CN116555473A - Tomato ITS (ITS-mediated isothermal amplification) labeled primer, tomato specific ITS sequence and application thereof - Google Patents

Tomato ITS (ITS-mediated isothermal amplification) labeled primer, tomato specific ITS sequence and application thereof Download PDF

Info

Publication number
CN116555473A
CN116555473A CN202310478659.7A CN202310478659A CN116555473A CN 116555473 A CN116555473 A CN 116555473A CN 202310478659 A CN202310478659 A CN 202310478659A CN 116555473 A CN116555473 A CN 116555473A
Authority
CN
China
Prior art keywords
tomato
primer
sequence
root system
specific
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310478659.7A
Other languages
Chinese (zh)
Inventor
周新刚
金雪
冉令义
张敬禹
张鲜红
吴凤芝
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Northeast Agricultural University
Original Assignee
Northeast Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northeast Agricultural University filed Critical Northeast Agricultural University
Priority to CN202310478659.7A priority Critical patent/CN116555473A/en
Publication of CN116555473A publication Critical patent/CN116555473A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a tomato ITS (ITS-mediated isothermal amplification) labeled primer, a tomato specific ITS sequence and application thereof, and belongs to the technical field of molecular biological detection. The tomato ITS marking primer comprises a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown as SEQ ID No.1, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 2. The tomato ITS marking primer provided by the invention can accurately identify the attribution of the root system of the tomato, distinguish the root system of the tomato from common crops and weeds, effectively reduce the interference of common microorganisms in soil on identification, improve the speed and accuracy of identification of the root system of the tomato, and has important significance for research of the root system of the tomato, construction of DNA bar codes of the root system of the tomato, analysis of residual stubble of the soil and the like.

Description

Tomato ITS (ITS-mediated isothermal amplification) labeled primer, tomato specific ITS sequence and application thereof
Technical Field
The invention relates to the technical field of molecular biology detection, in particular to a tomato ITS (ITS-mediated isothermal amplification) labeled primer, a tomato specific ITS sequence and application thereof.
Background
Root system research is an important research direction in the fields of agricultural production, plant interaction and the like, and root systems are important organs of plants and play an important role in plant growth and development. For example, the distribution of crop root systems can affect crop yield and stress tolerance; crop stubbles can directly influence the biological, physical and chemical properties of soil and influence the health state of the soil. However, the root system is hidden in the soil, and the phenotype identification work is time-consuming, labor-consuming and low in accuracy, so that the application of the crop root system in practice is greatly restricted. Therefore, improving the efficiency of root phenotype identification is an urgent need to accelerate root research.
The existing methods for identifying root systems are mainly based on morphological and physiological characteristics, such as morphological identification, anatomical identification, biochemical identification and the like. However, these methods have limitations and errors such as: the morphological identification needs detailed morphological description of the root system, and it is difficult to distinguish some plants with similar root system morphology; the anatomical discrimination needs to carry out slicing observation on root systems, and has large workload and long time; the biochemical identification needs to analyze chemical components of the root system, and the operation is complex. Therefore, the method cannot meet the requirement of modern agriculture on rapid and accurate detection of root systems. The genomic DNA of the root system is analyzed by utilizing molecular biology technologies such as PCR amplification, DNA bar code technology and the like, so that the variety and the property of the root system can be rapidly and accurately identified. However, this method may suffer from contamination and interference due to insufficient specificity of the specific primers, affecting the results. Tomatoes are widely planted worldwide as common vegetables, and have important significance for researching root systems of tomatoes. Therefore, there is a need for a tomato specific primer with little interference and accurate results.
Disclosure of Invention
In view of the above, the invention aims to provide a tomato ITS (ITS-mediated isothermal amplification) marking primer, a tomato specific ITS sequence and application thereof, and the tomato ITS marking primer can accurately identify the root system attribution of tomatoes, improves the speed of identifying the root system of the tomatoes, and has important significance for researching the root system of the tomatoes, constructing DNA bar codes of the root system of the tomatoes, analyzing the soil stubble and the like.
In order to achieve the above object, the present invention provides the following technical solutions:
a tomato ITS tagged primer comprises a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown as SEQ ID No.1, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 2.
The invention also provides a tomato specific ITS sequence, which is obtained by amplifying the tomato ITS marking primer in the technical scheme.
Preferably, the nucleotide sequence of the tomato specific ITS sequence is shown in SEQ ID No. 3.
Preferably, the tomato specific ITS sequence is 235bp in size.
The invention also provides an application of the tomato ITS marking primer in the technical scheme.
The invention also provides an application of the specific ITS sequence in the technical scheme.
The invention also provides a method for identifying the attribution of the root system of the tomato, which comprises the following steps:
s1, extracting genome DNA of a sample to be detected;
s2, carrying out PCR amplification by using the genomic DNA obtained in the S1 as a template and using the tomato ITS marking primer in the technical scheme;
s3, detecting the PCR amplification product obtained in the S2 by adopting an agarose gel electrophoresis method.
Preferably, the reaction system for PCR amplification in S2 comprises 2× Rapid Taq MasterMix, tomato ITS labeled primer, DNA template, ddH 2 O。
Preferably, the reaction conditions for the PCR amplification in S2 are: pre-denaturation at 95℃for 3min; denaturation at 95℃for 15s, annealing at 55℃for 15s, extension at 72℃for 3s,35 cycles; extending at 72℃for 5min.
Preferably, the detection result in S3 is to detect whether the tomato-specific ITS sequence described in the above technical scheme is successfully amplified.
The beneficial technical effects are as follows: the invention provides a tomato ITS (ITS-mediated isothermal amplification) marking primer, a tomato specific ITS sequence and application thereof in identifying tomato root system attribution. The tomato ITS marking primer provided by the invention can accurately identify the attribution of the root system of the tomato, distinguish the root system of the tomato from common crops and weeds, effectively reduce the interference of common microorganisms in soil on identification, improve the speed and accuracy of identification of the root system of the tomato, and has important significance for research of the root system of the tomato, construction of DNA bar codes of the root system of the tomato, analysis of residual stubble of the soil and the like.
Drawings
FIG. 1 is an electrophoretogram of each sample amplification product;
FIG. 2 is an electrophoretogram of total DNA of each sample;
wherein, in fig. 1 and fig. 2, are: m: DL 2000DNAMarker; y: tillering onion; h: cucumber; x: watermelon; t: melon seeds; f: tomato; l: green pepper; q: eggplant; b: chinese cabbage; g: cabbage; c: beans; SD: rice; YM: corn; XM: wheat; ag: celery; ls: lettuce; af: green onion; st: potatoes; br: rape seed; vv: grape; fa: strawberry; cs: coriander (coriander); zo: ginger; cm: pumpkin; es: stink vegetable; at: chinese chives; gm: soybean; rs: radish dish; tm: dandelion; bj: mustard; at: arabidopsis thaliana; vu: cowpea; ds: carrot; bh: white gourd; ib: sweet potato; la: loofah; so: spinach; mc: peppermint, peppermint; as: artemisia selengensis; ac: herba Artemisiae Annuae; ea: a canopy; sj: sage (Salvia officinalis); cj: thistle, ms: alfalfa; ds: crabgrass; tr: grass of Trifolium pratense; hm: hemerocallis chinensis; ec: barnyard grass; ps: potentilla chinensis (Potentilla chinensis) Chamakinra (Thunb.) Rehd; aa: herba Acalyphae; hs: humulus scandens (L.) Linn; po: purslane (Portulaca oleracea L.) L; sw: endives are prepared; pa: herb of plantain; ei: herba Eleusines Indicae; sv: green bristlegrass; tp: root of common Holly; sn: solanum nigrum L; ca: quinoa (L); tri: trichoderma; asp: aspergillus; pen: penicillium sp; mor: mortierella jenkinii; cha: chaetomium globosum; muc: mucor; fol: tomato fusarium wilt bacteria; foc: cucumber fusarium wilt bacteria; fon: watermelon fusarium wilt bacteria; bac: bacillus; fla: flavobacterium (F.flavum); rhi: rhizobia bacteria; art: arthrobacter; act: actinomycetes; ros: performing fiber fermentation; str: streptomyces sp; and (3) the following steps: pseudomonas bacteria; TD: field soil DNA; n: negative control.
Detailed Description
The invention provides a tomato ITS (internal transcribed spacer) marker primer, which comprises a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown as SEQ ID No.1, and the nucleotide sequence of the reverse primer is shown as SEQ ID No.2
In the invention, the specific nucleotide sequences of SEQ ID No.1 to SEQ ID No.2 are shown as follows:
SEQ ID No.1：ACGGATCATAGGGGGATGCG；
SEQ ID No.2：TCAGCCTTGCAACGTGTAGG。
in the invention, the tomato ITS marking primer is designed and obtained according to ITS sequence analysis and comparison of common crops and field weeds and a difference section and primer design principle; the tomato ITS marking primer can distinguish the root system of the tomato from common crops and weeds, is not interfered by common microorganisms in soil, and effectively improves the speed and accuracy of identification of the root system of the tomato.
The invention also provides a tomato specific ITS sequence, which is obtained by amplifying the tomato ITS marking primer in the technical scheme.
In the invention, the nucleotide sequence of the tomato specific ITS sequence is shown as SEQ ID No. 3; the size of the tomato specific ITS sequence is 235bp; the specific nucleotide sequence of SEQ ID No.3 is shown below:
SEQ ID No.3：
ACGGATCATAGGGGGATGCGCGCTGCGCTGATAACACAAATGACTCATGACAATGAATATCTCGGCTCTCAAATTGATGAAGAAGGTAGCGAAATGCGATGCTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCAGGTCTGCCTGGGCGTCACGCATCACGTTGCCCTCCCCTACACGTTGCAAGGCTGA。
the invention also provides application of the tomato ITS marking primer in the technical scheme.
In the invention, the application is preferably kit for identifying the attribution of the tomato root system, tomato root system identification, soil stubble analysis and tomato root system DNA bar code construction. The application of the invention is preferably but not limited to the above field, the application type and method of the application are not particularly limited, and the application type and method acceptable by the tomato ITS labeled primer can be adopted.
The invention also provides application of the tomato specific ITS sequence in the technical scheme.
In the invention, the application is preferably kit for identifying the attribution of the tomato root system, tomato root system identification, soil stubble analysis and tomato root system DNA bar code construction. The application of the invention is preferably but not limited to the above field, the application type and method of the application are not particularly limited, and the application type and method acceptable by the tomato specific ITS sequence can be adopted.
The invention also provides a method for identifying the attribution of the root system of the tomato, which comprises the following steps:
s1, extracting genome DNA of a sample to be detected;
s2, carrying out PCR amplification by using the genomic DNA obtained in the S1 as a template and using the tomato ITS marking primer in the technical scheme;
s3, detecting the PCR amplification product obtained in the S2 by adopting an agarose gel electrophoresis method.
The invention firstly extracts the genome DNA of the sample to be detected.
In the invention, the genomic DNA of the sample to be detected can be extracted by using a plant genomic DNA extraction kit.
The invention uses the obtained genome DNA as a template and uses the tomato ITS marking primer in the technical proposal to carry out PCR amplification.
In the present invention, the reaction system for PCR amplification preferably comprises 2X Rapid Taq Master Mix, tomato ITS-labeled primer, DNA template, ddH 2 O. Of these, 2×RapidTaqMasterMix 12.5. Mu.L, tomato ITS-labeled primer 2. Mu.L (forward)1. Mu.L each of primer and reverse primer), DNA template 1. Mu. L, ddH 2 O was made up to 25. Mu.L.
In the present invention, the reaction conditions for the PCR amplification are preferably: pre-denaturation at 95℃for 3min; denaturation at 95℃for 15s, annealing at 55℃for 15s, extension at 72℃for 3s,35 cycles; extending at 72℃for 5min.
The invention adopts agarose gel electrophoresis method to detect the PCR amplified product.
In the invention, the agarose gel electrophoresis method is to electrophorese a sample in 1% agarose gel electrophoresis and detect the sample by an ultraviolet imager; the detection result is to detect whether the tomato specific ITS sequence in the technical scheme is successfully amplified.
For a better understanding of the present invention, the following examples are further illustrated, but are not limited to the following examples. Materials, reagents and the like used in the examples and test examples of the present invention can be obtained commercially unless otherwise specified; the methods used in the examples and test examples of the present invention are conventional methods unless otherwise specified.
Example 1 tomato ITS tagged primer design and validation
(1) Tomato ITS (internal transcribed spacer) labeling primer design
The complete ITS sequence of tomato and ITS sequences of 36 other common crops and 21 common field weeds (sources and information of tomato and other common crops and field weeds are shown in Table 1) are subjected to sequence analysis, proofreading and comparison by using MEGAX and BioEdit software, a section with difference between the nucleotide sequence of the ITS region of the target crop and bases in other common crops and field weeds is selected, and Primer design is performed by using software Primer Premier 5. Designing a primer according to the requirement of a general design principle of the selected primer, namely (1) the last base at the 3' end of the primer is preferably G or C; (2) The last 8 bases at the 3' end of the primer should avoid continuous mismatch; (3) the 3' -end of the primer should avoid the occurrence of hairpin structure; (4) Preferably, the difference between the Tm values of the forward primer and the reverse primer is not more than 1 ℃, and the Tm value is optimally adjusted to 55-65 ℃; (5) the GC content of the primer is controlled to be between 40 and 60 percent; (6) The primer A, G, C, T is uniformly distributed as much as possible, so that the use of GC or an area with high AT content is avoided; (7) The complementary sequences with more than 5 bases in the primer or between the two primers are avoided, and the complementary sequences with more than 3 bases are avoided at the 3' ends of the two primers; (8) The PCR amplification product length is selected to be 100-300 bp, so that the primer can be used for conventional PCR and quantitative PCR simultaneously. The sequence is appropriately adjusted according to the condition of the primer itself on the basis of satisfying the above conditions as much as possible. The designed primer is subjected to preliminary specificity verification in NCBI-BLAST comparison, whether the 3' -end of the primer is matched with other positions of target plant genome and non-target plant genome is checked, and the primer sequences are determined to be from target plants. And finally, selecting the primer meeting the requirements after BLAST comparison.
The nucleotide sequence of the tomato ITS marking primer is shown in SEQ ID No. 1-SEQ ID No. 2. Primer synthesis was performed by the division of biological engineering (Shanghai).
TABLE 1 sources and information of tomato and common crops, field weeds
(2) Extraction of DNA:
sample source: the sources of tomatoes, 36 other common crops and 21 common field weeds are shown in table 1; sources of fungi common in 9 soils and bacteria common in 8 soils are shown in table 2; the field soil is derived from corn continuous cropping soil of northeast agricultural university; the negative control was ddH 2 O；
Table 2 9 sources of fungi common in the soil and bacteria common in 8 soils
(1) Extraction of plant DNA:
the collected root systems of tomatoes, 36 other common crops and 21 common field weeds are frozen and ground by liquid nitrogen, and a novel rapid plant genome DNA extraction kit (centrifugal column type) of Baitaike biotechnology Co., ltd is adopted to extract plant genome DNA. 3. Mu.L of DNA samples were taken and electrophoresed in a 1% agarose gel and the extracted plant genomic DNA was detected under an ultraviolet imager.
(2) Extraction of fungal genomic DNA
The fungi from the sources are cultivated by a conventional method, mycelia are slowly removed from a PDA culture medium by using a sterilized medicine spoon after the fungi are cultivated in a solid culture medium for one week, the mycelia are frozen and ground by liquid nitrogen, and the genome DNA of the fungi is extracted by using a fungus genome DNA extraction kit (centrifugal column) of Baitaike biotechnology Co. A3. Mu.L sample of DNA was taken and electrophoresed in a 1% agarose gel and the extracted fungal genomic DNA was detected under an ultraviolet imager.
(3) Extraction of bacterial genomic DNA
Culturing the bacteria by a conventional method, picking out bacteria cultured for 2-3 d in a solid LB culture medium by using a sterilized toothpick, putting the bacteria into an LB liquid culture medium, shaking the bacteria for 1-2 d in a constant-temperature shaking table at the speed of 180rpm and the temperature of 37 ℃, and extracting bacterial genome DNA by sucking the shaken bacterial solution by using a bacterial genome DNA extraction kit (centrifugal column) of Baitaike biotechnology Co. A3. Mu.L sample of DNA was taken and electrophoresed in a 1% agarose gel and the extracted bacterial genomic DNA was detected under an ultraviolet imager.
(4) Extraction of total DNA from soil
Total DNA utilization of soil E.Z.N.ADNA Kit (Omega Bio-Tek, inc., GA, USA) was extracted. 3. Mu.L of DNA samples were taken and electrophoresed in a 1% agarose gel and the total DNA extracted from the soil was detected by UV imaging.
An electrophoresis diagram of total DNA of plants, fungi, bacteria and soil is shown in figure 2. As can be seen from FIG. 2, DNA of each sample has been successfully extracted.
(3) Verification of tomato ITS labeling primer:
the method is characterized in that tomatoes, 36 common crops, 21 common weeds in fields, 9 common fungi in soil, 8 common bacteria in soil and DNA (deoxyribonucleic acid) of the field are used as templates, conventional PCR (polymerase chain reaction) amplification reactions are respectively carried out, and specific application verification is carried out on designed primers.
The reaction system:
the reaction procedure:
pre-denaturation at 95℃for 3min; denaturation at 95℃for 15s, annealing at 55℃for 15s, extension at 72℃for 3s,35 cycles; extending at 72℃for 5min.
3. Mu.L of each sample of amplified product was taken and subjected to electrophoresis in a 1% agarose gel, followed by detection under an ultraviolet imager. The detection results are shown in FIG. 1. As can be seen from the figure 1, the lanes taking the tillered onion genomic DNA as the template have specific amplified bands, while the lanes taking the other sample genomic DNA as the template have no amplified bands, so that the specific primer obtained by the invention has good specificity, can accurately identify the root system attribution of tomatoes, distinguish the tomato root system from common crops and weeds, effectively reduce the interference of common microorganisms in soil on identification, improve the speed and accuracy of identification of the tomato root system, and have important significance for research of the tomato root system, construction of DNA bar codes of the tomato root system and analysis of soil stubbles.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (10)

1. The tomato ITS marking primer is characterized by comprising a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown as SEQ ID No.1, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 2.
2. Tomato specific ITS sequence, characterized in that it is amplified from the tomato ITS tagged primer of claim 1.
3. Tomato specific ITS sequence according to claim 2, characterized in that the nucleotide sequence of the tomato specific ITS sequence is shown in SEQ ID No. 3.
4. The tomato specific ITS sequence of claim 2, wherein the tomato specific ITS sequence is 235bp in size.
5. Use of a tomato ITS tagged primer as claimed in claim 1.
6. Use of a specific ITS sequence according to any one of claims 2 to 4.
7. A method for identifying tomato root system attribution, comprising the following steps:
s1, extracting genome DNA of a sample to be detected;
s2, carrying out PCR amplification by using the genomic DNA obtained in the S1 as a template and using the tomato ITS marking primer in the claim 1;
s3, detecting the PCR amplification product obtained in the S2 by adopting an agarose gel electrophoresis method.
8. The method for identifying tomato root system attribution according to claim 7, wherein the reaction system for PCR amplification in S2 comprises 2×RapidTaqMastermix, tomato ITS labeled primer, DNA template, ddH 2 O。
9. The method for identifying tomato root system assignment as claimed in claim 7, wherein the reaction conditions of the PCR amplification in S2 are: pre-denaturation at 95℃for 3min; denaturation at 95℃for 15s, annealing at 55℃for 15s, extension at 72℃for 3s,35 cycles; extending at 72℃for 5min.
10. The method according to claim 7, wherein the detection in S3 is a detection of successful amplification of the tomato specific ITS sequence according to any one of claims 2 to 4.
CN202310478659.7A 2023-04-28 2023-04-28 Tomato ITS (ITS-mediated isothermal amplification) labeled primer, tomato specific ITS sequence and application thereof Pending CN116555473A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310478659.7A CN116555473A (en) 2023-04-28 2023-04-28 Tomato ITS (ITS-mediated isothermal amplification) labeled primer, tomato specific ITS sequence and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310478659.7A CN116555473A (en) 2023-04-28 2023-04-28 Tomato ITS (ITS-mediated isothermal amplification) labeled primer, tomato specific ITS sequence and application thereof

Publications (1)

Publication Number Publication Date
CN116555473A true CN116555473A (en) 2023-08-08

Family

ID=87493962

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310478659.7A Pending CN116555473A (en) 2023-04-28 2023-04-28 Tomato ITS (ITS-mediated isothermal amplification) labeled primer, tomato specific ITS sequence and application thereof

Country Status (1)

Country Link
CN (1) CN116555473A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106350584A (en) * 2016-08-26 2017-01-25 北京通州国际种业科技有限公司 Primer set and method for identifying variety authentication and seed purity of tomatoes
CN107365865A (en) * 2017-09-01 2017-11-21 中国农业大学 The molecular labeling related to Tomato Fruit Color and its application
CN111518730A (en) * 2020-05-13 2020-08-11 中国科学院遗传与发育生物学研究所 Method for separating and culturing tomato root system microbiome and obtained tomato root system microbiome

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106350584A (en) * 2016-08-26 2017-01-25 北京通州国际种业科技有限公司 Primer set and method for identifying variety authentication and seed purity of tomatoes
CN107365865A (en) * 2017-09-01 2017-11-21 中国农业大学 The molecular labeling related to Tomato Fruit Color and its application
CN111518730A (en) * 2020-05-13 2020-08-11 中国科学院遗传与发育生物学研究所 Method for separating and culturing tomato root system microbiome and obtained tomato root system microbiome

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BO LIU等: "Multiple Divergent ITS1 Copies Were Identified in Single Tomato Genome Using DGGE Analysis", PLANT MOLECULAR BIOLOGY REPORTER, vol. 31, pages 273 *

Similar Documents

Publication Publication Date Title
Sabri et al. Importance of soil temperature for the growth of temperate crops under a tropical climate and functional role of soil microbial diversity
CN111961750A (en) KASP primer for detecting tomato yellow leaf curl virus disease resistance gene Ty-1 and application thereof
CN111961749A (en) KASP primer for detecting tomato yellow leaf curl virus disease resistance genes Ty-3 and Ty-3a and application thereof
CN110241245A (en) Detect KASP primer and its application of cucumber bacterial angular leaf spot gene
Jamali et al. Species-specific ITS primers for the identification of Picoa juniperi and Picoa lefebvrei and using nested-PCR for detection of P. juniperi in planta
CN112746124B (en) SSR primer and method for purity identification of cauliflower hybrid seeds
Nandwani et al. Molecular diversity of a native mesorhizobial population of nodulating chickpea (Cicer arietinum L.) in Indian soils
CN111961751B (en) KASP primer for detecting tomato root knot nematode resistance gene Mi-1.2 and application thereof
CN116555473A (en) Tomato ITS (ITS-mediated isothermal amplification) labeled primer, tomato specific ITS sequence and application thereof
CN116656868A (en) Bean specific labeling primer, specific ITS sequence and application thereof
CN116356074A (en) Primer pair for amplifying green pepper specific ITS sequence, green pepper specific ITS sequence and application thereof
CN116694801A (en) Specific primer and specific sequence of tillering onion and application of specific primer and specific sequence
CN108977563B (en) SSR core primer group developed based on radish whole genome sequence and application thereof
CN115747363A (en) SNP molecular marker for detecting gray mold resistance of cucumber and application thereof
CN110862930B (en) White agrocybe cylindracea and molecular marker identification method thereof
CN114032334A (en) Primer group and kit for detecting quinoa phomopsis and detection method thereof
Hong et al. First report of soft rot caused by Pectobacterium brasiliense on cucumber in Korea
CN106755541B (en) Molecular marker, primer and probe for identifying lyophyllum decastes
CN116411125B (en) Method for analyzing interaction of cucumber and wheat root system by quantitative PCR method
CN112752843A (en) Smut resistance-related marker of Saccharum plant and use thereof
CN105018481B (en) A kind of DNA fingerprinting and its acquisition methods and primer special of eight king of river
CN116334269B (en) Molecular marker for sex identification of actinidia arguta and specific primer pair M3 thereof
KR102162805B1 (en) Marker composition for discriminating anthracnose-resistant or sensitive grape cultivar and uses thereof
CN115838790B (en) Molecular marker for sex identification of actinidia arguta and application of specific primer pair M4
CN114574615B (en) Indel mark for identifying Hainan oil tea germplasm and detection method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination