. A medicament comprising the recombinant human adenovirus type 4 of claim 1 or 2 or 3 or 4 or 5 or 7;

the application of the medicine is as follows (c 1) or (c 2):

(c1) For the treatment and/or prophylaxis of cancer;

(c2) Used for killing cancer cells.