CN116555477A

CN116555477A - Sweet corn Sh2 gene, primer combination for detecting Sh2 genotype and application

Info

Publication number: CN116555477A
Application number: CN202310612063.1A
Authority: CN
Inventors: 郑红艳; 王磊; 张兰; 邢程
Original assignee: Sanya National Academy Of Southern Propagation Chinese Academy Of Agricultural Sciences; Biotechnology Research Institute of CAAS
Current assignee: Sanya National Academy Of Southern Propagation Chinese Academy Of Agricultural Sciences; Biotechnology Research Institute of CAAS
Priority date: 2023-05-26
Filing date: 2023-05-26
Publication date: 2023-08-08

Abstract

The invention belongs to the field of genetic engineering, and provides a primer combination for detecting the Sh2 genotype of sweet corn, a kit containing the primer combination, application of the primer combination and the kit, and a method for detecting the Sh2 genotype of sweet corn. The primer combination and the method for detecting the Sh2 genotype of the sweet corn have the advantages of simplicity, convenience, rapidness and low cost, can accurately distinguish homozygous or heterozygous genotypes, realize early generation elimination of plants which do not contain the Sh2 gene, shorten the breeding period, reduce the field workload and the breeding land, improve the breeding accuracy, are an efficient and accurate breeding material identification technology capable of early obtaining the Sh2 sweet corn genotype, and can be widely applied to molecular marker-assisted selective breeding or identification of fresh corn germplasm resources Sh2 genotype.

Description

Sweet corn Sh2 gene, primer combination for detecting Sh2 genotype and application

Technical Field

The invention relates to a gene separation and nucleic acid molecule detection technology, in particular to a primer combination for detecting Sh2 gene and Sh2 genotype of sweet corn and application thereof, belonging to the field of genetic engineering.

Background

Currently, the planting area of fresh corn in China breaks through 134 ten thousand hectares, and is the first big fresh corn producing country and consuming country in the world.

Fresh corn is primarily corn for the purpose of eating fresh ears, and includes sweet corn, waxy corn and emerging sweet and waxy corn. The essential difference between fresh corn and common corn is that fresh corn carries recessive mutant genes involved in starch synthesis pathway, which causes the sugar content or starch composition in grains in milk ripening period to change, wherein sweet corn is classified into common sweet type and super sweet type. Sh2 gene-controlled super sweet corn is widely used in commercial breeding. The Sh2 gene, which codes for the large subunit of ADPglucose pyrophosphorylase and is responsible for the catalysis of glucose-1-phosphate to ADP-glucose, provides a substrate for starch synthesis, was discovered in 1953 at the earliest. The seeds are sunken and shrunken after mutation, the sugar content of the seeds in the milk ripening period is about 20-24%, which is 4 times that of common corns, and the seeds are less in water-soluble polysaccharide (WSP), fresh and sweet in taste, long in harvesting period and long in storage life.

The breeding origin of the fresh corn is early and the development is rapid. In international terms, countries such as europe and america only use sweet corn as their fresh corn, the united states is the largest sweet corn producing and consuming country in the world, and the first sweet corn variety in 1836, the early date of the dalin, and the first barrel of sweet corn can in 1931, are all born in the united states. French is the leading sweet corn producer in europe, with production of 85% of europe and quick frozen corn of 70% of europe. In recent years, thailand has greatly introduced super sweet corn varieties featuring this country, and export volume has greatly increased.

In the domestic aspect, the breeding of the sweet corn in China starts from 60 th century, and the Beijing agricultural university in 1968 breeds the first common sweet corn variety Beijing white granulated sugar. The introduction of foreign high-quality sweet corn varieties begins in the 90 s, and the focus is turned to the research of super sweet corn, and partial examined varieties even exceed the American high-quality sweet corn varieties in terms of yield and resistance. Waxy corn originates in China, but research work on waxy corn breeding is not started until the 70 th century of China, and a series of new varieties of waxy corn with high and stable yield and good quality appear successively. Sweet and waxy corn is a new type of fresh corn cultivated independently in China, and is cultivated into a first new variety of sweet and waxy fresh corn in 2004. At present, china has become the largest fresh corn producing country and consuming country worldwide.

The molecular marker (Molecular Markers) is a genetic marker based on nucleotide sequence variation among biological individuals. With the development of molecular biology, the types and methods of DNA molecular markers are continuously updated, and molecular marker assisted breeding technology is widely used for genetic breeding, and overcomes the defects of long period, complex process, low efficiency and the like in the traditional breeding. The SSR and SNP molecular markers are widely used in corn genetic breeding research work, wherein the SNP has the advantages of high density, wide distribution and the like, and is widely used in crop molecular breeding.

At present, the total planting area of the fresh corn in China is over 2000 mu, the market consumption reaches 570 hundred million ears, the market demand of the fresh corn is vigorous, the development prospect is wide, and the potential is huge. The research work of breeding the high-quality fresh corn variety is enhanced, and the method has important significance for promoting sustainable development of the fresh corn industry, increasing income of farmers and increasing efficiency of enterprises, and has important significance for further promoting development of the fresh corn industry in China and improving dietary structures of people.

Disclosure of Invention

The present invention addresses the above-identified deficiencies in the prior art by providing an isolated sweet corn Sh2 gene having a mutation of bases T to C at 215 bp.

In a preferred embodiment of the invention, the sweet corn Sh2 gene comprises the sequence shown in SEQ ID No. 19.

In another aspect, the invention provides a primer combination for detecting the Sh2 genotype of sweet corn, which comprises the primers shown in SEQ ID Nos. 20-23.

In a further preferred embodiment of the invention, the Sh2 genotype comprises wild-type Sh2Sh2, heterozygote Sh2Sh2 and mutant Sh2Sh2.

Based on the differences between the Sh2 alleles, the present invention designed primers, co-dominant markers were developed to identify wild type and mutant. The marker associated with the wild type detection was designated Sh2-M and the marker associated with the corresponding mutation site detection was designated Sh2-M.

Thus, in a further preferred embodiment of the present invention, the primer combinations shown in SEQ ID Nos. 20-21 are used to amplify the wild-type band of the Sh2 gene, and the primer combinations shown in SEQ ID Nos. 22-23 are used to amplify the mutant band of the Sh2 gene.

In another aspect, the invention provides a kit for detecting the Sh2 genotype of sweet corn, comprising the primer combination of the invention.

In another aspect, the invention provides the use of the primer combination of the invention in the detection of the Sh2 genotype of sweet corn.

In another aspect, the invention provides the use of the kit of the invention in detecting the Sh2 genotype of sweet corn.

In another aspect, the present invention provides a method for detecting the Sh2 genotype of sweet corn comprising the steps of:

1. extracting DNA of sweet corn;

2. carrying out PCR amplification on the DNA of the sweet corn obtained in the step 1 by using the primer combination;

3. and (3) analyzing the PCR amplification product obtained in the step (2), and detecting the Sh2 genotype of the sweet corn.

In yet another aspect, the present invention provides a method for detecting the Sh2 genotype of sweet corn comprising the steps of:

1. extracting DNA of sweet corn;

2. carrying out PCR amplification on the DNA of the sweet corn obtained in the step 1 by using the kit;

In a further preferred embodiment of the invention, the DNA of sweet corn is derived from seeds, leaves, etc.

The invention can distinguish the wild type, heterozygote and mutant of the super sweet corn through optimizing the PCR system and the amplification condition and simultaneously adding the primer combination of the invention for one-time PCR amplification.

Thus, in a further preferred embodiment of the invention, the wild-type Sh2Sh2 sweet corn has two bands of 702bp and 479bp, the mutant Sh2Sh2 has two bands of 702bp and 272bp, and the hybrid Sh2Sh2 has three bands of 702bp, 479bp and 272 bp.

The invention uses Sh2 genes of maize B73 and Zheng58 as reference sequences to carry out sequence analysis of Sh2 genes on 25 sweet maize inbred lines and hybrid seeds. It was found that, compared with the Sh2 sequences of common maize B73 and Zheng58, the mutation of the base at 215bp from the start codon of sweet maize coding region resulted in the variation of the Sh2 gene sequence. Further, according to sequence differences, specific PCR primers are designed, molecular markers of the Sh2 gene are developed, and the primer combination is utilized to carry out PCR amplification on fresh corn DNA, so that the Sh2 genotype of the corn to be detected can be rapidly judged.

The invention carries out PCR amplification, sequencing and sequence comparison on the full-length sequence of the Sh2 gene of the sweet corn, searches for a new SNP locus, designs a specific primer combination according to the locus, carries out molecular identification on the genotype of the sweet corn by utilizing an allele specific PCR technology, establishes a molecular auxiliary screening platform based on SNP, and lays a foundation for carrying out molecular auxiliary screening and breeding on the super sweet corn by utilizing a corn SNP molecular marker.

At present, the existing identification method and primer cannot distinguish the homozygous or heterozygous state of the Sh2 gene, and the breeding period is prolonged. Compared with the existing identification method, the method for detecting the Sh2 genotype of the sweet corn has the advantages of simplicity, convenience, rapidness and low cost, can accurately distinguish homozygous or heterozygous genotypes, realizes early-generation elimination of plants which do not contain the Sh2 gene, shortens the breeding period, reduces the field workload and the breeding land, improves the breeding accuracy, is a high-efficiency and accurate breeding material identification technology capable of early obtaining the Sh2 sweet corn genotype, can be widely applied to molecular marker-assisted selection breeding or identification of fresh corn germplasm resources Sh2 genotype, and has important significance for sweet corn germplasm innovation.

Drawings

FIG. 1 is a diagram showing the sequence alignment of 25 parts of the Sh2 gene of maize material as set forth in Table 1.

FIG. 2 is a schematic diagram showing amplification of a wild-type detection marker Sh2-M and a mutation site detection marker Sh2-M.

FIG. 3 is a graph showing the results of detection of partial sweet corn wild-type, mutant and hybrid materials using the detection markers Sh2-M and Sh2-M.

Detailed Description

The present application is further described in detail below by way of the accompanying drawings and examples. The features and advantages of the present application will become more apparent from the description.

Example 1: extraction of Total DNA

5 seeds of the test materials listed in Table 1 were taken, respectively, and 30mg was crushed and weighed by a sample grinder, and seed DNA was extracted using plant genomic DNA extraction kit (DP 305-02, https:// www.tiangen.com/content/details_40_21504. Html) from Tiangen.

The method comprises the following specific steps:

1. about 100mg of fresh tissue or about 30mg of dry tissue of the plant is taken, and is fully ground by adding liquid nitrogen.

2. The ground powder was rapidly transferred to a centrifuge tube pre-filled with 700. Mu.l of a pre-heated buffer GP1 at 65℃and mercaptoethanol was added to the pre-heated GP1 before the experiment to give a final concentration of 0.1%, and after rapid inversion and mixing, the centrifuge tube was placed in a water bath at 65℃for 20min, and the tube was inverted during the water bath to mix the samples several times.

3. Mu.l of chloroform was added thereto, and the mixture was thoroughly mixed and centrifuged at 12,000rpm (. About.13,400Xg) for 5 minutes.

If plant tissue rich in polyphenols or starch is extracted, an equal volume extraction with phenol: chloroform=1:1 can be performed before step 3.

4. The upper aqueous phase from the previous step was carefully transferred to a new centrifuge tube, 700. Mu.l of buffer GP2 was added and thoroughly mixed.

5. The well-mixed liquid was transferred to an adsorption column CB3, centrifuged at 12,000rpm (13,400Xg) for 30sec, and the waste liquid was discarded.

6. To the adsorption column CB3, 500. Mu.l of a buffer solution GD (absolute ethanol has been added), and the mixture was centrifuged at 12,000rpm (13,400Xg) for 30sec, and the waste liquid was poured off, and the adsorption column CB3 was placed in a collection tube.

7. 600 μl of the rinse solution PW (absolute ethanol added) was added to the adsorption column CB3, centrifuged at 12,000rpm (13,400Xg) for 30sec, and the waste liquid was poured off, and the adsorption column CB3 was placed in a collection tube.

8. And repeating the operation step 7.

9. The adsorption column CB3 was put back into the collection tube and centrifuged at 12,000rpm (13,400Xg) for 2min, and the waste liquid was discarded. The adsorption column CB3 was left at room temperature for several minutes to thoroughly dry the residual rinse solution in the adsorption material.

10. Transferring the adsorption column CB3 into a clean centrifuge tube, suspending and dripping 50-200 μl of elution buffer TE into the middle part of the adsorption film, standing at room temperature for 2-5min, centrifuging at 12,000rpm (13,400×g) for 2min, and collecting the solution into the centrifuge tube.

TABLE 1 basic information of test materials

Example 2: sh2 Gene full Length amplification

9 pairs of primer pairs Sh2 gene with overlapped ends are designed to amplify the full length of the gene, and the amplified gene is sent to the Optimaceae company for PCR sequencing, and the sequences of the primers are shown in Table 2:

TABLE 2 primer sequences for segmented amplification

The PCR amplification system is shown in Table 3.

TABLE 3PCR amplification System

The PCR amplification procedure was:

the amplification length, annealing temperature and extension time for each pair of amplification primers are shown in Table 4.

TABLE 4 basic information for segmented amplification

And respectively sequencing and sequence splicing the amplified products obtained by each section of amplification to obtain the full-length sequence of the Sh2 gene, wherein the full-length sequence is shown as SEQ ID NO. 19. The full length sequence of the Sh2 gene contains 9422bp altogether, covering 20 exons and 19 introns and the 3' utr region.

The specific sequence of SEQ ID NO.19 is as follows.

ATGGGCGGGCAGTGCTGTGAGTTAGAGCAGTGTGGCAGTGTTGGTGGTAGTGGTGACACCCTT

CGGGAGCGGAAAAGAGAAGAGGGAGAGGATAAGGTGATGCGAGGCAGGAAGGAGGCTGGAA

CTTCAGGTCAGTTCTATTGCCATAAATAAATAAAATAAAATAAATGAGGCTCAAAATTCCAAA

ATGTCATTTCAGCGTGTGCACCGCTTCATAAGGCCAGTCTCGTGAATCCTACAAGTTTGATGGT

ATTCTGGGCCTCGGGCATAGACCATTTATCATAAATAAGGACAATTTTGTAATTCTCTCCTTTTC

TTTTTGTTTGGGTCTGTGGAGTGCTTGTATTTGTATTTCACATGGGACTCACTTATGTTGATGTA

GTTTAGCTTGTAAAAAAGAGTAAAAACATTATTCAGTGAAGTGACGCATTGAGTTCATGATTAA

GTTTCAATTATCCTTTTTAATAGGTCCATGCCACGCTTGTATAAGGATTGAGTAAAAAAACTAA

CTTTATTACACCACAGTAGATAACAATAAGTCATATCAGTTGCATCACACAAGCACACTATTTA

CTTCTTGTTTTTGGATCAATTCTTTGGTGTCTGTAAACCCATACAACATAACTTGAATATGAACA

GCACTGCAGGGATAATTGAAACCTAGGAGTAAATAAAATGGATGTGAACGTTTCAGATTATTT

GGCATTCTGTAAAAGACCCAACACCCAAATGCTTGAAAAAAATATATCATGTTGTAAAAATTC

AATCTGCATTTCCTTCTGTAAGCAATAAAACATGGCTCTTTTAGGAATTACCTTGACAAAAAGG

TAAAATATAATATCAATAATAACTCTGCATGGGAAAAACTTATTCTTCTCTTATAATTATATCTT

AAATTTAAGTCTATGACAATGTGAAATATTTAATGCTAGTGCTACATTTTAATGTGTAATGAAA

GCACTTTCTTTTGGACATTCAAATTCTCCTTTGAAAATGATATACTCCTGTGATTCTGGTTTTTA

GGAGAATTGCATGCATGGCCTAGCGGTAGCGTTGAGATAATGAGTTAAGCTTTTAAAAGTTTCT

AATGTGAATTGTTTTTCTTTTAACTTAAATACTCATTCAGCGAAAGGTCCTCTAGCGTAATGGGT

AAGGATTCCGAGTATCACCTCTAGGTTCTGTGTTCGACCCTCATCGGGGGCGAATTTCGGGCTT

GGTTAAAAAAATACTCTCACTGTGCCCCGCCCGCTCCCGGGTTACGTTCTGCGCGCCACCCTCT

GGCTGGGCTGTTGTAAAGTGGGCGATGACGGCCCGCTAGTGATGGGGGGCAGGGGTGGACCCA

AGTACGGCTGAGTGAGGGCACATGCCCCCGCCCATTTCTTTGTTCTAAGTACTAGGGTCTAAAT

TTTCACCATGAGGCCCCCTGCTTAGTCTAATTTAGATGCCCTTGCTCTGGTATTTTGATGCTCGT

CCTTACAAGTATGCCCTTAGTCATATTTTGTCCTGGGTCCGCCCCTGATGAGAGGGGCCAGGGT

TTAGAGATTTTCTCGGCCGGGACCAATGTTCCGGTCTCTTCTTAATATAATACCGGGACAATCTT

TCCCTCTCCGGCCGAGTTTTTTATACTCACTCTAGGTGCAAACGTAAGTTGTTCAGGCTTGTGCT

TAAGGATTAAGAAAGTAAATCAAATGACCATGTTACACTTTTTTTATTTATACCGTATCGGGAA

AGATAAACCATTTATCTGTGAGTGGTAGCATGGTCAAGGAGAAAAAAATAGATGCATAGAGGT

TCTGGGACGACTCACATTTAGAGCATAGTTGAAAAGGCTAAAACAACCAGGAGGGGGTGGGGT

CGGGATACATAAATTTTCATGAGTGATGGTTGAACTATTGAGGGTGCAAAATAATTTTTTCAAC

AAATAATGTGGTGAAATACCTAAGAGGGGTGCACCTAGCATAGATTTTTTGGGGCTCCCCTTGG

CCTCTCCTTTCTTCCGCCCTGAAAACAACCTACATGGATACATCTGCAACCAGAGGGAGTATCT

GATGCTTTTTCCTGGGCAGGGAGAGCTATGAGGCGTATGTCCTCAAAGCCACTTTGCATTGTGT

GAAACCAATATCGATCTTTGTTACTTCATCATGCGTGAACATTTGTGGAAACTACTAGCTTACA

AGCATTAGTGACAGCTCAGAAAAAAGTTATCTCTGAAAGGTTTCATGTGTACCGTGGGAAATG

AGAAATGTTGCCAACTCAAACACCTTCAATATGTTGTTTGCAGGCAAACTCTTCTGGAAGAAAG

GTGTCTAAAACTATGAACGGGTTACAGAAAGGTATAAACCACGGCTGTGCATTTTGGAAGTAT

CATCTATAGATGTCTGTTGAGGGGAAAGCCGTACGCCAACGTTATTTACTCAGAAACAGCTTCA

ACACACAGTTGTCTGCTTTATGATGGCATCTCCACCCAGGCACCCACCATCACCTATCTCTCGTG

CCTGTTTATTTTCTTGCCCTTTCTGATCATAAAAAATCATTAAGAGTTTGCAAACATGCATAGGC

ATATCAATAATTCAATATGCTCATTTATTAATTTGCTAGCAGATCATCTTCCTACTCTTTACTTTA

TTTGTTGTTTGAAAAATATGTCCTGCACCTAGGGAGCTCGTATACAGTACCAATGCATCTTCATT

AAATGTGAATTTCAGAAAGGAAGTAGGAACCTATGAGAGTATTTTTCAAAATTAATTAGCGGC

TTCTATTATGTTTATAGCAAAGGCCAAGGGCAAAATTGGAACACTAACGATGGTTGGTTGCATG

AGTCTGTCGATTACTTGCAAGAAATGTGAACCTTTGTTTCTGTGCGTGGGCATAAAACAAACAG

CTTCTAGCCTCTTTTACGGTACTTGCACTTGCAAGAAATGTGAACTCCTTTTCATTTCTGTATGT

GGACATAATGCCAAAGCATCCAGGCTTTTTCATGGTTGTTGATGTCTTTACACAGTTCATCTCCA

CCAGTATGCCCTCCTCATACTCTATATAAACACATCAACAGCATCGCAATTAGCCACAAGATCA

CTTCGGGAGGCAAGTGCGATTTTGATCTCGCAGCCACCTTTTTTTGTTCTGTTGTAAGTATACTT

TCCCTTACCATCTTTATCTGTTAGTTTAATTTGTAATTGGGAAGTATTAGTGGAAAGAGGATGA

GATGCTATCATCTATGTACTCTGCAAATGCATCTGACGTTATATGGGCTGCTTCATATAATTTGA

ATTGCTCCATTCTTGCCGACAATATATTGCAAGGTATATGCCTAGTTCCATCAAAAGTTCTGTTT

TTTCATTCTAAAAGCATTTTAGTGGCACACAATTTTTGTCCATGAGGGAAAGGGAATCTGTTTT

GGTTACTTTGCTTGAGGTGCATTCTTCATATGTCCAGTTTTATGGAAGTAATAAACTTCAGTTTG

GTCATAAGATGTCATATTAAAGGGCAAACATATATTCAATGTTCAATTCATCGTAAATGTTCCC

TTTTTGTAAAAGATTGCATACTCATTTATTTGAGTTGCAGGTGTATCTAGTAGTTGGAGGAGAT

ATGCAGTTTGCACTTGCATTGGACACGAACTCAGGTCCTCACCAGATAAGATCTTGTGAGGGTG

ATGGGATTGACAGGTTGGAAAAATTAAGTATTGGGGGCAGAAAGCAGGAGAAAGCTTTGAGA

AATAGGTGCTTTGGTGGTAGAGTTGCTGCAACTACACAATGTATTCTTACCTCAGATGCTTGTC

CTGAAACTCTTGTAAGTATCCACCTCAATTATTACTCTTACATGTTGGTTTACTTTACGTTTGTCT

TTTCAAGGGAAATTTACTGTATTTTTTGTGTTTTGTGGGAGTTCTATACTTCTGTTGGACTGGTT

ATTGTAAAGATTTGTTCAAATAGGGTCATCTAATAATTGTTTGAAATCTGGGAACTGTGGTTTC

ACTGCGTTCAGGAAAAAGTGAATTCTTGGTTACTGCATGAATAACTTATGGAAATAGACCTTAG

AGTTGCTGCATGATTATCACAAATCATTGCTACGATATCTTATAATAGTTCTTTCGACCTCGCAT

TACATATATAACTGCAACTCGTAGTTGCGGTCAAAAAAAAAATGCAACTCTTAAAACGCTCACC

AGTGTAATCTTTCCTGAATTGTTATTTAATGGCATGTATGCACTACTTGTATACTTATCTAGGAT

TAAGTAATCTAACTCTAGGCCCCATATTTGCAGCATTCTCAAACACAGTCCTCTAGGAAAAATT

ATGCTGATGCAAACCGTGTATCTGCTATCATTTTGGGCGGAGGCACTGGATCTCAGCTCTTTCCT

CTGACAAGCACAAGAGCTACGCCTGCTGTAAGGGATAACACTGAACATCCAACGTTGATTACT

CTATTATAGTATTATACAGACTGTACTTTTCGAATTTATCTTAGTTTTCTACAATATTTAGTGGA

TTCTTCTCATTTTCAAGATACACAATTGAACCATAATCGAAGTGGTATGTAAGACAGTGAGTTA

AAAGATTATATTTTTTGGGAGACTTCCAGTCAAATTTTCTTAGAAGTTTTTTTGGTCCAGATGTT

CATAAAGTCGCCGCTTTCATACTTTTTTTAATTTTTTAATTGGTGCACTATTAGGTACCTGTTGG

AGGATGTTACAGGCTTATTGATATCCCTATGAGTAACTGCTTCAACAGTGGTATAAATAAGATA

TTTGTGATGAGTCAGTTCAATTCTACTTCGCTTAACCGCCATATTCATCGTACATACCTTGAAGG

CGGGATCAACTTTGCTGATGGATCTGTACAGGTGATTTACCTCATCTTGTTGATGTGTAATACTG

TAATTAGGAGTAGATTTGTGTGGAGAGAATAATAAACAGATGCCGAGATTCTTCTCTAAAAGTC

TAGATCCAAAGGCATTGTGGTTCAAAACACTATGGACTTCTACCATTTATGTTATTACTTTGCCT

TAATGTTCCATTGAATGGGGCAAATTATTGATTCTACAAGTGTTTAATTAAAAACTAATTGTTC

ATCCTGCAGGTATTAGCGGCTACACAAATGCCTGAAGAGCCAGCTGGATGGTTCCAGGGTACA

GCAGACTCTATCAGAAAATTTATCTGGGTACTCGAGGTAGTTGATATTTTCTCGTTTATGAATGT

CCATTCACTCATTCCTGTAGCATTGTTTCTTTGTAATTTTGAGTTCTCCTGTATTTCTTTAGGATT

ATTACAGTCACAAATCCATTGACAACATTGTAATCTTGAGTGGCGATCAGCTTTATCGGATGAA

TTACATGGAACTTGTGCAGGTATGGTGTTCTCTTGTTCCTCATGTTTCACGTAATGTCCTGATTT

TGGATTAACCAACTACTTTTGGCATGCATTATTTCCAGAAACATGTCGAGGACGATGCTGATAT

CACTATATCATGTGCTCCTGTTGATGAGAGGTAATCAGTTGTTTATATCATCCTAATATGAATAT

GTCATCTTGTTATCCAACACAGGATGCATATGGTCTAATCTGCTTTCCTTTTTTTCCCTTCGGAA

GCCGAGCTTCTAAAAATGGGCTAGTGAAGATTGATCATACTGGACGTGTACTTCAATTCTTTGA

AAAACCAAAGGGTGCTGATTTGAATTCTATGGTTAGAAATTCCTTGTGTAATCCAATTCTTTTGT

TTTCCTTTCTTTCTTGAGATGAACCCCTCTTTTAGTTATTTCCATGGATAACCTGTACTTGACTTA

TTCAGAAATGATTTTCTATTTTGCTGTAGAATCTGACACTAAAGCTAATAGCTACTGATGTTGCA

GAGAGTTGAGACCAACTTCCTGAGCTATGCTATAGATGATGCACAGAAATATCCATACCTTGCA

TCAATGGGCATTTATGTCTTCAAGAAAGATGCACTTTTAGACCTTCTCAAGTAATCACTTTCCTG

TGACTTTTTTCTATCCAACTCCTAGTTTACCTTCTAACAGTGTCAATTCTTAGGTCAAAATATAC

TCAATTACATGACTTTGGATCTGAAATCCTCCCAAGAGCTGTACTAGATCATAGTGTGCAGGTA

AGTCTGATCTGTCTGGAGTATGTGTTCTGTAAACTGTAAATTCTTCATGTCAAAAAGTTGTTTTT

GTTTCCAGTTTCCACTAGTTTTTATTTACCAATGCACGATTTATGTATTTTCGCTTCCATGCATCA

TACATACTAACAATACATTTTACGTATTGTGTTAGGCATGCATTTTTACGGGCTATTGGGAGGA

TGTTGGAACAATCAAATCATTCTTTGATGCAAACTTGGCCCTCACTGAGCAGGTACTCTGTCAT

GTATTCTGTACTGCATATATATTACCTGGAATTCAATGCATAGAATGTGTTAGACCATCTTAGTT

CCATCCTGTTTTCTTCAATTAGCTTATCATTTAATAGTTGTTGACTAGAATCTAAACACAAATTT

ACCTAATATGTTTCTCTCTTCAGCCTTCCAAGTTTGATTTTTACGATCCAAAAACACCTTTCTTC

ACTGCACCCCGATGCTTGCCTCCGACGCAATTGGACAAGTGCAAGGTATATGTCTTACCGAGCA

CAATTGTTACCTGAGCAAGATTTTGTGTACTTGACTTGTTCTCCTCCACAGATGAAATATGCATT

TATCTCAGATGGTTGCTTACTGAGAGAATGCAACATCGAGCATTCTGTGATTGGAGTCTGCTCA

CGTGTCAGCTCTGGATGTGAACTCAAGGTACATACTCTGCCAATGTATATGCTGATGTTTTATA

CATTCTCTTGCATAATTTGATTCGAGTCACCACAATTAGTGTAACTGCAATCTACTCTTGAGTAT

ACCATTTCAACACCAAGCATCACCAAATCACACAGAACAATAGCAACAAAGCCTTTTAGTTCC

AAGCAATTTAGGGTAGCCTAGAGTTGAAATCTAACAAAACAAAAGTCAAAGCTCTATCACGTG

GATAGTTGTTTTCCATGCACTCTTATTTAAGCTAATTTTTGGGTATACTACATCCATTTAATTATT

GTTTTATTGCTTCTTCCCTTTGCCTTTCCCCCATTACTATCGCGTCTTAAGATCATACTACGCACT

AGTGTCTTTAGAGGTCTCTGGTGGACATGTTCAAACCATCTCAATCGGTGTTGGACAAGTTTTTC

TTGAATTTGTGCTACACCTAACCTATCATGTATGTCATCGTTTCAAACTCGATCCTTCCTGTATC

ATCATAAATCCAATGCAACATACGCATTTATGCAACATTTATCTGTTGAACATGTCATCTTTTTG

TAGGTTAACATTATACACCATACAATGTAGCATGTCTAATCATCATCCTATAAAATTTACATTTT

AGCTTATGTGGTATCCTCTTGCCACTTAGAACATCATATGCTTGATGCCATTTCATCCACCCTGC

TTTGATTCTATGGCTAACATCTTCATTAATATCCTTGCCTCTCTGTATCATTGGTCCTAAATATG

GAAATACATTCTTTCTGGGCACTACTTGACCTTCCAAACTAACGTCTCCTTTGATCCTTTCTTGT

GTGTAGTAGTACCGAAGTCACATCTCATATATTCGGTTTTAGTTCTACTAAGTCCCGGGTTCGAT

CCCCCTCAGGGGTAAATTTCGGGCTTGGTAAAAAAAATCCCCTCGCTGTGTCCCGCCCTCTCTC

GGGGATCGATATCCTGCGCGCCACCCTCCGGCTGGGCATTGCAGAGTGGGCAGTTGATCGACTC

GTTAGTGATGGGGAGCGGGGTTCAAGGGTTTTCTCGGCCGGGACCATGTTTCGGTCTCTTAATA

TAATACCGGGAGGGCAGTCTTTCCCTCCCCGGTCGAGTTTTAGTTCTACTGAGTCTAAAACCTTT

GGACTCTAGAGTCCCCTGTCACAACTCACAACTCTATTTTTCTATTTACTTCTACCTAGCGTTTA

TTAATGATCACTATATCGTCTGTAAAAAGCATACACCAAGGTAATCCCCTTGTATGTCCCTTGT

AATATTATCCATCACAAGAAAAAAAAGGTAAGGCTCAAAGTTGACTTTTGATATAATCCTATTC

TAATCGAGAAGTCATCTGTATCTTCGTCTCTTGTTCGAACACTAGTCACAAATTTTTTTGTACAT

GTTCTTAATGAGTCCAACGTAATATTCCTTGATATTTTGTCATAAGCCCTCATCAAGTCAATGAA

AATCACGTGTAGGTCCTTCATTTGTTCCTTATACTGCTCCATCACTTGTCTCATTAAGAAAATAT

CTCTCATAGTTAACCTTTTGGCATGAAACAAAATCACACAGAATTTGTTTCCTTTTTTTAAGATC

CCACACAAAAGAGGTTTGATCTAAGGAATCTGGATCCCTGACAGGTTTATCAAAATCCTTTGTG

TTTTTCTTAAAACTGAATATTCCTCCAGCTTCTAGTATTGATGTAATATTCAATCTGTTTAGCAA

GTGAACACCTTGGTTCTTGTTGTTACTGTACATCCCACCCACCCCCCCGAGGCCCAGATTACCA

CAACATGAATACAAGAATATTGAACCCAGATCTAGAGTTTGTTTGTACTGTTGAAAATCGGTGA

CAATTCATTTTGTTATTGCGCTTTCTGATAACGACAGGACTCCGTGATGATGGGAGCGGACATC

TATGAAACTGAAGAAGAAGCTTCAAAGCTACTGTTAGCTGGGAAGGTCCCAGTTGGAATAGGA

AGGAACACAAAGATAAGGTGAGTATGGATGTGGAACCACCGGTTAGTTCCCAAAAATATCACT

CACTGATACCTGATGGTATCCTCTGATTATTTTCAGGAACTGTATCATTGACATGAATGCTAGG

ATTGGGAAGAACGTGGTGATCACAAACAGTAAGGTGAGCGAGCGCACCTACATGGGTGCAGA

ATCTTGTGTGCTCATCTATCCTAATTCGGTAATTCCTATCCAGCGCTAGTCTTGTGACCATGGGG

CATGGGTTCGACTCTGTGACAGGGCATCCAAGAGGCTGATCACCCGGAAGAAGGGTACTACAT

AAGGTCTGGAATCGTGGTGATCTTGAAGAATGCAACCATCAACGATGGGTCTGTCATATAGATC

GGCTGCGTGTGCGTCTACAAAACAAGAACCTACAATGGTATTGCATCGATGGATCGTGTAACCT

TGGTATGGTAAGAGCCGCTTGACAGGAAGTCGAGCGTTCGGGCGCAAGATGCGTAGTCTGGCA

TGCTGTTCCTTGACCATTTGTGCTGCTAGTATGTACTGTTATAAGCTGCCCTAGAAGTTGCAGCA

AACCTTTTTATGAACCTTTGTATTTCCATTACCTGCTTTGGATCAACTATATCTGTCATCCTATAT

ATTACTAAATTTTTACGTGTTTTTCTAA

As a result of PCR amplification, sequencing and sequence alignment analysis of the full-length sequence of the Sh2 gene in 25 parts of the maize material listed in Table 1, it was found that in the Sh2 mutant, there was a base change from T to C at 215bp of the cDNAs sequence of the Sh2 gene, resulting in the change of the encoded amino acid from methionine to threonine. In normal kernels, the locus is T, and in heterozygous kernels, the locus is in a T/C heterozygous state. See in particular table 1 and figure 1.

Example 3: molecular marker detection

Primers were designed based on the differences between the Sh2 alleles, and co-dominant markers were developed to identify wild type and mutant. The marker associated with the wild type detection was designated Sh2-M and the marker associated with the corresponding mutation site detection was designated Sh2-M. The specific sequences of the detection primers are shown in Table 5.

TABLE 5 detection primers for mutation sites

To increase primer specificity, the third and fourth last bases of Sh 2M LP and Sh 2M RP primers, respectively, are mutated and indicated in lower case in Table 5.

The design of the two pairs of label-dependent detection primers is shown in FIG. 2.

The PCR amplification system is shown in Table 6.

TABLE 6PCR amplification System

The PCR amplification procedure was:

by optimizing PCR system and amplification conditions and simultaneously adding two pairs of amplification primers Sh2-M and Sh2-M, the wild type (Sh) of the super sweet corn can be distinguished by one-time PCR amplification ₂ Sh ₂ ) Mutant (sh) ₂ sh ₂ ) And hybrids (Sh) ₂ sh ₂ ). The results of the partial material PCR amplification assay are shown in FIG. 3, in which the wild type (Sh ₂ Sh ₂ ) Super sweet corn mutant (sh) with two bands of 702bp and 479bp ₂ sh ₂ ) Has two bands of 702bp and 272bp, and a hybrid (Sh ₂ sh ₂ ) Has three bands of 702bp, 272bp and 479 bp.

The present application has been described in connection with the preferred embodiments, but these embodiments are merely exemplary and serve only as illustrations. On the basis of this, many alternatives and improvements can be made to the present application, which fall within the scope of protection of the present application.

Claims

1. An isolated sweet corn Sh2 gene having a mutation of bases T to C at 215 bp.

2. The gene according to claim 1, comprising the sequence shown in SEQ ID No. 19.

3. A primer combination for detecting the Sh2 genotype of sweet corn comprising the primers shown in SEQ ID nos. 20-23.

4. A primer combination according to claim 3, wherein the Sh2 genotype comprises wild-type Sh2Sh2, heterozygote Sh2Sh2 and mutant Sh2Sh2.

5. A primer combination according to claim 3 or 4, wherein the primer combination shown in SEQ ID nos. 20-21 is used to amplify a wild-type band of the Sh2 gene and the primer combination shown in SEQ ID nos. 22-23 is used to amplify a mutant band of the Sh2 gene.

6. A kit for detecting the Sh2 genotype of sweet corn comprising the primer combination of any one of claims 3-5.

7. Use of a primer combination according to any one of claims 3-5 or a kit according to claim 6 for detecting the Sh2 genotype of sweet corn.

8. A method for detecting the Sh2 genotype of sweet corn comprising the steps of:

(1) Extracting DNA of sweet corn;

(2) Performing PCR amplification of DNA of sweet corn obtained in step (1) with the primer combination of any one of claims 3-5 or the kit of claim 6;

(3) And (3) analyzing the PCR amplification product obtained in the step (2), and detecting the Sh2 genotype of the sweet corn.

9. The method of claim 8, wherein the DNA of sweet corn is derived from seeds, leaves, or the like.

10. A method according to claim 8 or 9, wherein wild-type Sh2Sh2 sweet corn has two bands of 702bp and 479bp, mutant Sh2 has two bands of 702bp and 272bp, and hybrid Sh2Sh2 has three bands of 702bp, 479bp and 272 bp.