CN114854902B - Wheat molecular marker 5668 and application thereof in grain hardness improvement - Google Patents
Wheat molecular marker 5668 and application thereof in grain hardness improvement Download PDFInfo
- Publication number
- CN114854902B CN114854902B CN202210744206.XA CN202210744206A CN114854902B CN 114854902 B CN114854902 B CN 114854902B CN 202210744206 A CN202210744206 A CN 202210744206A CN 114854902 B CN114854902 B CN 114854902B
- Authority
- CN
- China
- Prior art keywords
- wheat
- seq
- hardness
- molecular marker
- chromosome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Abstract
The invention discloses a molecular marker 5668 related to wheat grain hardness property, a set of KASP primer groups related to the molecular marker and application thereof, wherein the KASP primer groups comprise: an upstream primer 1 with a nucleotide sequence shown as SEQ ID NO.1, an upstream primer 2 with a nucleotide sequence shown as SEQ ID NO.2, and a downstream primer 3 with a nucleotide sequence shown as SEQ ID NO.3, wherein the primers 3 are common primers; and taking the KASP primer group as a primer, and taking a wheat genome to be detected as a template for PCR amplification, wherein when bases at corresponding sites of two chromosomes of wheat are C, the wheat seeds belong to CC genotype wheat varieties with high-hardness seed phenotype, and when bases at corresponding sites of two chromosomes of wheat are T, the wheat seeds belong to TT genotype wheat varieties with low-hardness seed phenotype.
Description
Technical Field
The invention belongs to the technical field of wheat grain hardness molecular markers, and relates to a wheat molecular marker 5668 and application thereof in grain hardness improvement.
Background
Wheat is the main food of the second large-ration crop in China and the northern people, and accounts for about 40% of the consumption of the ration in China, and is also an important raw material in the white wine brewing industry. Along with the rapid development of the economy in China, the market demands on high-quality special wheat are increasingly vigorous. Grain hardness is an important factor affecting wheat food processing and white spirit brewing quality. In the milling process, the hardness of the seeds not only affects the water adding amount of wheat, the milling energy consumption and the flour yield, but also is a key factor for determining the size of flour particles, the quantity of broken starch and the like. The high-quality strong gluten wheat grain has high hardness and the high-quality weak gluten wheat grain has low hardness. In the process of making yeast by brewing white spirit, the flour is thicker when hard wheat is used for making the flour, and a yeast blank is not easy to form and is not suitable for making the yeast; the soft wheat flour has small broken starch grains, fine flour and easy molding of the yeast blank, and is suitable for making yeast. The research shows that when equal amount of water is added, the yeast prepared from durum wheat has lower water content, low temperature in the middle and later stages of fermentation, and difficult evaporation of water, so that the moisture of the finished product yeast is higher, and the mold of the yeast is caused, and the white yeast is more. The microorganism contained in the yeast made of soft wheat is higher than that in hard wheat, which is beneficial to fermenting and producing aroma of Daqu. The practical experience of starter propagation shows that when the hardness of wheat grains is less than 60, the wheat grains are crushed to obtain small fine powder and large amount of skin, and the quality of the produced starter is high.
The hardness of wheat grains is quantitative character and is controlled by multiple genes. Two linked genes Pina and Pinb located on wheat 5Ds are major genes controlling wheat grain hardness. The grain hardness can be changed by over-expression, RNAi, gene editing Pina or Pinb. Beecher et al transferred Chinese spring wild type Pinb-D1a into durum wheat, the SKCS hardness of the receptor was reduced from 70 to 25, and the broken starch was also reduced from 3.71% to 1.69%. Nevertheless, there is a large variation in grain hardness in materials where Pina and Pinb are both wild-type. Therefore, a new wheat grain hardness control gene is mined, corresponding molecular markers are developed and used for accurately designing the wheat hardness, and the method has important significance for breeding of high-quality wheat and special wheat varieties for brewing.
Disclosure of Invention
In order to overcome the defects in the prior art, the invention further develops the application of the specific primer combination for identifying the site in the screening of the wheat grain hardness property by combining the wheat grain hardness measurement and statistics of different wheat varieties in China and the complete genome association analysis (GWAS) identification result, screening and identifying a remarkable site 5668 affecting the wheat grain hardness and combining the KASP technical principle.
The first aspect of the invention provides a substance for detecting the hardness of wheat grains, which is a set of primers or a detection reagent or a kit containing the set of primers, wherein the set of primers is used for detecting that the 36 th deoxyribonucleotide of the molecular marker 5668 shown in SEQ ID No.4 on chromosome 1B in a wheat genome is CC, TT or CT.
CGATCAGCAACCTCCCCGATGGCGCTGACTCTGTGRGGCCTTTTTCCCGGTGATGCACCCTGGTGACGGGG (SEQ ID No. 4), wherein R in position 36 represents [ C/T ].
In certain embodiments, the set of primers comprises two upstream primers and one downstream primer; the upstream primer is designed according to the 36 th deoxyribonucleotide of the gene fragment shown in SEQ ID No.4 on chromosome 1B in the wheat genome and the upstream sequence thereof, wherein the 3 'terminal deoxyribonucleotide of one upstream primer is T, and the 3' terminal deoxyribonucleotide of the other upstream primer is C; the downstream primer is designed according to the downstream sequence of the 36 th deoxyribonucleotide of the gene fragment shown in SEQ ID No.4 on chromosome 1B in the wheat genome.
In certain embodiments, the set of primers is a set of primers consisting of the single stranded DNA molecule shown at positions 22-42 of SEQ ID No.1 or a derivative thereof, the single stranded DNA molecule shown at positions 22-42 of SEQ ID No.2 or a derivative thereof, and the single stranded DNA molecule shown at SEQ ID No. 3.
In certain embodiments, the derivative of the single-stranded DNA molecule shown at positions 22-42 of SEQ ID No.1 is a single-stranded DNA molecule shown at positions 22-42 of SEQ ID No.1, the 5' end of which is linked to a specific fluorescent tag sequence A; the derivative of the single-stranded DNA molecule shown in the 22 th-42 th positions of the SEQ ID No.2 is that the 5' end of the single-stranded DNA molecule shown in the 22 nd-42 th positions of the SEQ ID No.2 is connected with a specific fluorescent tag sequence B.
In certain embodiments, the specific fluorescent tag sequence a is a fluorescent tag sequence FAM and the specific fluorescent tag sequence B is a fluorescent tag sequence HEX.
In certain embodiments, the sequence of the upstream primer is shown in SEQ ID No.1 and SEQ ID No.2, respectively, and the sequence of the downstream primer is shown in SEQ ID No. 3.
In another aspect the invention provides the use of a substance as described above in any of the following:
(A) Identifying or assisting in identifying the hardness character of the wheat seeds;
(B) Comparing the hardness of the wheat grains to be tested;
(C) Selecting or screening single wheat plants or lines or strains or varieties with relatively high grain hardness;
(D) Selecting or screening single wheat plants or lines or strains or varieties with relatively low grain hardness;
(E) Preparing a product for identifying or assisting in identifying or comparing the hardness of wheat grains to be tested;
(F) Preparing a product for breeding or screening single wheat plants or lines or strains or varieties with relatively high grain hardness;
(G) The method is used for preparing products for breeding or screening single plants or strains or varieties of wheat with relatively low grain hardness.
In another aspect of the invention, there is provided any of the following methods:
method A: a method for comparing the hardness of wheat grain to be tested, comprising the following steps (A1) or (A2):
(A1) Detecting whether 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the wheat genome is CC or TT or C and T;
(A2) The wheat grain hardness to be tested was determined as follows: the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the genome is homozygote of C, and the grain hardness of the wheat to be detected is higher than that of the wheat to be detected, wherein the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the genome is homozygote of T or heterozygote of T and C;
method B: a method for breeding or screening single plants or strains or varieties of wheat with relatively high grain hardness comprises the following steps:
(B1) Detecting whether 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the wheat genome is CC or TT or C and T;
(B2) Selecting wheat to be detected, of which the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the genome is homozygote of C, as a parent for breeding, and selecting wheat of which the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in each generation of breeding is homozygote of C, so as to finally obtain a wheat single plant or strain or variety with relatively high grain hardness;
method C: a method for breeding or screening single plants or strains or varieties of wheat with relatively low grain hardness comprises the following steps:
(C1) Detecting whether 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the wheat genome is CC or TT or C and T;
(C2) Selecting wheat to be detected, of which the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the genome is a homozygote of T, as a parent for breeding, and selecting wheat of which the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in each generation of breeding is a homozygote of T, so as to finally obtain a wheat single plant or strain or variety with relatively low grain hardness.
In some embodiments, the specific operations of (A1), (B1) and (C1) are that the detection reagent or kit of the present invention is used to amplify the genomic DNA of the wheat to be detected, the amplified product is subjected to fluorescent signal scanning, the scanned data is analyzed, and then whether the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the wheat gene to be detected is CC, TT, C and T is determined as follows:
if the fluorescence signal data of the amplification product of the wheat to be detected shows blue, the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the genome of the wheat to be detected is a homozygote of T;
if the fluorescence signal data of the amplification product of the wheat to be detected shows yellow, the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the genome of the wheat to be detected is a homozygote of C;
if the fluorescence signal data of the amplified product of the wheat to be tested is green, the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the genome of the wheat to be tested is a hybrid of C and T.
In certain embodiments, the PCR amplification is specifically,
in the primer group combination, the upstream primer 1: the upstream primer 2: the downstream primer = 12:12:30; the PCR reaction procedure was: 95 ℃ for 15min;95 ℃, 20s,65 ℃ 655 ℃ for 1min;94 ℃, 20s,57 ℃, 1min,30 cycles; 37℃for 1min.
The 5. Mu.L amplification system can be designed as follows:
the Primer Mix, per 100 μl:
upstream primer 1 (F1), 10. Mu.M, 12. Mu.L;
upstream primer 2 (F2), 10. Mu.M, 12. Mu.L;
a downstream primer (R), 10uM, 30 uL;
ddH 2 O，46μL。
compared with the prior art, the method provided by the invention has the advantages that a remarkable site 5668 influencing the hardness of the wheat grains is screened and identified, and the site is remarkably related to the hardness character of the wheat grains. Preliminary research results show that TT genotypes have the advantage of low hardness phenotype. Based on the locus and by combining with the KASP technical principle, the invention further develops a specific primer combination for identifying the locus, and the specific primer combination can be used for detecting the grain hardness character of the wheat to be detected, and screening and breeding wheat varieties with high hardness character or low hardness character, so that a certain theoretical basis and a technical basis can be laid for the identification of the grain hardness character of the wheat and the cultivation of new varieties of soft wheat.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments will be briefly described below.
FIG. 1 is a full genome correlation analysis 1BL significance map;
FIG. 2 shows the genotyping results of the 5668 locus wheat genotype; wherein CC represents 5668-C, TT represents 5668-T, CK represents template-free control, namely, ultrapure water is used for replacing sample DNA, and whether sample pollution occurs in an experiment is detected;
FIG. 3 is a box plot of 5668 different genotypes.
Detailed Description
Embodiments of the technical scheme of the present invention will be described in detail below with reference to the accompanying drawings. The following examples are only for more clearly illustrating the technical aspects of the present invention, and thus are merely examples, which should not be construed as limiting the scope of the present invention. It is noted that unless otherwise indicated, technical or scientific terms used herein should be given the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.
Wheat material: the related wheat varieties (lines) in the following examples are all provided by the institute of wheat at the academy of agricultural sciences in Henan province, and the related wheat is sown in Henan New county (original yang, laboratory base at the academy of agricultural sciences in Henan province), harvested after physiological maturation (harvesting samples of different tissues at different growth stages in the meantime, and freezing and preserving in a laboratory for later analysis).
The applicant has long stored relevant germplasm materials as a professional agricultural research institution, and relevant wheat varieties are all publicly available in the market or in the existing germplasm banks.
Example 1
In order to obtain the wheat grain hardness regulation genes, in combination with the prior art, firstly, the hardness phenotype conditions of different wheat varieties planted continuously for three years are measured based on a wheat grain hardness measurement method (single grain characteristic measuring instrument method, single kernel characterization system, SKCS) so as to preliminarily determine the hardness phenotype differences of the wheat grains. See table 1, infra.
It should be explained that the specific wheat grain hardness measurement method can be referred to as the following operations:
after the harvested wheat seeds in the mature period are naturally dried in the sun, 300 complete seeds without problems of half grains or insect eyes and the like are selected, poured into a single grain hardness tester SKCS (model Perten SKCS 4100), the tester is operated, and the hardness data of the sample are obtained through measurement.
Example 2
Based on the hardness phenotype data obtained by the measurement of example 1, two significant sites affecting wheat grain hardness (1 BL: 572152983-573860794), (1 BL:572638947-572639017 bp) were identified using the whole genome association analysis (GWAS) method (see FIG. 1 for partial results), and the two sites were respectively named: 5668. 5668-1.
The specific procedure for obtaining the above loci by using the whole genome association analysis (GWAS) method is as follows:
genome-wide association analysis (GWAS) is a new approach to complex trait research developed in recent years. In the past few years, a large number of researchers at home and abroad develop the GWAS on the aspects of disease resistance, stress resistance, nutrition quality, processing quality and the like of wheat. These studies not only greatly enrich the molecular markers available in wheat marker-assisted selection breeding, but also provide important clues for the molecular mechanism exploration and study of these traits. The invention utilizes the Wheat660K SNP chip to genotype 207 parts of related population materials, and quality control is carried out on the typing result to obtain 224,706 SNP markers with high quality. And (3) carrying out group STRUCTURE analysis by utilizing STRUCTURE software according to the parting result, carrying out principal component analysis by using Plink software, and obtaining a genetic relationship matrix. The affinity K matrix was calculated using the Kinship in Tassel v5.0 software, and the correlation analysis between phenotype and marker was performed using the q+k mixed linear model MLM in Tassel v5.0 software, with the threshold set at-log 10 (P) >4. Analysis results show that the SNP locus 5668 on the 1B chromosome, which is commonly identified by the hardness data (specific methods are shown in example 1) under the same environment for many years (2019, 2020 and 2021), is a stable genetic locus affecting the hardness of wheat grains, and the phenotype contribution rate is 8.25-12.17%.
After further analysis, it can be seen that the two significant sites affecting wheat grain hardness obtained by identification should be identical sites, namely, the wheat molecular marker 5668, the length of the full-length sequence of which is 71bp, and a C/T mutation at the 36 th site of the sequence.
The specific sequence of the wheat molecular marker 5668 is as follows:
CGATCAGCAACCTCCCCGATGGCGCTGACTCTGTGRGGCCTTTTTCCCGGTGATGCACCCTGGTGACGGGG (SEQ ID No. 4), wherein R represents [ C/T ].
Based on the sequence difference and KASP principle, the primer group for PCR amplification to obtain the wheat molecular marker is further developed and designed, and the specific design is as follows:
5668-F1：5’-GAAGGTGACCAAGTTCATGCTCCGATGGCGCTGACTCTGTGC-3 '(SEQ ID No. 1), (5' end "GAAGGTGACCAAGTTCATGCT" partial sequence being the FAM marker sequence)
5668-F2：5’-GAAGGTCGGAGTCAACGGATTCCGATGGCGCTGACTCTGTGT-3’(SEQ ID No.2)，
(5' end "GAAGGTCGGAGTCAACGGATT" part sequence is HEX marker sequence)
5668-R：5’-GGGTCAAGGCAGGTGACTGAAG-3’(SEQ ID No.3)；
When 5668-F1 and 5668-R are used as primer pairs for combination, the sequence with the 36 th base of C in the wheat molecular marker is amplified;
when 5668-F2 and 5668-R are used as primer pairs, the primer pairs are used for amplifying a sequence with the 36 th base of the wheat molecular marker being T.
Example 3
Based on the primer set design of example 2, genotypes of 207 parts of wheat material were detected, and the correlation between genotypes and hardness phenotypes was identified, as follows.
Firstly, respectively extracting genome DNA of each wheat variety;
then, PCR (BIO-RAD fluorescent quantitative PCR apparatus CFX ConnectTM Real-Time System) was performed on different wheat samples using the above-described DNA as a template according to the primers designed in example 2, and the 36 th nucleotide sequence was finally determined.
For a specific PCR amplification, a 5. Mu.L amplification system can be designed as follows:
KASP Mix(2X)，2.5μL；
Primer Mix，0.7μL；
MgCl 2 ，0.04μL；
DNA，30ng；
ddH 2 o, make up to 5 μl;
the Primer Mix, per 100 μl:
5668-F1，10uM、12μL；
5668-F2，10uM、12μL；
5668-R，10uM、30μL；
ddH 2 O，46μL；
the PCR reaction procedure is referenced (appropriately adjusted according to the amplification result) as follows:
95 ℃ for 15min;95 ℃, 20s,65 ℃ 655 ℃ for 1min (10 cycles, each cycle reduced by 1 ℃); 94 ℃, 20s,57 ℃, 1min,30 cycles; 37℃for 1min.
The specific genotypes and wheat hardness statistics are shown in table 1 below and in fig. 2 and 3.
TABLE 1 genotype of different wheat varieties and corresponding results of grain hardness
Further statistical analysis was performed on the results of the above table, and the results are shown in table 2 below.
TABLE 2 average value of hardness index T test results for molecular markers 5668
Based on the above statistics, it can be seen that: the grain hardness of CC genotype wheat is 50.6 on average; grain hardness of TT genotype wheat was 41.2 on average. The grain hardness of CC genotype wheat is significantly higher than that of TT genotype wheat, differing by 22.8%, and significant difference in p <0.01 level. That is, the grain hardness of CC genotype wheat is significantly higher than TT genotype wheat. Meanwhile, the grain hardness of the heterozygous CT genotype wheat is only 37.8 on average.
Based on the results, on one hand, by using the designed primer pair, the hardness characteristics of the wheat seeds can be accurately judged by detecting specific sites, so that a foundation can be laid for molecular breeding technology application; on the other hand, based on the locus, a certain technology and theoretical basis can be laid for cultivating new varieties of wheat with different hardness, and the novel wheat strain has better technical significance for improving the processing performance of related wheat.
The numerical values set forth in these examples do not limit the scope of the present invention unless specifically stated otherwise. In all examples shown and described herein, unless otherwise specified, any particular value is to be construed as exemplary only and not as limiting, and thus, other examples of exemplary embodiments may have different values.
SEQUENCE LISTING
<110> molecular breeding institute for crop in Henan province
<120> wheat molecular marker 5668 and application thereof in grain hardness improvement
<130> 202206
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 42
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 1
gaaggtgacc aagttcatgc tccgatggcg ctgactctgt gc 42
<210> 2
<211> 42
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 2
gaaggtcgga gtcaacggat tccgatggcg ctgactctgt gt 42
<210> 3
<211> 22
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 3
gggtcaaggc aggtgactga ag 22
<210> 4
<211> 71
<212> DNA
<213> Artificial sequence (artificial sequence)
<220>
<221> misc_feature
<222> (36)..(36)
<223> r is a base C/T
<400> 4
cgatcagcaa cctccccgat ggcgctgact ctgtgrggcc tttttcccgg tgatgcaccc 60
tggtgacggg g 71
Claims (4)
1. The use of a substance for detecting the hardness of wheat kernels, characterized in that,
the substance is a set of primers or a detection reagent or a kit containing the set of primers, wherein the set of primers is used for detecting whether the 36 th genotype of the molecular marker 5668 shown in SEQ ID No.4 on chromosome 1B in a wheat genome is CC, TT or CT, the set of primers contains an upstream primer 1, an upstream primer 2 and a downstream primer, the sequence of the upstream primer 1 is shown in SEQ ID No.1, the sequence of the upstream primer 2 is shown in SEQ ID No.2, and the sequence of the downstream primer is shown in SEQ ID No. 3;
the application is specifically as follows:
(A) Identifying or assisting in identifying the hardness character of the wheat seeds;
(B) Comparing the hardness of the wheat grains to be tested;
(C) Selecting or screening single wheat plants or lines or strains or varieties with relatively high grain hardness;
(D) Selecting or screening single wheat plants or lines or strains or varieties with relatively low grain hardness;
(E) Preparing a product for identifying or assisting in identifying or comparing the hardness of wheat grains to be tested;
(F) Preparing a product for breeding or screening single wheat plants or lines or strains or varieties with relatively high grain hardness;
(G) The method is used for preparing products for breeding or screening single plants or strains or varieties of wheat with relatively low grain hardness.
2. The method comprises the following steps:
method A: a method for comparing the hardness of wheat grain to be tested, comprising the following steps (A1) or (A2):
(A1) Detecting whether the 36 th genotype of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the wheat genome is CC or TT or CT;
(A2) The wheat grain hardness to be tested was determined as follows: the grain hardness of the wheat to be detected is higher than that of the wheat to be detected, wherein the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the genome is homozygote of C, and the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the genome is homozygote of T or heterozygote of T and C;
method B: a method for breeding or screening single plants or strains or varieties of wheat with relatively high grain hardness comprises the following steps:
(B1) Detecting whether the 36 th genotype of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the wheat genome is CC or TT or CT;
(B2) Selecting wheat to be detected, of which 36 th deoxyribonucleotide of a molecular marker shown in SEQ ID No.4 on chromosome 1B in a genome is homozygote of C, as a parent for breeding, and selecting wheat of which 36 th deoxyribonucleotide of a molecular marker shown in SEQ ID No.4 on chromosome 1B in each generation of breeding is homozygote of C, so as to finally obtain a wheat single plant or strain or variety with relatively high grain hardness;
method C: a method for breeding or screening single plants or strains or varieties of wheat with relatively low grain hardness comprises the following steps:
(C1) Detecting whether 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the wheat genome is CC or TT or CT;
(C2) Selecting the wheat to be detected, of which the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the genome is a homozygote of T, as a parent for breeding, and selecting the wheat of which the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in each generation of breeding is a homozygote of T, thereby finally obtaining the wheat single plant or strain or variety with relatively low grain hardness.
3. The method according to claim 2, wherein the (A1) (B1) (C1)
In particular, the operation is carried out in such a way that,
PCR amplification is carried out on the genomic DNA of wheat to be detected by using the detection reagent or the kit according to claim 1, and whether the 36 th deoxyribonucleotide shown as SEQ ID No.4 on chromosome 1B in the wheat gene to be detected is CC, TT, C and T is determined according to the amplified product.
4. The method according to claim 3, wherein the PCR amplification is specifically,
in the primer group combination, the upstream primer 1: the upstream primer 2: the downstream primer = 12:12:30; the PCR reaction procedure was: 95 ℃ for 15min;95 ℃, 20s,65 ℃ to 55 ℃ for 1min;94 ℃, 20s,57 ℃, 1min,30 cycles; 37℃for 1min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210744206.XA CN114854902B (en) | 2022-06-27 | 2022-06-27 | Wheat molecular marker 5668 and application thereof in grain hardness improvement |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210744206.XA CN114854902B (en) | 2022-06-27 | 2022-06-27 | Wheat molecular marker 5668 and application thereof in grain hardness improvement |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114854902A CN114854902A (en) | 2022-08-05 |
| CN114854902B true CN114854902B (en) | 2023-05-05 |
Family
ID=82625988
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210744206.XA Active CN114854902B (en) | 2022-06-27 | 2022-06-27 | Wheat molecular marker 5668 and application thereof in grain hardness improvement |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114854902B (en) |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101798596B (en) * | 2010-03-19 | 2012-05-16 | 河南农业大学 | Aided identification method of wheat with good characteristics |
| CN102382895B (en) * | 2011-12-02 | 2013-07-24 | 新疆农垦科学院 | PCR system for identifying or assisting in identifying genes of wheat for Sinkiang stretched noodle quality |
| CN111411168B (en) * | 2020-05-07 | 2022-08-16 | 中国农业科学院作物科学研究所 | Screening method for breeding parent variety of high-quality wheat and primer group combination used by same |
| CN112273221B (en) * | 2020-11-05 | 2022-09-30 | 南京农业大学 | Breeding method of high-hardness wheat |
| CN114480698B (en) * | 2021-12-15 | 2023-08-22 | 江苏里下河地区农业科学研究所 | Molecular marker related to wheat set spike number and/or grain hardness characteristics and application |
-
2022
- 2022-06-27 CN CN202210744206.XA patent/CN114854902B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114854902A (en) | 2022-08-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109762812B (en) | Wheat growth potential related SNP and application thereof as target point in identification of wheat growth potential traits | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN111394508B (en) | Molecular marker linked with capsicum frutescens gene and application thereof | |
| CN110777216B (en) | Method for identifying purity of Jingke waxy 2000 corn hybrid based on SNP marker | |
| CN110157833B (en) | Method for detecting high-lysine corn and special molecular marker thereof | |
| CN110527742B (en) | KASP marker related to wheat spike length under low salt condition and application thereof | |
| CN114854902B (en) | Wheat molecular marker 5668 and application thereof in grain hardness improvement | |
| JP4450856B2 (en) | Barley variety identification method and barley variety with excellent brewing quality | |
| CN114480698B (en) | Molecular marker related to wheat set spike number and/or grain hardness characteristics and application | |
| CN113197089B (en) | Breeding method facilitating early generation selection of soft weak gluten wheat | |
| CN111849999B (en) | Rice GS3 mutant gene, molecular marker and application thereof | |
| CN116555467A (en) | KASP marker related to wheat grain hardness and application thereof | |
| CN108424954A (en) | One anthranilate synthase allele segment for increasing rice yield and its application | |
| CN116287397A (en) | Genetic information identification method related to wheat grain hardness | |
| CN113073143B (en) | Method for detecting rice yield traits by using three haplotypes | |
| CN116732223B (en) | Litchi embryo character SNP molecular marker developed based on KASP technology and application thereof | |
| CN116751881A (en) | Genetic information identification method related to wheat grain hardness | |
| CN116855629B (en) | SNP molecular marker for judging embryo coke nucleus character of litchi seeds and application thereof | |
| CN114369680B (en) | Application of sequence shown in SEQ ID NO.1 in aspect of regulating and controlling wheat plant height as wheat dwarf gene Rht8, and molecular marker and application thereof | |
| CN112538533B (en) | Molecular marker related to long-hair rabbit hair length and application thereof | |
| CN117867163A (en) | KASP molecular marker of wheat wet gluten content major QTL QQQQgc.cau-2D and application thereof | |
| CN115820909A (en) | Method for screening wheat with different thousand grain weights and primer group used by method | |
| CN116377102A (en) | Wheat molecular marker AX-95660756 and application thereof in gluten aggregation characteristic improvement | |
| CN116162727A (en) | InDel marker coseparated from watermelon yellowing trait and application thereof | |
| CN117904344A (en) | SNP molecular marker combination for constructing large-diameter material populus americana DNA fingerprint and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |