CN114854902A

CN114854902A - Wheat molecular marker 5668 and application thereof in grain hardness improvement

Info

Publication number: CN114854902A
Application number: CN202210744206.XA
Authority: CN
Inventors: 周正富; 秦毛毛; 耿胜辉; 雷振生; 吴政卿; 侯锦娜; 车军
Original assignee: Henan Academy Of Crop Molecular Breeding
Current assignee: Henan Academy Of Crop Molecular Breeding
Priority date: 2022-06-27
Filing date: 2022-06-27
Publication date: 2022-08-05
Anticipated expiration: 2042-06-27
Also published as: CN114854902B

Abstract

The invention discloses a molecular marker 5668 related to wheat grain hardness traits, a group of KASP primer groups related to the molecular marker and application thereof, wherein the KASP primer groups comprise: an upstream primer 1 with a nucleotide sequence shown as SEQ ID NO.1, an upstream primer 2 with a nucleotide sequence shown as SEQ ID NO.2, and a downstream primer 3 with a nucleotide sequence shown as SEQ ID NO.3, wherein the primers 3 are common primers; the KASP primer group is used as a primer, the wheat genome to be detected is used as a template for PCR amplification, when the bases of the corresponding sites of the two chromosomes of the wheat are both C, the wheat grain belongs to a CC genotype wheat variety with a high hardness grain phenotype, and when the bases of the corresponding sites of the two chromosomes of the wheat are both T, the wheat grain belongs to a TT genotype wheat variety with a low hardness grain phenotype.

Description

Wheat molecular marker 5668 and application thereof in grain hardness improvement

Technical Field

The invention belongs to the technical field of wheat grain hardness molecular markers, and relates to a wheat molecular marker 5668 and application thereof in grain hardness improvement.

Background

Wheat is the second major food crop in China, the staple food of northern people, accounts for about 40% of food consumption in China, and is also an important raw material in the white spirit brewing industry. With the rapid development of economy in China, the market increasingly flourishes the demand for high-quality special wheat. The grain hardness is an important factor influencing the processing of wheat food and the brewing quality of white spirit. In the flour making process, the grain hardness not only influences the water adding amount of the wheat wetting, the energy consumption of milling and the flour yield, but also is a key factor for determining the grain size of the flour, the quantity of damaged starch and the like. The hardness of the high-quality strong gluten wheat grains is high, and the hardness of the high-quality weak gluten wheat grains is low. In the process of making the yeast by brewing the white spirit, the hard wheat flour is thick when being made into flour, and the yeast blank is not easy to form and is not suitable for making the yeast; the soft wheat flour has small damage of starch grains when being made into flour, fine flour and easy forming of yeast blank, and is suitable for yeast making. Researches find that when the same amount of water is added, the water content of the yeast made of hard wheat is low, the temperature is low in the middle and later stages of fermentation, the water is not easy to evaporate, the moisture of the finished product yeast is higher, and the yeast core is mildewed and the white yeast is more abundant. The microorganisms contained in the soft wheat starter are higher than those in the hard wheat starter, so that the fermentation and aroma generation of the hard wheat starter are facilitated. The practical experience of yeast making shows that when the hardness of wheat grains is less than 60, the crushed wheat grains have less fine powder and more block skins, and the produced yeast blocks have high quality.

Wheat grain hardness is quantitative and controlled by polygene. Two linked genes Pina and Pinb on wheat 5Ds are main effective genes for controlling wheat grain hardness. Through overexpression, RNAi and gene editing Pina or Pinb, the hardness of the grains can be changed. Beecher et al transferred the wild type Pinb-D1a in China spring into durum wheat, the SKCS hardness value of the receptor was reduced from 70 to 25, and the damaged starch was also reduced from 3.71% to 1.69%. Nevertheless, there is a large variation in kernel hardness in materials where Pina and Pinb are both wild-type. Therefore, the method excavates a new wheat grain hardness control gene, develops a corresponding molecular marker, is used for the accurate design of wheat hardness, and has important significance for the breeding of high-quality wheat and special wheat varieties for brewing.

Disclosure of Invention

In order to overcome the defects in the prior art, the invention screens and identifies a significant site 5668 influencing the wheat grain hardness by measuring and counting the wheat grain hardness of different wheat varieties in China in combination with the identification result of wheat whole genome association analysis (GWAS), and further develops the application of the specific primer combination for identifying the site in the wheat grain hardness character screening in combination with the KASP technical principle.

The invention provides a substance for detecting wheat grain hardness, which is a complete set of primers for detecting whether the 36 th deoxyribonucleotide of a molecular marker 5668 shown as SEQ ID No.4 on a chromosome 1B in a wheat genome is CC, TT or CT or a detection reagent or a kit containing the complete set of primers.

CGATCAGCAACCTCCCCGATGGCGCTGACTCTGTGRGGCCTTTTTCCCGGTGATGCACCCTGGTGACGGGG (SEQ ID No.4), wherein R at position 36 represents [ C/T ].

In certain embodiments, the set of primers comprises two forward primers and one reverse primer; the upstream primers are designed according to the 36 th deoxyribonucleotide of a gene fragment shown by SEQ ID No.4 on chromosome 1B in the wheat genome and an upstream sequence thereof, the deoxyribonucleotide at the 3 'end of one upstream primer is T, and the deoxyribonucleotide at the 3' end of the other upstream primer is C; the downstream primer is designed according to the downstream sequence of the 36 th deoxyribonucleotide of the gene fragment shown by SEQ ID No.4 on the chromosome 1B in the wheat genome.

In certain embodiments, the primer set is a primer set consisting of the single-stranded DNA molecule shown at positions 22-42 of SEQ ID No.1 or a derivative thereof, the single-stranded DNA molecule shown at positions 22-42 of SEQ ID No.2 or a derivative thereof, and the single-stranded DNA molecule shown at SEQ ID No. 3.

In some embodiments, the derivative of the single-stranded DNA molecule shown in the 22 nd to 42 th positions of the SEQ ID No.1 is that the 5' end of the single-stranded DNA molecule shown in the 22 nd to 42 th positions of the SEQ ID No.1 is connected with a specific fluorescent tag sequence A; the derivative of the single-stranded DNA molecule shown in 22 th to 42 th positions of SEQ ID No.2 is that the 5' end of the single-stranded DNA molecule shown in 22 th to 42 th positions of SEQ ID No.2 is connected with a specific fluorescent label sequence B.

In certain embodiments, the specific fluorescent tag sequence a is a fluorescent tag sequence FAM and the specific fluorescent tag sequence B is a fluorescent tag sequence HEX.

In some embodiments, the sequences of the upstream primer are shown as SEQ ID No.1 and SEQ ID No.2, respectively, and the sequence of the downstream primer is shown as SEQ ID No. 3.

In another aspect, the invention provides the use of a substance as defined above in any one of:

(A) identifying or assisting in identifying the hardness character of the wheat grains;

(B) comparing the hardness of the wheat grains to be detected;

(C) breeding or screening a single wheat plant or strain or variety with relatively high grain hardness;

(D) selecting or screening a single wheat plant or strain or variety with relatively low grain hardness;

(E) preparing a product for identification or auxiliary identification or comparison of the hardness of the wheat grains to be detected;

(F) preparing a product for breeding or screening a single wheat plant or strain or variety with relatively high grain hardness;

(G) preparing a product for breeding or screening a single wheat plant or strain or variety with relatively low grain hardness.

In another aspect of the invention, there is provided any one of the following methods:

the method A comprises the following steps: a method for comparing the hardness of wheat grains to be tested comprises the following steps (A1) or (A2):

(A1) detecting whether the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the wheat genome is CC, TT or C and T;

(A2) determining the hardness of the wheat grains to be detected as follows: the hardness of the wheat grain to be detected is higher than that of the wheat grain to be detected, wherein the 36 th deoxyribonucleotide of the molecular marker shown by SEQ ID No.4 on the chromosome 1B in the genome is a homozygote of C, and the 36 th deoxyribonucleotide of the molecular marker shown by SEQ ID No.4 on the chromosome 1B in the genome is a homozygote of T or a heterozygote of T and C;

the method B comprises the following steps: a method for breeding or screening a single wheat plant or a wheat strain or a wheat variety with relatively high grain hardness comprises the following steps:

(B1) detecting whether the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the wheat genome is CC, TT or C and T;

(B2) selecting wheat to be tested, wherein the 36 th deoxyribonucleotide of the molecular marker shown by SEQ ID No.4 on the chromosome 1B in the genome is a homozygote of C, as a parent to carry out breeding, and selecting the wheat, wherein the 36 th deoxyribonucleotide of the molecular marker shown by SEQ ID No.4 on the chromosome 1B in the genome is a homozygote of C, in each generation of breeding, so as to finally obtain a single wheat plant or a strain or a variety with relatively high grain hardness;

the method C comprises the following steps: a method for breeding or screening a single wheat plant or strain or line or variety with relatively low grain hardness comprises the following steps:

(C1) detecting whether the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on chromosome 1B in the wheat genome is CC, TT or C and T;

(C2) selecting wheat to be tested, wherein the 36 th deoxyribonucleotide of the molecular marker shown by SEQ ID No.4 on the chromosome 1B in the genome is a homozygote of T, as a parent to carry out breeding, and selecting the wheat, wherein the 36 th deoxyribonucleotide of the molecular marker shown by SEQ ID No.4 on the chromosome 1B in the genome is a homozygote of T, in each generation of breeding, so as to finally obtain a single wheat plant or a strain or a variety with relatively low grain hardness.

In some embodiments, the specific operations of (a1), (B1) and (C1) are to perform PCR amplification on a wheat genomic DNA to be detected by using the detection reagent or the kit of the present invention, scan a fluorescence signal of an amplified product, analyze scan data, and determine whether the 36 th deoxyribonucleotide of a molecular marker shown as SEQ ID No.4 on chromosome 1B in the wheat gene to be detected is CC, TT or C and T as follows:

if the fluorescence signal data of the amplification product of the wheat to be detected shows blue, the 36 th deoxyribonucleotide of the molecular marker shown by SEQ ID No.4 on the chromosome 1B in the genome of the wheat to be detected is a homozygote of T;

if the fluorescence signal data of the amplification product of the wheat to be detected shows yellow, the 36 th deoxyribonucleotide of the molecular marker shown by SEQ ID No.4 on the chromosome 1B in the genome of the wheat to be detected is a homozygote of C;

and if the fluorescence signal data of the amplification product of the wheat to be detected is green, the 36 th deoxyribonucleotide of the molecular marker shown in SEQ ID No.4 on the chromosome 1B in the genome of the wheat to be detected is a hybrid of C and T.

In certain embodiments, the PCR amplification is specifically,

in the primer group combination, the upstream primer 1: the upstream primer 2: the downstream primer is 12: 12: 30, of a nitrogen-containing gas; the PCR reaction program is: 95 ℃ for 15 min; 95 deg.C, 20s, 65 deg.C, 655 deg.C, 1 min; 94 ℃, 20s, 57 ℃, 1min, 30 cycles; 37 ℃ for 1 min.

A5. mu.L amplification system can be designed by reference as follows:

the Primer Mix, per 100 μ L:

forward primer 1(F1), 10uM, 12. mu.L;

forward primer 2(F2), 10uM, 12. mu.L;

downstream primer (R), 10uM, 30. mu.L;

ddH ₂ O，46μL。

compared with the prior art, the method screens and identifies a significant site 5668 affecting the hardness of the wheat grains, and the site is significantly related to the hardness trait of the wheat grains. Preliminary research results show that the TT genotype has the advantage of low hardness phenotype. Based on the locus and combined with the KASP technical principle, the invention further develops a specific primer combination for identifying the locus, and the specific primer combination can be used for detecting the grain hardness character of the wheat to be detected and screening and breeding wheat varieties with high hardness character or low hardness character, thereby laying a certain theoretical basis and technical basis for wheat grain hardness character identification and new soft wheat variety cultivation.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments will be briefly described below.

FIG. 1 is a genome-wide association analysis 1BL significant site plot;

FIG. 2 shows the results of typing of wheat genotype at position 5668; wherein CC represents 5668-C, TT represents 5668-T, CK represents no template control, namely ultrapure water is used for replacing sample DNA, and whether sample pollution occurs in the experiment is detected;

FIG. 3 is a box plot of 5668 different genotypes.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The following examples are only for illustrating the technical solutions of the present invention more clearly, and therefore are only examples, and the protection scope of the present invention is not limited thereby. It is to be noted that, unless otherwise specified, technical or scientific terms used herein shall have the ordinary meaning as understood by those skilled in the art to which the present invention belongs.

Wheat material: the related wheat varieties (lines) referred to in the following examples are provided by wheat research institute of agricultural academy of sciences in Henan province, and the related wheat is sown in New county (original Yang, experimental base of agricultural academy of sciences in Henan province), harvested after physiological maturity (during which different tissue samples at different growth stages are harvested, and stored in a laboratory for later use), and used for subsequent analysis.

The applicant has stored relevant germplasm materials for a long time as a professional agriculture research institution, and all relevant wheat varieties are publicly available in the market or in the existing germplasm bank.

Example 1

In order to obtain the wheat grain hardness regulation gene, the prior art is combined, firstly, based on a wheat grain hardness measurement method (single kernel characterization system, SKCS), the hardness phenotype conditions of different wheat varieties continuously planted for three years are measured, and the preliminary determination of the wheat grain hardness phenotype difference is expected. See table 1 below for specific assay results.

It should be explained that, the specific wheat grain hardness measurement method can refer to the following operations:

the harvested wheat grains in the mature period are naturally dried, 300 complete seeds without half grains or wormholes and other problems are selected, poured into a single-grain hardness tester SKCS (model number Perten SKCS 4100), and the instrument is operated to obtain sample hardness data through measurement.

Example 2

Based on the hardness phenotype data obtained by the determination of example 1, two significant sites (1BL: 572152983-: 5668. 5668-1.

The site process is obtained by using a genome-wide association analysis (GWAS) method, and is specifically described as follows:

genome-wide association assays (GWAS) are a new approach to complex trait research that has been developed in recent years. In the past few years, many researchers at home and abroad have developed GWAS in the aspects of wheat disease resistance, stress resistance, nutritional quality, processing quality and the like. The research not only greatly enriches the available molecular markers in the wheat marker-assisted selective breeding, but also provides important clues for the molecular mechanism exploration and research of the traits. The invention carries out gene typing on 207 parts of associated population materials by utilizing a Wheat 660K SNP chip, carries out quality control on typing results and obtains 224,706 high-quality SNP markers. And (4) carrying out group STRUCTURE analysis by using STRUCTURE software according to the typing result, carrying out principal component analysis by using Plink software, and obtaining a genetic relationship matrix. The Kinship in the Tassel v5.0 software was used to calculate the genetic K matrix, and the Q + K mixed linear model MLM in the Tassel v5.0 software was used for correlation analysis between phenotype and marker, with the threshold set at-log 10(P) > 4. The analysis result shows that the SNP site 5668 which is jointly identified by hardness data (the specific method is shown in example 1) under the same environment for years (2019, 2020 and 2021) and is positioned on the 1B chromosome is a stable genetic site influencing the hardness of the wheat grain, and the contribution rate to the phenotype is 8.25-12.17%.

After further analysis, it can be seen that the two identified significant sites affecting wheat grain hardness should be the same site, that is, the wheat molecular marker 5668 has a full-length sequence length of 71bp, and a C/T mutation exists at the 36 th site of the sequence.

The wheat molecular marker 5668 has the following specific sequence:

CGATCAGCAACCTCCCCGATGGCGCTGACTCTGTGRGGCCTTTTTCCCGGTGATGCACCCTGGTGACGGGG (SEQ ID No.4), wherein R represents [ C/T ].

Based on the sequence difference and on the KASP principle, the primer group for obtaining the wheat molecular marker by PCR amplification is further developed and designed, and is specifically designed as follows:

5668-F1：5’-GAAGGTGACCAAGTTCATGCTCCGATGGCGCTGACTCTGTGC-3 '(SEQ ID No.1), (GAAGGTGACCAAGTTCATGCT partial sequence at 5' end is FAM marker sequence)

5668-F2：5’-GAAGGTCGGAGTCAACGGATTCCGATGGCGCTGACTCTGTGT-3’(SEQ ID No.2)，

(5' end "GAAGGTCGGAGTCAACGGATT" partial sequence HEX tag sequence)

5668-R：5’-GGGTCAAGGCAGGTGACTGAAG-3’(SEQ ID No.3)；

When 5668-F1 and 5668-R are used as a primer pair combination, the primer pair is used for amplifying a sequence with the 36 th base being C in the wheat molecular marker;

when 5668-F2 and 5668-R are used as a primer pair combination, the primer pair is used for amplifying a sequence of which the 36 th base is T in the wheat molecular marker.

Example 3

Based on the primer pair design of example 2, 207 parts of wheat material were genotyped, and the correlation between the genotype and the hardness phenotype was identified, which is briefly described below.

Firstly, respectively extracting genome DNA of each wheat variety;

then, PCR (using BIO-RAD fluorescent quantitative PCR instrument CFX connection TM Real-Time System) detection analysis was performed on different wheat samples according to the primers designed in example 2 and the DNA extracted above as a template, and the 36 th base sequence was finally determined.

For specific PCR amplification, a 5. mu.L amplification system can be designed by reference as follows:

KASP Mix(2X)，2.5μL；

Primer Mix，0.7μL；

MgCl ₂ ，0.04μL；

DNA，30ng；

ddH ₂ o, make up to 5 μ L;

the Primer Mix, per 100 μ L:

5668-F1，10uM、12μL；

5668-F2，10uM、12μL；

5668-R，10uM、30μL；

ddH ₂ O，46μL；

the PCR reaction program references (which can be adjusted appropriately according to the amplification result) are:

95 ℃ for 15 min; 95 ℃, 20s, 65 ℃, 655 ℃, 1min (10 cycles, 1 ℃ reduction per cycle); 94 ℃, 20s, 57 ℃, 1min, 30 cycles; 37 ℃ for 1 min.

The statistics of specific genotypes and wheat firmness are shown in table 1 below, and fig. 2 and 3.

TABLE 1 results of different wheat varieties genotypes and their grain hardness correspondences

Further statistical analysis was performed on the results of the above table, and the results are shown in table 2 below.

TABLE 2 hardness index mean T test results of molecular marker 5668

Based on the above statistics, it can be seen that: the average grain hardness of the CC genotype wheat is 50.6; the average grain hardness of TT genotype wheat is 41.2. The grain hardness of the CC genotype wheat is obviously higher than that of the TT genotype wheat, the difference is 22.8 percent, and the difference is obvious when the p is less than 0.01. That is, the grain hardness of the CC genotype wheat is obviously higher than that of the TT genotype wheat. Meanwhile, the average grain hardness of the CT genotype wheat as a heterozygous type is only 37.8.

Based on the results, on one hand, the hardness characteristic of the wheat grains can be accurately judged by detecting a specific site by using the designed primer pair, and further, a foundation can be laid for the application of a molecular breeding technology; on the other hand, based on the locus, a certain technical and theoretical basis can be established for breeding new wheat varieties with different hardness, and the locus has a better technical significance for improving the processing performance of related wheat.

Unless specifically stated otherwise, the numerical values set forth in these examples do not limit the scope of the invention. In all examples shown and described herein, unless otherwise specified, any particular value should be construed as merely illustrative, and not restrictive, and thus other examples of example embodiments may have different values.

SEQUENCE LISTING

<110> molecular breeding research institute of crops in Henan province

<120> wheat molecular marker 5668 and application thereof in improvement of grain hardness

<130> 202206

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 42

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

gaaggtgacc aagttcatgc tccgatggcg ctgactctgt gc 42

<210> 2

<211> 42

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

gaaggtcgga gtcaacggat tccgatggcg ctgactctgt gt 42

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

gggtcaaggc aggtgactga ag 22

<210> 4

<211> 71

<212> DNA

<213> Artificial sequence (artificial sequence)

<220>

<221> misc_feature

<222> (36)..(36)

<223> r is a base C/T

<400> 4

cgatcagcaa cctccccgat ggcgctgact ctgtgrggcc tttttcccgg tgatgcaccc 60

tggtgacggg g 71

Claims

1. A substance for detecting wheat grain hardness is characterized in that the substance is a complete set of primers for detecting that the 36 th genotype of a molecular marker 5668 shown as SEQ ID No.4 on a chromosome 1B in a wheat genome is CC, TT or CT, or a detection reagent or a kit containing the complete set of primers.

2. The substance according to claim 1,

the primer set contains two upstream primers and one downstream primer;

the upstream primers are designed according to the 36 th deoxyribonucleotide of a sequence shown by SEQ ID No.4 on a chromosome 1B in the wheat genome and an upstream sequence thereof, the deoxyribonucleotide at the 3 'end of one upstream primer is T, and the deoxyribonucleotide at the 3' end of the other upstream primer is C;

the downstream primer is designed according to the downstream sequence of the 36 th deoxyribonucleotide of the sequence shown by SEQ ID No.4 on the chromosome 1B in the wheat genome.

3. The substance according to claim 2, wherein the primer set is a primer set consisting of a single-stranded DNA molecule represented by SEQ ID No.1 or a derivative thereof from position 22 to 42, a single-stranded DNA molecule represented by SEQ ID No.2 or a derivative thereof from position 22 to 42, and a single-stranded DNA molecule represented by SEQ ID No. 3.

4. The substance according to claim 3, wherein the derivative of the single-stranded DNA molecule shown in the 22 nd to 42 th positions of SEQ ID No.1 is that the 5' end of the single-stranded DNA molecule shown in the 22 nd to 42 th positions of SEQ ID No.1 is connected with a specific fluorescent tag sequence A; the derivative of the single-stranded DNA molecule shown in 22 th to 42 th positions of SEQ ID No.2 is that the 5' end of the single-stranded DNA molecule shown in 22 th to 42 th positions of SEQ ID No.2 is connected with a specific fluorescent label sequence B.

5. The agent according to claim 4, wherein the specific fluorescent tag sequence A is a fluorescent tag sequence FAM and the specific fluorescent tag sequence B is a fluorescent tag sequence HEX.

6. The substance as claimed in claim 5, wherein the sequences of the upstream primer are shown as SEQ ID No.1 and SEQ ID No.2, respectively, and the sequence of the downstream primer is shown as SEQ ID No. 3.

7. Use of a substance according to any one of claims 1 to 6 in any one of:

(B) comparing the hardness of the wheat grains to be detected;

8. Any one of the following methods:

(A1) detecting whether the 36 th genotype of the molecular marker shown as SEQ ID No.4 on chromosome 1B in the wheat genome is CC, TT or CT;

(B1) detecting whether the 36 th genotype of the molecular marker shown as SEQ ID No.4 on chromosome 1B in the wheat genome is CC, TT or CT;

(C1) detecting whether the 36 th deoxyribonucleotide of the molecular marker shown by SEQ ID No.4 on chromosome 1B in the wheat genome is CC, TT or CT;

9. The method of claim 8, wherein said (A1) (B1) (C1) is specifically operative to,

performing PCR amplification on wheat genome DNA to be detected by using the detection reagent or the kit of any one of claims 1 to 6, scanning the amplified product with a fluorescent signal, analyzing the scanning data, and then determining whether the 36 th deoxyribonucleotide represented by SEQ ID No.4 on chromosome 1B in the wheat gene to be detected is CC, TT, or C and T according to the following steps:

10. The method according to claim 9, wherein the PCR amplification is in particular,