CN116529365A

CN116529365A - Compositions and methods for treating duchenne muscular dystrophy

Info

Publication number: CN116529365A
Application number: CN202180075396.4A
Authority: CN
Inventors: J·格罗马达; T·富尔加; A·麦维-威利; G·多明格斯古铁雷斯; 辛玉蓉; 闵译立; M·F·博卢卡巴斯; E·安德森
Original assignee: Vertex Pharmaceuticals Inc
Current assignee: Vertex Pharmaceuticals Inc
Priority date: 2020-09-09
Filing date: 2021-09-08
Publication date: 2023-08-01

Abstract

Compositions and methods for treating Duchenne Muscular Dystrophy (DMD) are contemplated.

Description

Compositions and methods for treating duchenne muscular dystrophy

The present application claims U.S. provisional application No. 63/076,250 filed on 9/2020; U.S. provisional application No. 63/152,114 filed on 22 nd 2 nd 2021; U.S. provisional patent application No. 63/166,174, filed on 3/25 of 2021; and U.S. provisional application No. 63/179,850, filed on 26, 4, 2021, which is incorporated by reference in its entirety.

The present application contains a sequence listing that is electronically submitted in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created at 9.7 of 2021, named 2021-09-07_0145-0024-00PCT_ST25. Txt, and was 646,734 bytes in size.

Introduction and summary of the invention

Muscular Dystrophy (MD) is a group of more than 30 genetic diseases characterized by progressive weakness and degeneration of skeletal muscles that control movement. Dunaliella muscular dystrophy (Duchenne muscular dystrophy, DMD) is one of the most severe forms of MD, affecting about five thousandths of boys and characterized by progressive muscle weakness and premature death. Cardiomyopathy and heart failure are common, incurable and fatal features of DMD. The disease is caused by mutations in the gene encoding dystrophin (DMD), which cause the loss of expression of dystrophin, leading to myomembrane fragility and progressive muscle atrophy.

Sequence-specific cleavage of genomic DNA can be provided using Cas9 and guide RNAs for CRISPR-based genome editing. For example, the nucleic acid encoding the Cas9 enzyme and the nucleic acid encoding the appropriate guide RNA may be provided on separate vectors or together on a single vector and administered in vivo or in vitro to knock out or correct the gene mutation. Approximately 20 nucleotides at the 5' end of the guide RNA act as a guide or spacer sequence, which may be any sequence complementary to one strand of the genomic target site, with adjacent protospacer sequence adjacent motifs (PAMs). PAM sequences are short sequences required for proper binding of Cas9 molecules, adjacent to Cas9 nuclease cleavage sites. The 3' nucleotide of the guide or spacer sequence of the guide RNA serves as a backbone sequence that interacts with Cas 9. When expressing guide RNA and Cas9, the guide RNA will bind to Cas9 and guide it to a sequence complementary to the guide sequence, which will then initiate a Double Strand Break (DSB) in the sequence. To repair these breaks, cells typically utilize an error-prone non-homologous end joining (NHEJ) mechanism that can disrupt the function of the target gene via codon insertions or deletions, a shift of the reading frame, or cause premature termination codons to trigger nonsense-mediated attenuation. See, e.g., kumar et al, (2018) front. Mol. Neurosci. Volume 11, article 413.

While gene editing strategies for treating DMD using systems (e.g., CRISPR) have been previously studied, these strategies focus primarily on: a) Cleavage at a plurality of different sites to excise a substantial portion (e.g., one or more exons) of the dystrophin gene (see e.g., eusterout et al, 2015,Nat Commun.6:6244); or b) in a single site to introduce insertions/deletions (indels) that result in frameshift mutations and/or disrupt splice acceptor/donor sites in the dystrophin gene (see, e.g., amoassi et al, 2018, science,362 (6410): 86-91). However, additional alternative and effective gene editing strategies are still needed to treat diseases such as DMD.

In order for a gene editing system (e.g., CRISPR) to effectively treat diseases and conditions (e.g., DMD) in a patient, a vector that effectively delivers the components of the CRISPR system is needed. Administration of CRISPR-Cas components via adeno-associated viruses (AAV) in vivo or in vitro is attractive as AAV vector design, manufacture and clinical phase administration of gene therapy is continually accomplished early and successfully. See, e.g., wang et al, (2019) Nature Reviews Drug Discovery18:358-378; ran et al, (2015 a) Nature 520:186-101. However, the commonly used streptococcus pyogenes (Streptococcus pyogenes) (spCas 9) is very large and when used in AAV-based CRISPR/Cas systems, two AAV vectors are required: one vector carries a nucleic acid encoding spCas9 and the other carries a nucleic acid encoding a guide RNA. One possible way to overcome this technical hurdle is to utilize smaller orthologs of Cas9 derived from different prokaryotic species. Smaller Cas9, such as staphylococcus aureus (SaCas 9) and staphylococcus lugdunensis (Staphylococcus lugdunensis) (slaucas 9), may be able to be made on a single AAV vector along with nucleic acid encoding one or more guide RNAs. One advantage of incorporating one or more guide RNAs along with a smaller SaCas9 or slaucas 9 into a single vector is that doing so enables great design flexibility in situations where more than one guide RNA is required for optimal performance. For example, one vector may be used to express SaCas9 or slaucas 9 and one or more guide RNAs targeting a first genomic target (e.g., a pair of guide RNAs that together bind to regions flanking the genomic target), and a second vector may be used to express multiple copies of the same guide RNA (e.g., the same pair of guide RNAs in the first vector) or different guide RNAs targeting the same or different genomic targets. As another example, multiple copies of the same guide RNA may be advantageous, and the use of smaller Cas9 allows multiple copies of the guide RNA to be incorporated into the same vector as Cas9, and allows even more copies of the guide RNA to be incorporated when combined with a second vector. The benefits of compositions and methods utilizing these configurations are reduced manufacturing costs, reduced complexity of administration routes and protocols, and maximum flexibility in targeting the same or different genomic target sequences with multiple copies of the same or different guide RNAs. In some cases, providing multiple copies of the same guide RNA improves the efficiency of the guide, thereby improving a successful system.

Provided herein are compositions and methods for treating DMD using smaller Cas9s from staphylococcus aureus (SaCas 9) and staphylococcus lucas9 (lucas 9). Compositions are provided that comprise a single AAV vector comprising a nucleic acid molecule encoding SaCas9 or slaucas 9 and a guide RNA.

Accordingly, the following non-limiting embodiments are provided.

Embodiment A1 is a composition comprising:

a. a single nucleic acid molecule comprising:

i. nucleic acids encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) and at least one, at least two or at least three guide RNAs; or (b)

Nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (lucas 9) and 1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid; or (b)

Nucleic acids encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) and 1, 2 or 3 guide RNAs; or (b)

b. Two nucleic acid molecules comprising:

i. a first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9); and

a second nucleic acid encoding either one of the following, but not encoding SaCas9 or slaucas 9:

1. At least one, at least two, at least three, at least four, at least five, or at least six guide RNAs; or (b)

2.1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid; or (b)

3. One to six guide RNAs; or (b)

A first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9); and

1. at least one, at least two, or at least three guide RNAs; or (b)

3.1, 2 or 3 guide RNAs; and

a second nucleic acid that does not encode SaCas9 or slaucas 9, optionally wherein the second nucleic acid comprises any one of:

3. One to six guide RNAs; or (b)

A first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) and at least one, at least two or at least three guide RNAs; and

a second nucleic acid encoding one to six guide RNAs that does not encode SaCas9 or slaucas 9; or (b)

A first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) and at least two guide RNAs, wherein at least one guide RNA binds to the sequence of interest upstream and at least one guide RNA binds to the sequence of interest downstream; and

a second nucleic acid encoding at least one additional copy of each guide RNA encoded in the first nucleic acid that does not encode SaCas9 or SlucAs9,

wherein the guide RNA targets a region in the dystrophin gene.

Embodiment A2 is a composition comprising two nucleic acid molecules comprising: i) A first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) for excision of a portion of the DMD gene, a first guide RNA and a second guide RNA; and ii) a second nucleic acid encoding at least 2 or at least 3 copies of the first guide RNA and at least 2 or at least 3 copies of the second guide RNA.

Embodiment A3 is a composition comprising one or more nucleic acid molecules encoding an endonuclease and a pair of guide RNAs, wherein each guide RNA targets a different sequence in a DMD gene, wherein the endonuclease and guide RNA pair are capable of excision of a DNA fragment from the DMD gene; wherein the DNA fragment is between 5 and 250 nucleotides in length.

Embodiment A4 is the composition of claim 3, wherein the endonuclease is a type 2 II Cas endonuclease.

Embodiment A5 is the composition of claim 3, wherein the class 2 type II Cas endonuclease is SpCas9, saCas9, or slaucas 9.

Embodiment A6 is the composition of claim 3, wherein the endonuclease is not a class 2V Cas endonuclease.

Embodiment A7 is the composition of claim 3, wherein the excised DNA fragment comprises a splice acceptor site or a splice donor site.

Embodiment A8 is the composition of claim 3, wherein the excised DNA fragment comprises a premature stop codon in the DMD gene.

Embodiment A9 is the composition of claim 3, wherein the excised DNA segment does not comprise the complete exon of the DMD gene.

Embodiment a10 is the composition of any one of claims 1-9, wherein the guide RNA comprises any one of:

a. when SaCas9 is used, one or more spacer sequences selected from any one of SEQ ID NOs 1-35, 1000-1078 and 3000-3069; or (b)

b. When SluCas9a is used, one or more spacer sequences selected from any of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; or (b)

c. When SaCas9 is used, one or more spacer sequences comprising at least 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs 1-35, 1000-1078 and 3000-3069; or (b)

d. When using SluCas9a, one or more spacer sequences comprising at least 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; or (b)

e. When SaCas9 is used, one or more spacer sequences that are at least 90% identical to any one of SEQ ID NOs 1-35, 1000-1078, and 3000-3069; or (b)

f. When SluCas9 is used, one or more spacer sequences that are at least 90% identical to any of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; or (b)

g. When SaCas9 is used with at least two guide RNAs, the first and second spacer sequences are selected from any one of the following spacer sequences pairs: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; or (b)

h. When SaCas9 is used with at least two guide RNAs, at least 17, 18, 19, 20 or 21 contiguous nucleotides of a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; or (b)

i. When SaCas9 is used with at least two guide RNAs, it is at least 90% identical to the first and second spacer sequences selected from any one of the following spacer sequences pairs: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; or (b)

j. When slaucas 9 is used with at least two guide RNAs, a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; or (b)

k. When slaucas 9 is used with at least two guide RNAs, at least 17, 18, 19, 20 or 21 contiguous nucleotides of a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; or (b)

l. when slaucas 9 is used with at least two guide RNAs, it is at least 90% identical to the first and second spacer sequences selected from any one of the following spacer sequences pairs: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; or (b)

m. when slaucas 9 is used with at least two guide RNAs, it is at least 90% identical to the first and second spacer sequences selected from any one of the following spacer sequences pairs:

SEQ ID NOS 148 and 134,

SEQ ID Nos. 145 and 131,

SEQ ID Nos 144 and 149;

SEQ ID Nos. 144 and 150; and

SEQ ID Nos 146 and 148; or (b)

n. when SaCas9-KKH is used with at least two guide RNAs, it is at least 90% identical to the first and second spacer sequences selected from any one of the following spacer sequences pairs:

SEQ ID NOS 12 and 1013; and

SEQ ID Nos. 12 and 1016.

Embodiment a11 is a composition comprising a single nucleic acid molecule encoding one or more guide RNAs and Cas9, wherein the single nucleic acid molecule comprises:

a. a first nucleic acid encoding one or more spacer sequences selected from any one of SEQ ID NOs 1-35, 1000-1078 or 3000-3069, and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9); or (b)

b. A first nucleic acid encoding one or more spacer sequences selected from any one of SEQ ID NOs 100-225, 2000-2116 or 4000-4251, and a second nucleic acid encoding Staphylococcus luCas 9; or (b)

c. A first nucleic acid encoding one or more spacer sequences comprising at least 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs 1-35, 1000-1078 or 3000-3069 and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9); or (b)

d. A first nucleic acid encoding one or more spacer sequences comprising at least 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs 100-225, 2000-2116 or 4000-4251 and a second nucleic acid encoding staphylococcus lucas 9; or (b)

e. A first nucleic acid encoding one or more spacer sequences at least 90% identical to any one of SEQ ID NOs 1-35, 1000-1078 or 3000-3069 and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9); or (b)

f. A first nucleic acid encoding one or more spacer sequences at least 90% identical to any one of SEQ ID NOs 100-225, 2000-2116 or 4000-4251 and a second nucleic acid encoding staphylococcus lucas 9; or (b)

g. A first nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9); or (b)

h. A first nucleic acid encoding a pair of guide RNAs comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9); or (b)

i. A first nucleic acid encoding a pair of guide RNAs that are at least 90% identical to a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9); or (b)

j. A first nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; and a second nucleic acid encoding staphylococcus lucas 9; or (b)

k. A first nucleic acid encoding a pair of guide RNAs comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; and a second nucleic acid encoding staphylococcus lucas 9; or (b)

A first nucleic acid encoding a pair of guide RNAs that are at least 90% identical to a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; and a second nucleic acid encoding staphylococcus lucas 9; or (b)

A first nucleic acid encoding a pair of guide RNAs that are at least 90% identical to a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs:

SEQ ID NOS 148 and 134,

SEQ ID Nos. 145 and 131,

SEQ ID Nos 144 and 149;

SEQ ID Nos. 144 and 150;

SEQ ID Nos 146 and 148;

and a second nucleic acid encoding staphylococcus lucas 9; or (b)

SEQ ID NOS 12 and 1013; and

SEQ ID Nos. 12 and 1016;

and a second nucleic acid encoding SaCas 9-KKH.

Embodiment a12 is a composition comprising one or more nucleic acid molecules encoding staphylococcus lucas9 and at least two guide RNAs, wherein a first guide RNA and a second guide RNA target different sequences in the DMD gene, wherein the first guide RNA and the second guide RNA comprise sequences that are at least 90% identical to a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs:

SEQ ID NOS 148 and 134,

SEQ ID Nos. 145 and 131,

SEQ ID Nos 144 and 149;

SEQ ID Nos. 144 and 150;

SEQ ID Nos 146 and 148.

Embodiment a13 is a composition comprising one or more nucleic acid molecules encoding an endonuclease and at least two guide RNAs, wherein the guide RNAs each target a different sequence in a DMD gene, wherein the guide RNAs each comprise a sequence that is at least 90% identical to a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs:

SEQ ID NOS 12 and 1013; and

SEQ ID Nos. 12 and 1016; and

b. a second nucleic acid encoding SaCas 9-KKH.

Embodiment a14 is the composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least two guide RNAs.

Embodiment a15 is the composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least three guide RNAs.

Embodiment a16 is the composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least four guide RNAs.

Embodiment a17 is the composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least five guide RNAs.

Embodiment a18 is the composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least six guide RNAs.

Embodiment a19 is the composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least seven guide RNAs.

Embodiment a20 is the composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least eight guide RNAs.

Embodiment a21 is the composition of any one of the preceding claims, wherein the first nucleic acid comprises a nucleotide sequence encoding an endonuclease and at least one, at least two, or at least three guide RNAs.

Embodiment a22 is the composition of any one of the preceding claims, wherein the first nucleic acid comprises a nucleotide sequence encoding an endonuclease and 1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid.

Embodiment a23 is the composition of any one of the preceding claims, wherein the first nucleic acid comprises a nucleotide sequence encoding an endonuclease and one to three guide RNAs.

Embodiment a24 is the composition of any one of the preceding claims, wherein the second nucleic acid, when present, encodes at least one, at least two, at least three, at least four, at least five, or at least six guide RNAs.

Embodiment a25 is the composition of any one of the preceding claims, wherein the second nucleic acid, when present, encodes from 1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid.

Embodiment a26 is the composition of any one of the preceding claims, wherein the second nucleic acid, when present, encodes one to six guide RNAs.

Embodiment a27 is the composition of any one of the preceding claims, wherein the second nucleic acid, when present, encodes 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, or 2-3 guide RNAs.

Embodiment a28 is the composition of any one of the preceding claims, wherein the second nucleic acid, when present, encodes 2, 3, 4, 5, or 6 guide RNAs.

Embodiment a29 is the composition of any one of the preceding claims, comprising at least two nucleic acid molecules, wherein the guide RNAs encoded by the first nucleic acid and the second nucleic acid are identical.

Embodiment a30 is the composition of any one of the preceding claims, comprising at least two nucleic acid molecules, wherein the guide RNAs encoded by the first nucleic acid and the second nucleic acid are different.

Embodiment a31 is the composition of any of the preceding claims, comprising at least two nucleic acid molecules encoding at least two guide RNAs, wherein at least one guide RNA binds to a target sequence within an exon in the DMD gene that is upstream of a premature stop codon, and wherein at least one guide RNA binds to a target sequence within an exon in the DMD gene that is downstream of a premature stop codon.

Embodiment a32 is the composition of any one of the preceding claims, comprising at least two nucleic acid molecules, wherein the first nucleic acid molecule and the second nucleic acid molecule each encode the same guide RNA.

Embodiment a33 is the composition of any one of the preceding claims, comprising at least two nucleic acid molecules each encoding at least one guide RNA, wherein the guide RNA encoded by the second nucleic acid molecule binds to the same target sequence as the guide RNA in the first nucleic acid molecule.

Embodiment a34 is the composition of any one of the preceding claims, comprising at least two nucleic acid molecules, wherein the second nucleic acid molecule encodes at least 2, at least 3, at least 4, at least 5, or at least 6 guide RNAs, wherein the guide RNAs in the second nucleic acid molecule bind to the same target sequence as the guide RNAs in the first nucleic acid molecule.

Embodiment a35 is the composition of any one of the preceding claims, wherein the composition comprises at least two nucleic acid molecules, wherein the first nucleic acid molecule comprises a sequence encoding an endonuclease, wherein the second nucleic acid molecule encodes a first guide RNA and a second guide RNA, wherein the first guide RNA is not the same sequence as the second guide RNA, and wherein the second nucleic acid molecule does not encode an endonuclease.

Embodiment a36 is the composition of claim 35, wherein the first nucleic acid molecule also encodes a copy of the first guide RNA and a copy of the second guide RNA.

Embodiment a37 is the composition of claim 35 or 36, wherein the second nucleic acid molecule encodes two copies of the first guide RNA and two copies of the second guide RNA.

Embodiment a38 is the composition of any one of claims 35-37, wherein the second nucleic acid molecule encodes three copies of the first guide RNA and three copies of the second guide RNA.

Embodiment a39 is the composition of any one of claims 35-37, wherein the first nucleic acid molecule comprises, in terms of the positive strand: a reverse complement of the first guide RNA backbone sequence, a reverse complement of a nucleotide sequence encoding the first guide RNA sequence, a reverse complement of a promoter for expressing the nucleotide sequence encoding the first guide RNA sequence, a promoter for expressing the nucleotide sequence encoding an endonuclease, a polyadenylation sequence, a promoter for expressing the second guide RNA in the same direction as the promoter of the endonuclease, a second guide RNA sequence, and a second guide RNA backbone sequence.

Embodiment A40 is the composition of claim 39, wherein the promoter used to express the nucleotide sequence encoding the first guide RNA sequence in the first nucleic acid molecule is a U6 promoter and the promoter used to express the nucleotide sequence encoding the second guide RNA in the first nucleic acid molecule is a U6 promoter.

Embodiment a41 is the composition of any one of claims 35-40, wherein the first nucleic acid molecule is in a first vector, and wherein the second nucleic acid is in a separate second vector.

Embodiment a42 is the composition of any one of claims 35-41, wherein the first nucleic acid molecule encodes a staphylococcus aureus Cas9 (SaCas 9) endonuclease, and wherein the first guide RNA comprises a first sequence and the second guide RNA comprises a second sequence selected from any one of the following pairs of sequences: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018.

Embodiment A43 is the composition of claim 42, wherein the first guide RNA comprises the sequence of SEQ ID NO. 12 and the second guide RNA comprises the sequence of SEQ ID NO. 1013.

Embodiment a44 is the composition of any one of claims 35-43, wherein the first nucleic acid molecule encodes a staphylococcus lucas9 endonuclease, and wherein the first guide RNA comprises a first sequence and the second guide RNA comprises a second sequence selected from any one of the following sequence pairs: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146.

Embodiment A45 is a composition according to claim 44, wherein:

i. the first guide RNA comprises the sequence of SEQ ID No. 148 and the second guide RNA comprises the sequence of SEQ ID No. 134; or (b)

The second guide RNA comprises the sequence of SEQ ID NO:145 and the second guide RNA comprises the sequence of SEQ ID NO: 131.

Embodiment a46 is the composition of any one of claims 35-45, wherein the first nucleic acid is in a first vector, and wherein the second nucleic acid is in a separate second vector.

Embodiment A47 is the composition of claim 46, wherein the first vector and the second vector are viral vectors.

Embodiment A48 is the composition of claim 47, wherein the viral vector is an AAV9 vector.

Embodiment A49 is the composition of claim 48, wherein the AAV9 vector has a size from ITR to ITR (including two ITRs) of less than 5kb, less than 4.9kb, less than 4.85kb, less than 4.8kb, or less than 4.75kb, respectively.

Embodiment A50 is a composition according to claim 48 or 49, wherein the AAV9 vector has a size ranging from ITR to ITR (including two ITRs) of 3.9-5kb, 4-5kb, 4.2-5kb, 4.4-5kb, 4.6-5kb, 4.7-5kb, 3.9-4.9kb, 4.2-4.9kb, 4.4-4.9kb, 4.7-4.9kb, 3.9-4.85kb, 4.2-4.85kb, 4.4-4.85kb, 4.6-4.85kb, 4.7-4.9kb, 3.9-4.8kb, 4.2-4.8kb, 4.4-4.8kb or 4.6-4.8kb, respectively.

Embodiment a51 is the composition of any one of claims 47-50, wherein the first vector has a size from ITR to ITR (including two ITRs) of between 4.4-4.85 kb.

Embodiment a52 is the composition of any one of the preceding claims, wherein the guide RNA binds to one or more sequences of interest within the DMD gene.

Embodiment a53 is the composition of any one of the preceding claims, wherein the guide RNA binds to one or more target sequences within an exon of the DMD gene.

Embodiment a54 is the composition of any one of the preceding claims, comprising two guide RNAs, wherein i) each guide RNA targets a sequence within an exon; ii) a guide RNA targets sequences within exons and a targeting sequence within introns; or iii) sequences within each guide RNA targeting intron.

Embodiment a55 is the composition of any one of the preceding claims, comprising at least two guide RNAs, wherein i) each guide RNA targets the same genomic target sequence; ii) each guide RNA targets a different target sequence; or iii) at least one guide RNA targets one sequence and at least one guide RNA targets a different sequence.

Embodiment a56 is the composition of any one of the preceding claims comprising a guide RNA that binds to an exon of the DMD gene, wherein the exon is selected from the group consisting of exons 43, 44, 45, 50, 51 and 53.

Embodiment a57 is the composition of any one of the preceding claims, comprising at least two guide RNAs that bind to exons of a DMD gene, wherein at least one guide RNA binds to a sequence of interest within an exon of a DMD gene and at least one guide RNA binds to a different sequence of interest within the same exon of a DMD gene.

Embodiment a58 is the composition of any one of the preceding claims, comprising at least two guide RNAs, wherein at least one guide RNA binds to a target sequence within an exon that is upstream of a premature stop codon and at least one guide RNA binds to a target sequence within an exon that is downstream of a premature stop codon.

Embodiment a59 is the composition of any one of the preceding claims, comprising at least two guide RNAs, wherein at least one guide RNA binds to a target sequence within an exon of a DMD gene and at least one guide RNA binds to a different target sequence within the same exon of the DMD gene, wherein a portion of the exon is excised upon expression in vivo or in vivo.

Embodiment a60 is the composition of any one of the preceding claims, comprising at least two guide RNAs, wherein the guide RNAs, after expression in vitro or in vivo, in combination with an RNA-guided endonuclease excises a portion of the exon.

Embodiment a61 is the composition of any one of the preceding claims, comprising at least two guide RNAs, wherein after expression of the guide RNAs in vitro or in vivo, in combination with an RNA-guided endonuclease cleaves a portion of the exons, and wherein the remaining exon portions after cleavage are rejoined via one nucleotide insertion.

Embodiment a62 is the composition of any one of the preceding claims, comprising at least two guide RNAs, wherein after expression of the guide RNAs in vitro or in vivo, in combination with an RNA-guided endonuclease cleaves a portion of the exons, wherein the remaining exon portions after cleavage are rejoined without nucleotide insertion.

Embodiment a63 is the composition of any one of the preceding claims, comprising at least two guide RNAs, wherein the guide RNAs, after expression in vitro or in vivo, in combination with an RNA-guided endonuclease excises a portion of the exon, wherein the excised portion of the exon is between 5 and 250 nucleotides in length dimension.

Embodiment a64 is a composition according to any one of the preceding claims, comprising at least two guide RNAs, wherein after expression of the guide RNAs in vitro or in vivo, in combination with an RNA-guided endonuclease a portion of the exon is excised and the excised portion of the exon is between 5 and 250, 5 and 200, 5 and 150, 5 and 100, 5 and 75, 5 and 50, 5 and 25, 5 and 10, 20 and 250, 20 and 200, 20 and 150, 20 and 100, 20 and 75, 20 and 50, 20 and 25, 50 and 250, 50 and 200, 50 and 150, 50 and 100 and 50 and 75 nucleotides in size.

Embodiment a65 is the composition of any of the preceding claims, comprising at least two guide RNAs, wherein the guide RNAs, after expression in vitro or in vivo, in combination with an RNA-guided endonuclease excises a portion of the exon, wherein the excised portion of the exon is between 8 and 167 nucleotides in size.

Embodiment a66 is the composition of any one of the preceding claims, wherein the guide RNA is sgRNA.

Embodiment a67 is the composition of any one of the preceding claims, wherein the guide RNA is modified.

Embodiment a68 is the composition of any of the preceding claims, wherein the guide RNA is modified, and wherein the modification alters one or more 2' positions and/or phosphodiester linkages.

Embodiment a69 is the composition of any one of the preceding claims, wherein the guide RNA is modified, and wherein the modification alters one or more or all of the first three nucleotides of the guide RNA and/or the last three nucleotides of the sgRNA.

Embodiment a70 is the composition of any one of claims 66-68, wherein the modification alters one or more or all of the last three nucleotides of the guide RNA.

Embodiment a71 is the composition of any one of the preceding claims, wherein the guide RNA is modified, and wherein the modification comprises one or more of a phosphorothioate modification, a 2' -OMe modification, a 2' -O-MOE modification, a 2' -F modification, a 2' -O-methine-4 ' bridge modification, a 3' -thiophosphonoacetate modification, or a 2' -deoxy modification.

Embodiment a72 is the composition of any one of the preceding claims, wherein the composition further comprises a pharmaceutically acceptable excipient.

Embodiment a73 is the composition of any one of the preceding claims, wherein the composition binds to a Lipid Nanoparticle (LNP).

Embodiment a74 is the composition of any one of the preceding claims, wherein the composition is conjugated to a viral vector.

Embodiment a75 is the composition of any one of the preceding claims, wherein the composition is in combination with a viral vector, and wherein the viral vector is an adeno-associated viral vector, a lentiviral vector, an integrase-deficient lentiviral vector, an adenoviral vector, a vaccinia viral vector, an alphaviral vector, or a herpes simplex viral vector.

Embodiment a76 is the composition of any one of the preceding claims, wherein the composition is associated with a viral vector, and wherein the viral vector is an adeno-associated virus (AAV) vector.

Embodiment a77 is the composition of any one of the preceding claims, wherein the composition binds to a viral vector, wherein the viral vector is an adeno-associated virus (AAV) vector, and wherein the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh10, AAVrh74, or AAV9 vector, wherein a number following AAV is indicative of an AAV serotype.

Embodiment a78 is the composition of any one of the preceding claims, wherein the composition is associated with a viral vector, wherein the viral vector is an adeno-associated virus (AAV) vector, and wherein the AAV vector is an AAV serotype 9 (AAV 9) vector.

Embodiment a79 is the composition of claim 78, wherein the AAV serotype 9 vector has a size from ITR to ITR (including two ITRs) of less than 5kb, less than 4.9kb, less than 4.85kb, less than 4.8kb, or less than 4.75kb.

Embodiment A80 is the composition of claim 78 or 79, wherein the AAV serotype 9 vector has a size ranging from ITR to ITR (including both ITRs) ranging from 3.9-5kb, 4-5kb, 4.2-5kb, 4.4-5kb, 4.6-5kb, 4.7-5kb, 3.9-4.9kb, 4.2-4.9kb, 4.4-4.9kb, 4.7-4.9kb, 3.9-4.85kb, 4.2-4.85kb, 4.4-4.85kb, 4.6-4.85kb, 4.7-4.9kb, 3.9-4.8kb, 4.2-4.8kb, 4.4-4.8kb or 4.6-4.8 kb.

Embodiment a81 is the composition of any one of claims 78-80, wherein the AAV serotype 9 vector has a size ranging from ITR to ITR (including two ITRs) between 4.4 and 4.85 kb.

Embodiment a82 is the composition of any one of the preceding claims, wherein the composition is associated with a viral vector, wherein the viral vector is an adeno-associated virus (AAV) vector, and wherein the AAV vector is an AAVrh10 vector.

Embodiment a83 is the composition of any one of the preceding claims, wherein the composition is associated with a viral vector, wherein the viral vector is an adeno-associated virus (AAV) vector, and wherein the AAV vector is an AAVrh74 vector.

Embodiment a84 is the composition of any one of the preceding claims, wherein the composition is in combination with a viral vector, wherein the viral vector comprises a tissue specific promoter.

Embodiment a85 is the composition of any one of the preceding claims, wherein the composition is in combination with a viral vector, wherein the viral vector comprises a muscle-specific promoter, optionally wherein the muscle-specific promoter is a muscle creatine kinase promoter, a desmin promoter, an MHCK7 promoter, an SPc5-12 promoter, or a CK8e promoter.

Embodiment a86 is the composition of any one of the preceding claims, wherein the composition is associated with a viral vector, wherein the viral vector comprises any one or more of the following promoters: u6, H1 and 7SK promoters.

Embodiment a87 is the composition of any of the preceding claims, comprising a nucleic acid encoding SaCas9, wherein at least one guide RNA comprises a spacer sequence selected from any of SEQ ID NOs 12, 15, 16, 20, 27, 28, 32, 33 and 35.

Embodiment a88 is the composition of any one of the preceding claims, comprising a nucleic acid encoding SaCas9, wherein the SaCas9 comprises the amino acid sequence SEQ ID No. 711.

Embodiment a89 is the composition of any one of the preceding claims, comprising a nucleic acid encoding SaCas9, wherein the SaCas9 is a variant of amino acid sequence SEQ ID No. 711.

Embodiment a90 is the composition of any one of the preceding claims, comprising a nucleic acid encoding SaCas9, wherein the SaCas9 comprises an amino acid sequence selected from any one of SEQ ID NOs 715-717.

Embodiment a91 is the composition of any one of the preceding claims, comprising a nucleic acid encoding slaucas 9, wherein at least one guide RNA comprises a spacer sequence selected from any one of: 131, 134, 135, 136, 139, 144, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224 and 225.

Embodiment a92 is the composition of any one of the preceding claims comprising a nucleic acid encoding slaucas 9, wherein the slaucas 9 comprises the amino acid sequence SEQ ID NO 712.

Embodiment a93 is the composition of any one of the preceding claims comprising a nucleic acid encoding slaucas 9, wherein said slaucas 9 is a variant of amino acid sequence SEQ ID No. 712.

Embodiment a94 is the composition of any one of the preceding claims comprising a nucleic acid encoding slaucas 9, wherein said slaucas 9 comprises an amino acid sequence selected from any one of SEQ ID NOs 718-720.

Embodiment a95 is the composition of claim 1, wherein the single nucleic acid molecule or the first nucleic acid comprises, in terms of the positive strand, from 5 'to 3': a reverse complement of a nucleotide sequence encoding the first guide RNA backbone sequence, a reverse complement of a nucleotide sequence encoding the first guide RNA sequence, a reverse complement of a promoter for expressing a nucleotide sequence encoding the first guide RNA sequence, a promoter for expressing a nucleotide sequence encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (lucas 9), a nucleotide sequence encoding SaCas9 or slacas 9, a polyadenylation sequence, a promoter for expressing the second guide RNA in the same direction as the promoter of SaCas9 or slacas 9, a nucleotide sequence encoding the second guide RNA sequence, and a nucleotide sequence encoding the second guide RNA backbone sequence.

Embodiment a96 is the composition of claim 95, wherein the promoter for expressing the nucleic acid encoding the first guide RNA sequence is a U6 promoter and the promoter for expressing the nucleic acid encoding the second guide RNA is a U6 promoter.

Embodiment a97 is the composition of claim 95 or 96, wherein the SaCas9 or slaucas 9 comprises at least two Nuclear Localization Signals (NLS).

Embodiment a98 is the composition of claim 97, wherein the SaCas9 or slaucas 9 comprises a c-Myc NLS fused to the N-terminus of the SaCas9 or slaucas 9, optionally through a linker.

Embodiment a99 is the composition of claim 97 or 98, wherein the SaCas9 or slaucas 9 comprises an SV40 NLS fused to the C-terminus of the SaCas9 or slaucas 9, optionally through a linker.

Embodiment a100 is the composition of any one of claims 97-99, wherein the SaCas9 or slaucas 9 comprises a nucleoplasmin NLS fused to the C-terminus of the SaCas9 or slaucas 9, optionally through a linker.

Embodiment a101 is the composition of any one of claims 97-100, wherein the SaCas9 or slaucas 9 comprises:

i. a c-Myc NLS optionally fused to the N-terminus of the SaCas9 or slaucas 9 by a linker,

SV40 NLS fused to the C-terminus of said SaCas9 or slaucas 9, optionally through a linker, and

a nucleoplasmin NLS fused to the C-terminus of said SV40 NLS, optionally via a linker.

Embodiment a102 is the composition of any one of claims 95-101, wherein the backbone sequence of the first guide RNA comprises the sequence SEQ ID No. 901.

Embodiment a103 is the composition of any one of claims 95-101, wherein the backbone sequence of the second guide RNA comprises the sequence SEQ ID No. 901.

Embodiment a104 is the composition of any one of claims 95-103, wherein the size of the single nucleic acid molecule or the first nucleic acid is less than 5kb, less than 4.9kb, 4.85kb, 4.8kb, or 4.75kb.

Embodiment A105 is the composition of any one of claims 95-104, wherein the size of the single nucleic acid molecule or the first nucleic acid is between 3.9-5kb, 4-5kb, 4.2-5kb, 4.4-5kb, 4.6-5kb, 4.7-5kb, 3.9-4.9kb, 4.2-4.9kb, 4.4-4.9kb, 4.7-4.9kb, 3.9-4.85kb, 4.2-4.85kb, 4.4-4.85kb, 4.6-4.85kb, 4.7-4.9kb, 3.9-4.8kb, 4.2-4.8kb, 4.4-4.8kb, or 4.6-4.8 kb.

Embodiment a106 is the composition of claim 105, wherein the size of the single nucleic acid molecule or the first nucleic acid from ITR to ITR is between 4.4-4.85 kb.

Embodiment A107 is a composition comprising a guide RNA encoded by a sequence comprising any one of SEQ ID NOs 1-35, 1000-1078 or 3000-3069 or the complement thereof.

Embodiment A108 is a composition comprising a guide RNA encoded by a sequence comprising any of SEQ ID NOs 100-225, 2000-2116 or 4000-4251 or the complement thereof.

Embodiment a109 is a composition of any one of claims 1-108 for use in treating Duchenne Muscular Dystrophy (DMD).

Embodiment a110 is the composition of any one of claims 1-108 for generating one or more double strand breaks in any one or more of exons 43, 44, 45, 50, 51 or 53 of an dystrophin gene.

Embodiment a111 is a method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering the composition of any one of claims 1-107 to a cell.

Embodiment a112 is a method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

i. a nucleic acid encoding one or more guide RNAs, wherein the one or more guide RNAs comprise:

1. A spacer sequence selected from SEQ ID NO 1-35, 1000-1078 or 3000-3069;

2. a spacer sequence comprising at least 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NOs 1-35, 1000-1078 or 3000-3069; or (b)

3. A spacer sequence at least 90% identical to any one of SEQ ID NOs 1-35, 1000-1078, 3000-3069; and

nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9).

Embodiment a113 is a method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

a. a nucleic acid molecule encoding one or more guide RNAs, wherein the one or more guide RNAs comprise:

i. a spacer sequence selected from the group consisting of SEQ ID NO. 100-225, 2000-2116 or 4000-4251;

a spacer sequence comprising at least 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NO:100-225, 2000-2116 or 4000-4251; or (b)

A spacer sequence at least 90% identical to any one of SEQ ID NOs 100-225, 2000-2116 or 4000-4251; and

b. a nucleic acid molecule encoding staphylococcus lucas 9.

Embodiment a114 is a method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

i. A nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising:

1. a first spacer sequence and a second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018;

2. a first spacer sequence and a second spacer sequence comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; or (b)

3. A first spacer sequence and a second spacer sequence that are at least 90% identical to any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; and

Nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9).

Embodiment a115 is a method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

1. a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151; and 146 and 148;

2. a first spacer sequence and a second spacer sequence comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; or (b)

3. A first spacer sequence and a second spacer sequence that are at least 90% identical to any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; and

nucleic acid encoding staphylococcus lucas 9.

Embodiment a116 is the method of any one of the preceding methods or use claims, wherein the single nucleic acid molecule is delivered to the cell on a single vector.

Embodiment a117 is the method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding SaCas9, wherein the spacer sequence is selected from any one of SEQ ID NOs 12, 15, 16, 20, 27, 28, 32, 33 and 35.

Embodiment a118 is a method according to any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding SaCas9, wherein the SaCas9 comprises the amino acid sequence SEQ ID No. 711.

Embodiment a119 is a method according to any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding SaCas9, wherein the SaCas9 is a variant of amino acid sequence SEQ ID No. 711.

Embodiment a120 is a method according to any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding SaCas9, wherein the SaCas9 comprises an amino acid sequence selected from any one of SEQ ID NOs 715-717.

Embodiment a121 is the method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding slaucas 9, wherein the spacer sequence is selected from any one of SEQ ID NOs 131, 134, 135, 136, 139, 144, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224 and 225.

Embodiment a122 is the method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding slaucas 9, wherein said slaucas 9 comprises the amino acid sequence SEQ ID NO 712.

Embodiment a123 is the method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding slaucas 9, wherein said slaucas 9 is a variant of amino acid sequence SEQ ID No. 712.

Embodiment a124 is the method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding slaucas 9, wherein said slaucas 9 comprises an amino acid sequence selected from any one of SEQ ID NOs 718-720.

Embodiment a125 is a method of using a premature stop codon to excise a portion of an exon in a subject suffering from Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

i. a nucleic acid encoding a pair of guide RNAs, wherein a first guide RNA binds to a target sequence within the exon upstream of the premature stop codon and wherein a second guide RNA binds to a sequence downstream of the premature stop codon and downstream of the sequence to which the first guide RNA binds; and

nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9);

wherein the guide RNA pair and SaCas9 excise a portion of the exon.

Embodiment a126 is a method of using a premature stop codon to excise a portion of an exon in a subject suffering from Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

nucleic acid encoding staphylococcus lucas 9;

wherein the guide RNA pair and SaCas9 excise a portion of the exon.

Embodiment a127 is the method of any one of the preceding method claims, comprising a single nucleic acid molecule, wherein the single nucleic acid molecule is delivered to the cell on a single vector.

Embodiment a128 is the method of any one of the preceding method claims, wherein a portion of the DMD gene is excised, and wherein the gene portion remaining after excision is rejoined using single nucleotide insertion.

Embodiment a129 is the method of any of the preceding method claims, wherein a portion of the DMD gene is excised, and wherein the remaining exon portions after excision are rejoined without nucleotide insertion.

Embodiment a130 is the method of any one of the preceding method claims, wherein a portion of the DMD gene is excised, wherein the excised portion of the gene is between 5 and 250, 5 and 200, 5 and 150, 5 and 100, 5 and 75, 5 and 50, 5 and 25, 5 and 10, 20 and 250, 20 and 200, 20 and 150, 20 and 100, 20 and 75, 20 and 50, 20 and 25, 50 and 250, 50 and 200, 50 and 150, 50 and 100, and 50 and 75 nucleotides in size.

Embodiment a131 is the method of any one of the preceding method claims, wherein a portion of the DMD gene is excised, wherein the excised portion of the exon is between 8 and 167 nucleotides in size.

Embodiment a132 is the method of any one of the preceding method claims, wherein a portion of the DMD gene is excised, wherein the portion is within exons 43, 44, 45, 50, 51 or 53.

Embodiment a133 is the method of any one of the preceding method claims, comprising a pair of guide RNAs, wherein the pair of guide RNAs comprises a first spacer sequence and a second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018.

Embodiment a134 is the method of any one of the preceding method claims, comprising a pair of guide RNAs, wherein the pair of guide RNAs comprises a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146.

Embodiment a135 is the method of any one of the preceding method claims, comprising SaCas9, wherein the SaCas9 comprises the amino acid sequence SEQ ID No. 715.

Embodiment a136 is the composition or method of any of the preceding claims, wherein the single nucleic acid molecule is an AAV vector, wherein the vector comprises from 5 'to 3' in terms of the plus strand: the reverse complement of the first sgRNA backbone sequence, the reverse complement of the nucleic acid encoding the first sgRNA guide sequence, the reverse complement of the promoter for expressing the nucleic acid encoding the first sgRNA, the promoter (e.g., CK8 e) for expressing the nucleic acid encoding SaCas9, the polyadenylation sequence, the promoter for expressing the second sgRNA in the same direction as the promoter of SaCas9, the second sgRNA guide sequence, and the second sgRNA backbone sequence.

Embodiment a137 is the composition or method of claim 136, wherein the promoter for expressing the first sgRNA guide sequence is an hU6 promoter.

Embodiment a138 is the composition or method of any one of claims 136-137, wherein the promoter used to express the second sgRNA guide sequence is an hU6 promoter.

Embodiment a139 is the composition or method of any one of claims 136-137, wherein the promoter for expressing the first sgRNA guide sequence is a hU6 promoter and the promoter for expressing the second sgRNA guide sequence is a hU6 promoter.

Embodiment a140 is the composition or method of any of claims 136-137, wherein the promoter for expressing the nucleic acid encoding the first sgRNA guide sequence is a 7SK promoter.

Embodiment a141 is the composition or method of any one of claims 136-137, wherein the promoter for expressing the nucleic acid encoding the second sgRNA guide sequence is a 7SK promoter.

Embodiment a142 is the composition or method of any one of claims 136-137, wherein the promoter for expressing the nucleic acid encoding the second sgRNA guide sequence is an H1m promoter.

Embodiment a143 is the composition or method of any of the preceding claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to a nucleic acid sequence encoding one or more Nuclear Localization Sequences (NLS).

Embodiment a144 is the composition or method of any of the preceding claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS).

Embodiment a145 is the composition or method of any of the preceding claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS).

Embodiment a146 is the composition or method of any of the preceding claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS).

Embodiment a147 is the composition or method of any one of claims 143-146, wherein the one or more NLS comprises an SV40 NLS.

Embodiment a148 is the composition or method of any one of claims 143-147, wherein the one or more NLS comprises a c-Myc NLS.

Embodiment a149 is the composition or method of any one of claims 143-148, wherein the one or more NLS comprise a nucleoprotein NLS.

Embodiment a150 is the composition or method of any of the preceding claims, wherein the nucleic acid encoding the guide RNA or the nucleic acid encoding the pair of guide RNAs comprises a sequence selected from any of SEQ ID NOs 600, 601, or 900-917, and wherein the composition or method comprises a nucleic acid encoding slaucas 9.

Embodiment a151 is the composition or method of any of the preceding claims, wherein the nucleic acid encoding the guide RNA or the nucleic acid encoding the pair of guide RNAs comprises a sequence selected from any of SEQ ID NOs 901-917, and wherein the composition or method comprises a nucleic acid encoding slaucas 9.

Embodiment a152 is the composition of any one of the preceding claims, wherein the nucleic acid molecule encodes at least a first and a second guide RNA.

Embodiment a153 is the composition of claim 152, wherein the nucleic acid molecule encodes a spacer sequence of a first guide RNA, a backbone sequence of a first guide RNA, a spacer sequence of a second guide RNA, and a backbone sequence of a second guide RNA.

Embodiment a154 is the composition of claim 152, wherein the spacer sequence of the first guide RNA is identical to the spacer sequence of the second guide RNA.

Embodiment a155 is the composition of claim 152, wherein the spacer sequence of the first guide RNA is different from the spacer sequence of the second guide RNA.

Embodiment a156 is the composition of any one of claims 153-155, wherein the backbone sequence of the first guide RNA is identical to the backbone sequence of the second guide RNA.

Embodiment a157 is the composition of any of claims 153-154, wherein the backbone sequence of the first guide RNA is different from the backbone sequence of the second guide RNA.

Embodiment a158 is the composition of claim 157, wherein the backbone sequence of the first guide RNA comprises a sequence selected from the group consisting of SEQ ID NOs 901-916, and wherein the backbone sequence of the second guide RNA comprises a different sequence selected from the group consisting of SEQ ID NOs 901-916.

Drawings

Fig. 1 provides a simplified depiction of several representative carrier configurations. The single line arrow indicates the direction of expression of the sgRNA, while the double line arrow indicates the direction of expression of the Cas9 protein. The promoter columns indicate representative promoters for expression of sgrnas. In a particular embodiment, the Cas9 promoter may be CK8e.

FIG. 2 shows an exemplary schematic of a site-specific insertion/deletion distribution as described in example 2, including editing categories for insertions and deletions.

Figures 3A-3B show the editing frequency and insertion/deletion distribution of selected slecas 9 and SaCas9 sgrnas targeting exon 45 of DMD gene in human HEK293FT cells (figure 3A) and mouse Neuro-2a cells (figure 3B). The high performance sgrnas of SpCas9 are included as references (E45 Sp 52). Each bar represents sgRNA and bar height depicts the total insertion/deletion frequency average. The insertion/deletion distribution for each sgRNA is shown below: solid black (1-nucleotide (nt) insertions that cause frame reconstruction, sometimes referred to as "rf.+1"); solid white (insertions/deletions other than 1-nt insertions that cause frame reconstruction, sometimes referred to as "RF. others"); a checkerboard pattern (insertion/deletion of a ± 6=nt window that breaks the exon/intron boundary, called "exon skipping"); diagonal (other insertions/deletions, sometimes referred to as "OE"). The data are the average of 3 replicates.

Figures 4A-4B show the editing frequency and insertion/deletion distribution of selected slecas 9 and SaCas9 sgrnas targeting exon 51 of DMD genes in human HEK293FT cells (figure 4A) and mouse Neuro-2a cells (figure 4B). The high performance sgrnas of SpCas9 are included as references (E51 Sp 32). Each bar represents sgRNA and bar height depicts the total insertion/deletion frequency average. The insertion/deletion distribution for each sgRNA is shown below: solid black (1-nucleotide (nt) insertions that cause frame reconstruction, sometimes referred to as "rf.+1"); solid white (insertions/deletions other than 1-nt insertions leading to frame reconstruction, called "RF. others"); a checkerboard pattern (insertion/deletion of a ± 6=nt window that breaks the exon/intron boundary, called "exon skipping"); diagonal (other insertions/deletions, sometimes referred to as "OE" or "other insertions/deletions"). The data are the average of 3 replicates.

Fig. 5A-5B show the editing frequency and insertion/deletion distribution of selected slecas 9 and SaCas9 sgrnas within exon 53 of DMD genes in human HEK293FT cells (fig. 5A) and mouse Neuro-2a cells (fig. 5B). The high performance sgrnas of SpCas9 are included as references (E53 Sp 63). Each bar represents sgRNA and bar height depicts the total insertion/deletion frequency average. The insertion/deletion profile for each sgRNA was as follows using different colors: solid black (1-nucleotide (nt) insertions that cause frame reconstruction, sometimes referred to as "rf.+1"); solid white (insertions/deletions other than 1-nt insertions leading to frame reconstruction, called "RF. others"); a checkerboard pattern (insertion/deletion of a ± 6=nt window that breaks the exon/intron boundary, called "exon skipping"); diagonal (other insertions/deletions, referred to as "OE" or "other insertions/deletions"). The data are the average of 3 replicates.

FIGS. 6A-D show the editing frequency and insertion/deletion distribution of selected SaCas9-KKH and SlucAs9 sgRNA pairs within exon 45 of HEK293FT cells (FIG. 6B) and Neuro-2a cells (FIG. 6D). Fig. 6A shows an editing schematic. The singly cut sgrnas of SaCas9 (SaCas 9-4) are included as references (fig. 6C). Each bar represents sgRNA and bar height depicts the total insertion/deletion frequency average. The insertion/deletion distribution for each sgRNA is shown using a different pattern. Error bar = upper limit of SEM for each insertion/deletion group.

Fig. 7A shows the nucleotide composition and RNA secondary structure of stem loop I in different slecas 9 one-way guide RNA backbones. The key differences in sequence and secondary structure between Slu-VCGT-4.5, slu-VCGT-4 and Slu-VCGT-5 are depicted. Square and triangle show the secondary structural differences of the upper stem. Diamonds and pentagons show single nucleotide changes of the basal stem.

Fig. 7B is a histogram showing two slaucas 9 sgRNA candidates: percentage of different types of insertions/deletions produced by slaucas 9-23 and slaucas 9-24. For each guide RNA, three backbones were tested, including Slu-VCGT-4.5, slu-VCGT-4 and Slu-VCGT-5. Each sgRNA was tested at three different RNP doses. The exact amount of the slecas 9 protein and sgRNA tested was 6.75pmol:37.5pmol for low doses, 12.5pmol:75pmol for medium doses, and 25pmol:150pmol for high doses. The different colors of the bars in the histogram represent the different types of insertions/deletions produced by the sgrnas. The black represents the percentage of +1bp insertions. White indicates the percentage of other insertions and deletions of the reading frame that are likely to repair the mutation in the particular DMD patient of interest. These are referred to as "RF others" which represent the sum of 2, 5, 8, 11bp deletions within the alignment window of-20 bp to +20bp surrounding the Cas9 cleavage site. The remaining insertions/deletions shown in the pattern are categorized as "other insertions/deletions".

Fig. 8 shows the editing frequency and insertion/deletion distribution of selected slecas 9 sgrnas within exon 45 in initial human skeletal myoblasts (hsmms). Two single-cut sgrnas of SpCas9 (EX-145, E45Sp 52) and slaucas 9 (slaucas 9-24) are included as references. Each bar represents an sgRNA or a pair of sgrnas and bar heights depict the total insertion/deletion frequency average. Different patterns are used to show the insertion/deletion distribution. Error bar = upper bound of SD for each insertion/deletion group.

Fig. 9A and 9B show the editing frequency and insertion/deletion distribution of selected SaCas9-KKH and slecas 9 sgRNA pairs within exon 51 in HEK293FT cells. Each bar represents an sgRNA or a pair of sgrnas and bar heights depict the total insertion/deletion frequency average. Different patterns are used to show the insertion/deletion distribution. Error bar = upper bound of SD for each insertion/deletion group.

Fig. 10A and 10B show the editing frequency and insertion/deletion distribution of selected AAV vectors in C2C12 myotubes. Fig. 10A shows three test guides and fig. 10B shows 4 test guides. Each bar represents a different AAV configuration and bar heights depict the total insertion/deletion frequency average. Different patterns are used to show the insertion/deletion distribution. Error bar = upper bound of SD for each insertion/deletion group.

FIG. 11 shows vector genomic quantification of selected AAV vectors in C2C12 myotubes. Each bar represents a different AAV configuration and bar height depicts the average vector genome copy number per μg of DNA. Error bar = upper limit of SD.

Fig. 12A and 12B show transgenic expression of selected AAV vectors in C2C12 myotubes. Fig. 12A: each bar represents a different AAV configuration and bar height depicts an average Cas9 transgene copy per μg rna. Cas9 nucleases are shown using different patterns. Fig. 12B: each bar represents a different sgRNA and bar height depicts the average sgRNA transgene copy number per μg RNA. Promoter combinations are shown using different patterns. Error bar = upper limit of SD.

Figure 13 shows Cas9 localization of selected AAV vectors in C2C12 myotubes. In fig. 13 and throughout this application, single-line arrows indicate the direction of expression of sgrnas, while double-line or "thick" arrows (with or without embedded "X") indicate the direction of expression of Cas9 proteins. The position of the slaucas 9 is shown in the lower panel of each figure; MYOG is shown with representative arrows, DAPI is shown with representative larger bold arrows. The images are displayed on a scale of 20-25 μm.

Fig. 14A and 14B show the editing frequency and insertion/deletion distribution of selected AAV vectors in the heart (fig. 14A) and quadriceps (fig. 14B) of the dEx44 mouse model. Each bar represents a different AAV configuration and bar heights depict the total insertion/deletion frequency average. Different patterns are used to show the insertion/deletion distribution. Error bar = upper bound of SD for each insertion/deletion group.

Fig. 15A and 15B show dystrophin repair achieved by the selected AAV vector in the heart (fig. 15A) and quadriceps (fig. 15B) of the dEx mouse model. Each group represents a different AAV configuration and the horizontal bars depict the average total dystrophin levels.

Fig. 16A and 16B show vector genome quantification of selected AAV vectors in the heart (fig. 16A) and quadriceps (fig. 16B) of a dEx44 mouse model. Each group represents a different AAV configuration and horizontal bars depict the average vector genome copy number per μg of DNA.

Fig. 17A and 17B show expression of Cas9 and sgRNA transgenes by selected AAV vectors in the heart (fig. 17A) and quadriceps (fig. 17B) of a dEx44 mouse model. Each group represents a different AAV configuration and horizontal bars depict average transgene copy number per μg RNA. Filled circles indicate Cas9 mRNA expression and open circles indicate sgRNA expression.

Figures 18A-18C show the editing frequency and insertion/deletion distribution of selected Cas12i2 guide RNAs in exon 45 of HEK293FT cells for use with Cas12i2 endonucleases. Fig. 18A shows an experimental schematic, fig. 18B shows the insertion/deletion frequency of selected guide RNA pairs, and fig. 18C shows single cut sgrnas of SaCas9 (SaCas 9-4) and slaucas 9 (slaucas 9-24) as references.

Detailed Description

Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention will be described in conjunction with the illustrated embodiments, it will be understood that it is not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications and equivalents, which may be included within the invention as defined by the appended claims and the included embodiments.

Before the present teachings are described in detail, it is to be understood that this disclosure is not limited to particular compositions or method steps and that such may vary. It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a guide" includes a plurality of guides, and reference to "a cell" includes a plurality of cells, and so forth.

Numerical ranges include numbers defining the ranges. In view of the significant figures and measurement-related errors, measured and measurable values are understood to be approximations. Furthermore, the use of "include/comprise/comprising", "contain/contain" and "include/include" is not intended to be limiting. It is to be understood that both the foregoing general description and the detailed description are exemplary and explanatory only and are not restrictive of the teachings.

Unless specifically stated otherwise in the specification, embodiments described herein as "comprising" various components are also considered as "consisting of" or "consisting essentially of" the components; embodiments described in this specification as "consisting of" various components are also contemplated as "comprising" or "consisting essentially of" the components; and embodiments in this specification that "consist essentially of the various components are also considered to be" consisting of "or" comprising "the components (such interchangeability is not applicable to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and/or (and/or)", unless the context clearly indicates otherwise.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter desired in any way. In the event that any material incorporated by reference contradicts any term defined in the specification or any other expression of the specification, the specification controls. While the present teachings are described in connection with a number of embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.

I. Definition of the definition

Unless otherwise indicated, the following terms and phrases as used herein are intended to have the following meanings:

"Polynucleotide", "nucleic acid" and "nucleic acid molecule" are used herein to refer to multimeric compounds comprising nucleosides or nucleoside analogs having nitrogen-containing heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers as analogs thereof. The nucleic acid "backbone" may be comprised of a plurality of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA; PCT No. WO 95/32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid may be ribose, deoxyribose, or similar compounds having a substitution (e.g., a 2 'methoxy or 2' halo substitution). The nitrogenous base can be a conventional base (A, G, C, T, U), an analog thereof (e.g., a modified uridine such as 5-methoxyuridine, pseudouridine, or N1-methyl pseudouridine, or others); inosine; derivatives of purines or pyrimidines (e.g. N ⁴ Methyl deoxyguanosine, deazapurine or azapurine, deazapyrimidine or azapyrimidine, pyrimidine bases having a substituent at the 5-or 6-position (e.g. 5-methylcytosine), purine bases having a substituent at the 2-, 6-or 8-position, 2-amino-6-methylaminopurine, O ⁶ -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O ⁴ -alkyl-pyrimidine; united states of americaPatent 5,378,825 and PCT WO 93/13121). For general discussion, see The Biochemistry of the Nucleic Acids 5-36, adams et al, 11 th edition, 1992). The nucleic acid may include one or more "abasic" residues, wherein the backbone does not include a nitrogenous base at the polymer position (U.S. Pat. No. 5,585,481). The nucleic acid may comprise only conventional RNA or DNA sugars, bases, and linkages, or may comprise conventional components with substitutions (e.g., conventional bases with 2' methoxy linkages, or polymers containing conventional bases and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNA), analogues containing one or more LNA nucleotide monomers in which the bicyclic furanose units are locked in RNA mimicking the sugar conformation, thereby enhancing the hybridization affinity for complementary RNA and DNA sequences (Vester and Wengel,2004,Biochemistry 43 (42): 13233-41). RNA and DNA have different sugar moieties and may differ in the presence of uracil or an analog thereof in RNA and thymine or an analog thereof in DNA.

"guide RNA (Guide RNA)", "guide RNA (guide RNA)" and simply "guide" are used interchangeably herein and refer to crRNA (also referred to as CRISPR RNA), or a combination of crRNA and trRNA (also referred to as tracrRNA). crRNA and trRNA can be combined as a single RNA molecule (single guide RNA, sgRNA) or as two separate RNA molecules (double guide RNA, dgRNA). "wizard RNA (Guide RNA)" or "wizard RNA (guide RNA)" refers to each type. the trRNA may be a naturally occurring sequence, or a trRNA sequence having modifications or variations as compared to a naturally occurring sequence. For clarity, the term "guide RNA" or "guide" as used herein may refer to an RNA molecule (comprising A, C, G and U nucleotides) or a DNA molecule (comprising A, C, G and T nucleotides) encoding such an RNA molecule, or the complement thereof, unless specifically stated otherwise. In general, in the case of a DNA nucleic acid construct encoding a guide RNA, the U residues in any RNA sequence described herein may be replaced with T residues, and in the case of a guide RNA construct encoded by any DNA sequence described herein, the T residues may be replaced with U residues.

As used herein, a "spacer sequence" is sometimes referred to herein and in the literature as a "spacer," "protospacer," "guide sequence," or "targeting sequence," refers to a sequence within a guide RNA that is complementary to a target sequence and used to guide the guide RNA to the target sequence for cleavage by Cas 9. The guide sequence may have a length of 24, 23, 22, 21, 20 or less base pairs, for example in the case of staphylococcus lucas9 or staphylococcus aureus (i.e., saCas 9) and related Cas9 homologs/orthologs. In a preferred embodiment, in the case of slecas 9 or SaCas9, the guide/spacer sequence has a length of at least 20 base pairs, or more specifically a length in the range of 20-25 base pairs (see, e.g., schmidt et al 2021,Nature Communications, "Improved CRISPR genome editing using small highly active and specific engineered RNA-guided nucleotides"). Shorter or longer sequences may also be used as guides, for example 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. For example, in some embodiments, the guide sequence comprises at least 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs 1-35 (for SaCas 9) and 100-225 (for slaucas 9). In some embodiments, the guide sequence comprises a sequence selected from the group consisting of SEQ ID NOS: 1-35, 100-225, 1000-1078, 2000-2116, 3000-3069, or 4000-4251. In some embodiments, the sequence of interest is located, for example, in a gene or on a chromosome, and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence may be about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%. For example, in some embodiments, the guide sequence comprises a sequence having about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to at least 17, 18, 19, 20, 21, 22, 23, 24 or 25 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOS: 1-35, 100-225, 1000-1078, 2000-2116, 3000-3069 or 4000-4251. In some embodiments, the guide sequence comprises a sequence having about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a sequence selected from the group consisting of SEQ ID NOS: 1-35, 100-225, 1000-1078, 2000-2116, 3000-3069, or 4000-4251. In some embodiments, the guide sequence may be 100% complementary or identical to the target region. In other embodiments, the guide sequence may contain at least one mismatch with the target region. For example, the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, wherein the total length of the target sequence is at least 17, 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and the region of interest may contain 1-4 mismatches, wherein the guide sequence comprises at least 17, 18, 19, 20 or more nucleotides. In some embodiments, the guide sequence and the region of interest may contain 1, 2, 3, or 4 mismatches, wherein the guide sequence comprises 20 nucleotides. In some embodiments, the guide sequence and the target region do not contain any mismatches.

In some embodiments, the guide sequence comprises a sequence selected from the group consisting of SEQ ID NOs 1-35, 100-225, 1000-1078, 2000-2116, 3000-3069, or 4000-4251, wherein if the 5 'terminal nucleotide is not guanine, one or more guanines (g) are added to the 5' end of the sequence. In some cases transcription requires 5'g or gg, e.g., expression of the RNA polymerase III-dependent U6 promoter or T7 promoter. In some embodiments, 5' guanine is added to any one of the guide sequences or guide sequence pairs disclosed herein.

The target sequence of Cas9s includes the positive and negative strands of genomic DNA (i.e., the given sequence and the reverse complement of the sequence), because the nucleic acid substrate of Cas9 is a double-stranded nucleic acid. Thus, where the guide sequence is said to be "complementary to" the target sequence, it will be appreciated that the guide sequence may direct the binding of the guide RNA to the reverse complement of the target sequence. Thus, in some embodiments, where the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., the target sequence that does not include PAM), but the T in the guide sequence is replaced with the U.

As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to guide RNAs as well as Cas9. In some embodiments, the guide RNA directs Cas9 (e.g., cas 9) to the target sequence, and the guide RNA hybridizes to the target sequence and the agent binds to the target sequence, which can then be cleaved or cleaved (in the case of modified "nickase" Cas 9).

As used herein, a first sequence is considered to "comprise a sequence having at least X% identity to a second sequence" if an alignment of the first sequence to the second sequence reveals that X% or more of the entire second sequence matches the first sequence. For example, the sequence AAGA comprises a sequence with 100% identity to the sequence AAG, since the alignment will result in 100% identity since there are matches at all three positions of the second sequence. The difference between RNA and DNA (typically, uridine is exchanged for thymidine or vice versa) and the presence of nucleoside analogues (e.g., modified uridine) does not result in a difference in identity or complementarity between polynucleotides, so long as the relevant nucleotides (e.g., thymidine, uridine or modified uridine) have the same complementary sequence (e.g., adenosine for thymidine, uridine or modified uridine as a whole; another example is cytosine and 5-methylcytosine, both with guanosine or modified guanosine as the complementary sequences). Thus, for example, the sequence 5'-AXG (where X is any modified uridine, such as pseudouridine, N1-methyl pseudouridine, or 5-methoxyuridine) is considered to be 100% identical to AUG, since both are fully complementary to the same sequence (5' -CAU). Exemplary alignment algorithms are the Smith-Waterman (Smith-Waterman) and the Needman-Wunsch algorithm, which are well known in the art. Those skilled in the art will appreciate that the algorithm selection and parameter settings are appropriate for the specific sequence pairs to be aligned; for sequences that are substantially similar in length and that are expected to be >50% (amino acids) or >75% (nucleotides) identical, the EBI provides a nidman-Wen algorithm with a nidman-Wen algorithm interface default setting at the www.ebi.ac.uk web site server that is generally appropriate.

"mRNA" is used herein to refer to a polynucleotide that is not DNA and that comprises an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation of ribosomes and aminoacylates tRNA). The mRNA may comprise a phosphate-sugar backbone comprising ribose residues or analogs thereof, such as 2' -methoxy ribose residues. In some embodiments, the saccharide in the mRNA phosphate-saccharide backbone consists essentially of ribose residues, 2' -methoxy ribose residues, or combinations thereof.

Guide sequences suitable for use in the guide RNA compositions and methods described herein are shown, for example, in table 1A, table 1B, and table 5 and throughout the specification.

As used herein, "target sequence" refers to a nucleic acid sequence in a target gene that has complementarity to at least a portion of a guide sequence of a guide RNA. Interaction of the target sequence with the guide sequence directs Cas9 binding and potentially cleavage or cleavage within the target sequence (depending on agent activity).

As used herein, "treating" refers to any administration or application of a therapeutic agent to a disease or disorder in a subject, and includes inhibiting the disease or progression of the disease (which may occur before or after the disease is formally diagnosed, e.g., where the genotype of the subject is likely or likely to cause the disease to progress), inhibiting its progression, alleviating one or more symptoms of the disease, curing the disease, or preventing recurrence of one or more symptoms of the disease. For example, DMD treatment may include alleviation of DMD symptoms.

As used herein, "ameliorating" refers to any beneficial effect on a phenotype or symptom, such as reducing its severity, slowing or delaying its progression, arresting its progression, or partially or completely reversing or eliminating it. In the case of a quantitative phenotype (e.g., expression level), the improvement encompasses altering the expression level such that it is closer to the expression level seen in healthy or uninfected cells or individuals.

By "pharmaceutically acceptable excipient" is meant an agent included in a pharmaceutical formulation that is not an active ingredient. Pharmaceutically acceptable excipients may, for example, aid in drug delivery or support or enhance stability or bioavailability.

The term "about" or "approximately" means an acceptable error of a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined.

As used herein, "staphylococcus aureus Cas9" may also be referred to as SaCas9, and includes wild-type SaCas9 (e.g., SEQ ID NO: 711) and variants thereof. The SaCas9 variant comprises one or more amino acid changes, including insertions, deletions, or substitutions of, or chemical modifications to, one or more amino acids as compared to SEQ ID NO 711.

As used herein, "staphylococcus lugdunensis Cas9" may also be referred to as slaucas 9, and includes wild-type slaucas 9 (e.g., SEQ ID NO: 712) and variants thereof. The slaucas 9 variant comprises one or more amino acid changes, including insertions, deletions, or substitutions of one or more amino acids, or chemical modifications of one or more amino acids, as compared to SEQ ID No. 712.

II composition

Provided herein are compositions suitable for treating Duchenne Muscular Dystrophy (DMD), for example using a single or multiple (e.g., at least 2) nucleic acid molecules encoding: 1) One or more guide RNAs comprising one or more guide sequences of table 1A, table 1B or table 5; and 2) SaCas9 (for SEQ ID NO:1-35, 1000-1078 or 3000-3069) or SlucAs9 (for SEQ ID NO:100-225, 2000-2116 or 4000-4251). Such compositions may be administered to a subject having or suspected of having DMD.

In some embodiments, a composition comprising, consisting of, or consisting essentially of: a single nucleic acid molecule comprising: i) Nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) and at least one, at least two or at least three guide RNAs; or ii) a nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) and 1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid; or iii) a nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) and one to three guide RNAs.

In some embodiments, a composition comprising, consisting of, or consisting essentially of: at least two nucleic acid molecules comprising a first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9); and a second nucleic acid encoding either of the following without encoding SaCas9 or slaucas 9: i) At least one, at least two, at least three, at least four, at least five, or at least six guide RNAs; or ii) 1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid; or iii) one to six guide RNAs.

In some embodiments, a composition comprising, consisting of, or consisting essentially of: at least two nucleic acid molecules comprising a first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas 9(s) and i) at least one, at least two or at least three guide RNAs; or ii) 1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid; or iii) one to three guide RNAs; and a second nucleic acid that does not encode SaCas9 or slaucas 9, optionally wherein the second nucleic acid comprises any one of: i) At least one, at least two, at least three, at least four, at least five, or at least six guide RNAs; or ii) 1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid; or iii) one to six guide RNAs.

In some embodiments, a composition comprising, consisting of, or consisting essentially of: at least two nucleic acid molecules comprising a first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) and at least one, at least two or at least three guide RNAs; and a second nucleic acid encoding one to six guide RNAs without encoding SaCas9 or slaucas 9.

In some embodiments, a composition comprising, consisting of, or consisting essentially of: at least two nucleic acid molecules comprising: a first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) and at least two guide RNAs, wherein at least one guide RNA binds upstream of the sequence to be excised and at least one guide RNA binds downstream of the sequence to be excised; and a second nucleic acid encoding at least one additional copy of the guide RNA encoded in the first nucleic acid, without encoding SaCas9 or slaucas 9. In some embodiments, the guide RNA cleaves a portion of the DMD gene, optionally cleaving an exon, an intron, or an exon/intron junction.

In some embodiments, a composition comprising, consisting of, or consisting essentially of: at least two nucleic acid molecules comprising a first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) and a first and a second guide RNA for excision of a portion of the DMD gene; and a second nucleic acid encoding at least 2 or at least 3 copies of the first guide RNA and at least 2 or at least 3 copies of the second guide RNA.

In some embodiments, a composition comprising, consisting of, or consisting essentially of: one or more nucleic acid molecules encoding an endonuclease and a pair of guide RNAs, wherein each guide RNA targets a different sequence in the DMD gene, wherein the endonuclease and guide RNA pair are capable of excision of a target sequence in DNA, the target sequence having a length of 5-250 nucleotides. In some embodiments, the endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the class 2, type II Cas endonuclease is SpCas9, saCas9, or slaucas 9. In some embodiments, the endonuclease is not a class 2, V-type Cas endonuclease. In some embodiments, the excised sequence of interest comprises a splice acceptor site or a splice donor site. In some embodiments, the excised target sequence comprises a premature stop codon in the DMD gene. In some embodiments, the excised target sequence does not comprise the complete exon of the DMD gene. In some embodiments, any of the methods and/or ribonucleoprotein complexes disclosed herein do not disrupt/specifically alter the sequence of the splice acceptor site, splice donor site, or premature stop codon site.

In some embodiments, the guide RNA in the composition comprises any one of the following:

c. When SaCas9 is used, one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs 1-35, 1000-1078 and 3000-3069; or (b)

d. When using SluCas9a, one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; or (b)

f. When SluCas9a is used, one or more spacer sequences that are at least 90% identical to any of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; or (b)

g. When SaCas9 is used with at least two guide RNAs, the first and second spacer sequences are selected from any one of the following: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; or (b)

h. When SaCas9 is used with at least two guide RNAs, at least 17, 18, 19, 20 or 21 contiguous nucleotides of a first spacer sequence and a second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; or (b)

i. When SaCas9 is used with at least two guide RNAs, the first spacer sequence and the second spacer sequence are at least 90% identical to any one selected from the group consisting of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; or (b)

j. When slaucas 9 is used with at least two guide RNAs, a first spacer sequence and a second spacer sequence selected from any one of the following: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; or (b)

k. When slaucas 9 is used with at least two guide RNAs, at least 17, 18, 19, 20 or 21 contiguous nucleotides of a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; or (b)

l. when slaucas 9 is used with at least two guide RNAs, the first spacer sequence and the second spacer sequence are at least 90% identical to any one selected from the group consisting of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; or (b)

m. when slaucas 9 is used with at least two guide RNAs, the first spacer sequence and the second spacer sequence are at least 90% identical to any one selected from the group consisting of:

SEQ ID NOS 148 and 134,

SEQ ID Nos. 145 and 131,

SEQ ID Nos 144 and 149;

SEQ ID Nos. 144 and 150; and

SEQ ID Nos 146 and 148; or (b)

n. when SaCas9 is used with at least two guide RNAs, it is at least 90% identical to the first spacer sequence and the second spacer sequence selected from any one of:

SEQ ID NOS 12 and 1013; and

SEQ ID NOS 12 and 1016.

In some embodiments, the present disclosure provides a composition comprising: a) One or more nucleic acid molecules encoding slaucas 9 and b) a first spacer sequence and a second spacer sequence selected from SEQ ID NOs 148 and 134. In some embodiments, the composition comprises: a) One or more nucleic acid molecules encoding slaucas 9 and b) a first spacer sequence and a second spacer sequence selected from SEQ ID NOs 145 and 131. In some embodiments, the composition comprises: a) One or more nucleic acid molecules encoding slaucas 9 and b) a first spacer sequence and a second spacer sequence selected from SEQ ID NOs 144 and 149. In some embodiments, the composition comprises: a) One or more nucleic acid molecules encoding slaucas 9 and b) a first spacer sequence and a second spacer sequence selected from SEQ ID NOs 144 and 150. In some embodiments, the composition comprises: a) One or more nucleic acid molecules encoding Slucas9 and b) a first spacer sequence and a second spacer sequence selected from the group consisting of SEQ ID NOs 146 and 148. In some embodiments, the composition comprises: a) One or more nucleic acid molecules encoding SaCas9 (e.g., saCas 9-KKH) and b) a first and a second spacer sequence selected from the group consisting of SEQ ID NOs 12 and 1013. In some embodiments, the composition comprises: a) One or more nucleic acid molecules encoding SaCas9 (e.g., saCas 9-KKH) and b) a first and a second spacer sequence selected from SEQ ID NOs 12 and 1016.

In some embodiments, the one or more guide RNAs directs Cas9 to a site in or near any one of exons 43, 44, 45, 50, 51 or 53 of dystrophin. For example, cas9 may be directed to cleave within 10, 20, 30, 40, or 50 nucleotides of the target sequence.

The disclosure may refer herein to "first and second spacers" or "first and second guide RNAs, grnas or sgrnas" followed by one or more pairs of specific sequences. It should be noted that the order of the sequences in the pair is not intended to be limited to the order in which they are presented. For example, the phrase "the first and second sgrnas comprise the sequences of SEQ ID NOs 10 and 15" may mean that the first sgRNA comprises the sequence of SEQ ID NO 10 and the second sgRNA sequence comprises the sequence of SEQ ID NO 15, or that this phrase may mean that the first sgRNA comprises the sequence of SEQ ID NO 15 and the second sgRNA sequence comprises the sequence of SEQ ID NO 10.

In some embodiments, a composition is provided comprising a single nucleic acid molecule encoding one or more guide RNAs and Cas9, wherein the single nucleic acid molecule comprises:

a. a first nucleic acid encoding one or more spacer sequences selected from any one of SEQ ID NOs 1-35, 1000-1078 or 3000-3069, and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9);

b. A first nucleic acid encoding one or more spacer sequences selected from any one of SEQ ID NOs 100-225, 2000-2116 or 4000-4251, and a second nucleic acid encoding Staphylococcus luCas 9;

c. a first nucleic acid encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs 1-35, 1000-1078 or 3000-3069, and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9);

d. a first nucleic acid encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs 100-225, 2000-2116 or 4000-4251 and a second nucleic acid encoding staphylococcus lucas 9;

e. a first nucleic acid encoding one or more spacer sequences that are at least 90% identical to any one of SEQ ID NOs 1-35, 1000-1078, or 3000-3069, and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9);

f. a first nucleic acid encoding one or more spacer sequences that are at least 90% identical to any one of SEQ ID NOs 100-225, 2000-2116 or 4000-4251 and a second nucleic acid encoding staphylococcus lucas 9;

g. A first nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising a first spacer sequence and a second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9);

h. a first nucleic acid encoding a pair of guide RNAs comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of a first spacer sequence and a second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9);

i. A first nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs being at least 90% identical to the first spacer sequence and the second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9);

j. a first nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; and a second nucleic acid encoding staphylococcus lucas 9;

k. A first nucleic acid encoding a pair of guide RNAs comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; and a second nucleic acid encoding staphylococcus lucas 9;

a first nucleic acid encoding a pair of guide RNAs that are at least 90% identical to a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; and a second nucleic acid encoding staphylococcus lucas 9;

A first nucleic acid encoding a pair of guide RNAs that are at least 90% identical to a first spacer sequence and a second spacer sequence selected from any one of:

SEQ ID NOS 148 and 134,

SEQ ID Nos. 145 and 131,

SEQ ID Nos 144 and 149;

SEQ ID Nos. 144 and 150;

SEQ ID Nos. 146 and 148; and a second nucleic acid encoding staphylococcus lucas 9; or (b)

SEQ ID NOS 12 and 1013; and

SEQ ID NOS 12 and 1016; and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9).

In some embodiments, a composition comprising, consisting of, or consisting essentially of: one or more nucleic acid molecules encoding staphylococcus lucas9 and at least two guide RNAs, wherein a first guide RNA and a second guide RNA target different sequences in the DMD gene, wherein the first guide RNA and the second guide RNA comprise a sequence that is at least 90% identical to a first spacer sequence and a second spacer sequence selected from any one of:

SEQ ID NOS 148 and 134,

SEQ ID Nos. 145 and 131,

SEQ ID Nos 144 and 149;

SEQ ID Nos. 144 and 150;

SEQ ID Nos 146 and 148.

In some embodiments, a composition comprising, consisting of, or consisting essentially of: one or more nucleic acid molecules encoding an endonuclease and at least two guide RNAs, wherein the guide RNAs each target a different sequence in a DMD gene, wherein the guide RNAs each comprise a sequence that is at least 90% identical to a first spacer sequence and a second spacer sequence selected from any one of:

SEQ ID NOS 12 and 1013; and

SEQ ID Nos. 12 and 1016; and

a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9).

In some embodiments, the first nucleic acid and/or the second nucleic acid, when present, comprises at least two guide RNAs. In some embodiments, the first nucleic acid and/or the second nucleic acid, when present, comprises at least three guide RNAs. In some embodiments, the first nucleic acid and/or the second nucleic acid, when present, comprises at least four guide RNAs. In some embodiments, the first nucleic acid and/or the second nucleic acid, when present, comprises at least five guide RNAs. In some embodiments, the first nucleic acid and/or the second nucleic acid, when present, comprises at least six guide RNAs. In some embodiments, the first nucleic acid comprises an endonuclease and at least one, at least two, or at least three guide RNAs. In some embodiments, the first nucleic acid comprises an endonuclease and 1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid. In some embodiments, the first nucleic acid comprises an endonuclease and one to three guide RNAs.

In some embodiments, the second nucleic acid, when present, encodes at least one, at least two, at least three, at least four, at least five, or at least six guide RNAs. In some embodiments, the second nucleic acid, when present, encodes from 1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid. In some embodiments, the second nucleic acid, when present, encodes one to six guide RNAs. In some embodiments, the second nucleic acid, when present, encodes 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, or 2-3 guide RNAs. In some embodiments, the second nucleic acid, when present, encodes 2, 3, 4, 5, or 6 guide RNAs.

In some embodiments comprising at least two nucleic acid molecules, the guide RNA encoded by the first nucleic acid is identical to the guide RNA encoded by the second nucleic acid. In some embodiments comprising at least two nucleic acid molecules, the guide RNA encoded by the first nucleic acid is different from the guide RNA encoded by the second nucleic acid. In some embodiments comprising at least two nucleic acid molecules, at least one guide RNA binds to a target sequence within an exon of the DMD gene that is upstream of a premature stop codon, and wherein at least one guide RNA binds to a target sequence within an exon of the DMD gene that is downstream of a premature stop codon. In some embodiments comprising at least two nucleic acid molecules, the same guide RNA is encoded by a nucleic acid of a first nucleic acid molecule and a second nucleic acid molecule. In some embodiments comprising at least two nucleic acid molecules, the guide RNA encoded by the second nucleic acid molecule binds to the same target sequence as the guide RNA in the first nucleic acid molecule. In some embodiments comprising at least two nucleic acid molecules, the second nucleic acid molecule encodes at least 2, at least 3, at least 4, at least 5, or at least 6 guide RNAs, wherein the guide RNAs in the second nucleic acid molecule bind to the same target sequence as the guide RNAs in the first nucleic acid molecule.

In some embodiments, the guide RNA binds to one or more target sequences within the DMD gene. In some embodiments, the guide RNA binds to one or more target sequences within an exon of the DMD gene. In some embodiments comprising two guide RNAs, i) each guide RNA targets a sequence within an exon; ii) a guide RNA targets sequences within exons and a targeting sequence within introns; or iii) sequences within each guide RNA targeting intron.

In some embodiments comprising at least two guide RNAs, i) each guide RNA targets the same genomic target sequence; ii) each guide RNA targets a different target sequence; or iii) at least one guide RNA targets one sequence and at least one guide RNA targets a different sequence.

In some embodiments, the guide RNA comprises an exon that binds to the DMD gene, the exon is selected from the group consisting of exons 43, 44, 45, 50, 51, and 53.

In some embodiments comprising at least two guide RNAs that bind to exons of the DMD gene, at least one guide RNA binds to a sequence of interest within an exon of the DMD gene, and at least one guide RNA binds to a different sequence of interest within the same exon of the DMD gene.

In some embodiments comprising at least two guide RNAs, at least one guide RNA binds to a target sequence within an exon that is upstream of a premature stop codon, and at least one guide RNA binds to a target sequence within an exon that is downstream of a premature stop codon.

In some embodiments comprising at least two guide RNAs, at least one guide RNA binds to a target sequence within an exon in the DMD gene and at least one guide RNA binds to a different target sequence within the same exon in the DMD gene, wherein a portion of the exon is excised when expressed in vivo or in vivo. In some embodiments comprising at least two guide RNAs, wherein the guide RNAs cleave a portion of an exon upon in vivo or in vivo expression.

In some embodiments comprising at least two guide RNAs, wherein after expression in vivo or in vivo, the guide RNAs cleave a portion of the exons, and wherein the remaining exons portions after cleavage are rejoined via one nucleotide insertion. In some embodiments comprising at least two guide RNAs, wherein upon in vivo or in vivo expression, the guide RNAs cleave a portion of the exons, wherein the remaining exons portions after cleavage are rejoined via nucleotide insertion.

In some embodiments comprising at least two guide RNAs, wherein the guide RNAs cleave a portion of an exon after expression in vivo or in vivo, wherein the cleaved portion of the exon has a length dimension of between 5, 6, 7, 8, 9, 10, 15 or 20 and 250 nucleotides. In some embodiments comprising at least two guide RNAs, after expression in vivo or in vivo, the guide RNAs excise a portion of the exons, wherein the excised portion of the exons is between 5 and 250, 5 and 200, 5 and 150, 5 and 100, 5 and 75, 5 and 50, 5 and 25, 5 and 10, 20 and 250, 20 and 200, 20 and 150, 20 and 100, 20 and 75, 20 and 50, 20 and 25, 50 and 250, 50 and 200, 50 and 150, 50 and 100, and 50 and 75 nucleotides in size.

In some embodiments comprising at least two guide RNAs, wherein the guide RNAs cleave a portion of an exon after expression in vivo or in vivo, wherein the size of the cleaved portion of the exon is between 8 and 167 nucleotides.

In some embodiments, the guide RNA and Cas9 are provided on a single nucleic acid molecule. In some embodiments, a single nucleic acid molecule comprises a nucleic acid encoding a guide RNA and a nucleic acid encoding SaCas9 or slaucas 9. In some embodiments, two guide RNAs and one Cas9 are provided on a single nucleic acid molecule. In some embodiments, a single nucleic acid molecule comprises a nucleic acid encoding a first guide RNA, a nucleic acid encoding a second guide RNA, and a nucleic acid encoding SaCas9 or slaucas 9. In some embodiments, the spacer sequence of the first guide RNA and the second guide RNA is identical. In some embodiments, the spacer sequence of the first guide RNA and the second guide RNA are different.

In some embodiments, the single nucleic acid molecule is a single vector. In some embodiments, a single vector expresses one or two guide RNAs and Cas9 according to the scheme of fig. 1. In some embodiments, the guide RNA and Cas9 are provided on a single vector. In some embodiments, a single vector comprises a nucleic acid encoding a guide RNA and a nucleic acid encoding SaCas9 or slaucas 9. In some embodiments, two guide RNAs and one Cas9 are provided on a single vector. In some embodiments, a single vector comprises a nucleic acid encoding a first guide RNA, a nucleic acid encoding a second guide RNA, and a nucleic acid encoding SaCas9 or slaucas 9. In some embodiments, the spacer sequence of the first guide RNA and the second guide RNA is identical. In some embodiments, the spacer sequence of the first guide RNA and the second guide RNA are different.

Each guide sequence shown in tables 1A, 1B, and 5 may also include additional nucleotides to form or encode a crRNA, for example, using any known sequence suitable for Cas9 being used. In some embodiments, the crRNA comprises (5 'to 3') at least one spacer sequence and a first complementary domain. The first complementary domain is sufficiently complementary to the second complementary domain, which can be part of the same molecule (in the case of sgrnas) or in a tracrRNA (in the case of duplex or modular grnas) to form a duplex. For a detailed discussion of crRNA and gRNA domains comprising a first complementary domain and a second complementary domain see, e.g., US 2017/0007679.

The single molecule guide RNA (sgRNA) may comprise an optional spacer extension sequence, a spacer sequence, a minimal CRISPR repeat sequence, a single molecule guide linker, a minimal tracrRNA sequence, a 3' tracrRNA sequence and/or an optional tracrRNA extension sequence in the 5' to 3' direction. The optional tracrRNA extension sequence may comprise elements that contribute additional functions (e.g., stability) to the guide RNA. A single molecule guide linker can link the smallest CRISPR repeat to the smallest tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension sequence may comprise one or more hairpins. In particular embodiments, the present disclosure provides sgrnas comprising a spacer sequence and a tracrRNA sequence.

In the 5' to 3' orientation, an exemplary framework sequence located after the 3' end of the guide sequence, suitable for use with SaCas9, is: GTTTAAGTACTCTGTGCTGGAAACA GCACAGAATCTACTTAAACAAGGCAAAATGCCGTGTTTATCTCG TCAACTTGTTGGCGAGA (SEQ ID NO: 500). In some embodiments, the exemplary framework sequence used with SaCas9 following the 3' end of the guide sequence is a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID No. 500, or a sequence that differs from SEQ ID No. 500 by NO more than 1, 2, 3, 4, 5, 10, 15, 20 or 25 nucleotides.

In some embodiments, variants of the SaCas9 framework sequence may be used. In some embodiments, the SaCas9 scaffold located after the 3' end of the guide sequence is referred to as the "Sa scaffold V1" and is in the 5' to 3' orientation: GTTTTAGTACTCTGGAAACAGAATC TACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTT GGCGAGAT (SEQ ID NO: 501). In some embodiments, an exemplary framework sequence for use with SaCas9 that is located after the 3' end of the guide sequence is a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID No. 910, or a sequence that differs from SEQ ID No. 910 by NO more than 1, 2, 3, 4, 5, 10, 15, 20 or 25 nucleotides.

In some embodiments, variants of the SaCas9 framework sequence may be used. In some embodiments, the SaCas9 scaffold located after the 3' end of the guide sequence is referred to as the "Sa scaffold V2" and is in the 5' to 3' orientation: GTTTAAGTACTCTGTGCTGGAAACA GCACAGAATCTACTTAAACAAGGCAAAATGCCGTGTTTATCTCG TCAACTTGTTGGCGAGAT (SEQ ID NO: 502). In some embodiments, an exemplary framework sequence for use with SaCas9 that is located after the 3' end of the guide sequence is a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID No. 911, or a sequence that differs by NO more than 1, 2, 3, 4, 5, 10, 15, 20 or 25 nucleotides from SEQ ID No. 911.

In some embodiments, variants of the SaCas9 framework sequence may be used. In some embodiments, the SaCas9 scaffold located after the 3' end of the guide sequence is referred to as the "Sa scaffold V3" and is in the 5' to 3' orientation: GTTTAAGTACTCTGGAAACAGAATC TACTTAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTT GGCGAGAT (SEQ ID NO: 503). In some embodiments, the exemplary framework sequences used with SaCas9 following the 3' end of the guide sequence are sequences that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO 912, or sequences that differ from SEQ ID NO 912 by NO more than 1, 2, 3, 4, 5, 10, 15, 20 or 25 nucleotides.

In some embodiments, variants of the SaCas9 framework sequence may be used. In some embodiments, the SaCas9 scaffold located after the 3' end of the guide sequence is referred to as the "Sa scaffold V5" and is in the 5' to 3' orientation: GTTTCAGTACTCTGGAAACAGAATCTACTGAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGAT (SEQ ID NO: 932). In some embodiments, the exemplary framework sequences used with SaCas9 following the 3' end of the guide sequence are sequences that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:932, or sequences that differ from SEQ ID NO:932 by NO more than 1, 2, 3, 4, 5, 10, 15, 20 or 25 nucleotides.

In the 5' to 3' orientation, two exemplary framework sequences located after the 3' end of the guide sequence, suitable for use with slecas 9, are: GTTTTAGTACTCTGGAAACAGAATCTACTGAAACAAGACAATATGTCGTGTTTATCCCATCAATTTATTGGTGGGA (SEQ ID NO: 900) and GTTTAAGTACTCTGTGCTGGAAACAGCACAGAATCTACTGAAACAAGACAATATGTCGTGTTTATCCCATCAATTTATTGGTGGGA (SEQ ID NO: 601). In some embodiments, exemplary sequences for use with slecas 9 that are located after the 3' end of the guide sequence are sequences that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID No. 900 or SEQ ID No. 601, or sequences that differ by NO more than 1, 2, 3, 4, 5, 10, 15, 20, or 25 nucleotides from SEQ ID No. 900 or SEQ ID No. 601.

Exemplary framework sequences (5 ' to 3' orientation) for use with slaucas 9 following the 3' end of the guide sequence are also shown below:

/>

in some embodiments, the backbone sequence, located after the 3 'end of the guide sequence in the 5' to 3 orientation, suitable for use with slecas 9 is selected from any one of SEQ ID NOs 900 or 601 or 901-917 (see below). In some embodiments, the exemplary sequence used with the slaucas 9 following the 3' end of the guide sequence is a sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO 900 or 601 or 901-917, or a sequence that differs by NO more than 1, 2, 3, 4, 5, 10, 15, 20 or 25 nucleotides from any of SEQ ID NOs 900 or 601 or 901-917.

In some embodiments, the backbone sequence located after the 3 'end of the guide sequence in the 5' to 3 orientation, suitable for use with slecas 9, is selected from any one of SEQ ID NOs 901-917 (see below). In some embodiments, the exemplary sequence used with the slaucas 9 following the 3' end of the guide sequence is a sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any of SEQ ID NOs 901-917, or a sequence that differs by NO more than 1, 2, 3, 4, 5, 10, 15, 20 or 25 nucleotides from any of SEQ ID NOs 901-917.

In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO 900. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID No. 601. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO 900. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID No. 901. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID No. 902. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO 903. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID No. 904. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO 905. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO 906. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO 907. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO 908. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO: 909. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID No. 910. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID No. 911. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO. 912. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO. 913. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO 914. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO 915. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO 916. In some embodiments, the nucleic acid encoding a gRNA or the nucleic acid encoding a gRNA pair comprises a sequence comprising SEQ ID NO 917. In some embodiments comprising a pair of grnas, one gRNA comprises a sequence selected from any one of SEQ ID NOs 900 or 601 or 901-917. In some embodiments comprising a pair of grnas, both grnas comprise a sequence selected from any one of SEQ ID NOs 900 or 601 or 901-917. In some embodiments comprising a pair of grnas, the 3' nucleotides of the guide sequence of the grnas are the same sequence. In some embodiments comprising a pair of grnas, the 3' nucleotides of the guide sequences of the grnas are different sequences.

In some embodiments, stem loop 1 of the framework sequence comprises one or more alterations compared to stem loop 1 of a wild-type slaucas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 900) or a reference slaucas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 901). In some embodiments, stem loop 2 of the framework sequence comprises one or more alterations compared to stem loop 2 of a wild-type slaucas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 900) or a reference slaucas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 901). In some embodiments, the four-loop of the framework sequence comprises one or more changes compared to the four-loop of the wild-type slecas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 900) or the reference slecas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 901). In some embodiments, the repeat region of the framework sequence comprises one or more alterations compared to the repeat region of a wild-type slecas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 900) or a reference slecas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 901). In some embodiments, the anti-repeat region of the framework sequence comprises one or more alterations compared to the anti-repeat region of the wild-type slecas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 900) or the reference slecas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 901). In some embodiments, the linker region of the framework sequence comprises one or more changes compared to the linker region of the wild-type slecas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 900) or the reference slecas 9 framework sequence (e.g., comprising the framework of sequence SEQ ID NO: 901). For a description of the framework regions, see, e.g., nishimasu et al, 2015, cell,162:1113-1126.

Where a tracrRNA is used, in some embodiments it comprises (5 'to 3') a second complementary domain and a proximal domain. In the case of sgrnas, the guide sequence forms or encodes the sgrnas along with other nucleotides, such as SEQ ID NOs: 500, or 910-912 (for SaCas 9) and 900 or 601, or 901-917 (for slaucas 9). In some embodiments, the sgRNA comprises (5 'to 3') at least one spacer sequence, a first complementary domain, a linking domain, a second complementary domain, and a proximal domain. The sgRNA or tracrRNA may also comprise a tail domain. The linking domain may be a hairpin forming domain. For a detailed discussion and examples of crRNA and gRNA domains including the second complementary domain, the linking domain, the proximal domain and the tail domain see, e.g., US 2017/0007679.

In general, in the case of a DNA nucleic acid construct encoding a guide RNA, the U residues in any RNA sequence described herein may be replaced with T residues, and in the case of a DNA encoding a guide RNA construct, the T residues may be replaced with U residues.

Provided herein are compositions comprising one or more guide RNAs or one or more nucleic acids encoding one or more guide RNAs comprising the guide sequences disclosed herein in tables 1A, 1B and 5 and throughout this specification.

In some embodiments, a composition is provided comprising a guide RNA or a nucleic acid encoding a guide RNA, wherein the guide RNA comprises 17, 18, 19, or 20 contiguous nucleotides of any one of the guide sequences disclosed herein in table 1A, table 1B, and table 5, and throughout the present specification.

In some embodiments, a composition is provided comprising a guide RNA or a nucleic acid encoding a guide RNA, wherein the guide RNA comprises a sequence having about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to at least 17, 18, 19 or 20 contiguous nucleotides of a guide sequence set forth in table 1A, table 1B and table 5 and throughout the specification.

In some embodiments, a composition is provided comprising a guide RNA or a nucleic acid encoding a guide RNA, wherein the guide RNA comprises a sequence having about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a guide sequence set forth in table 1A, table 1B and table 5 and throughout the specification.

In some embodiments, a composition is provided comprising a guide RNA or a nucleic acid encoding a guide RNA, wherein the guide RNA comprises a spacer sequence selected from any one of: 10, 12, 15, 16, 20, 27, 28, 32, 33, 35, 1001, 1003, 1005, 1010, 1012, 1013, 1016, 1017, and 1018 (for SaCas 9). In some embodiments, the spacer sequence is SEQ ID NO. 10. In some embodiments, the spacer sequence is SEQ ID NO. 12. In some embodiments, the spacer sequence is SEQ ID NO. 15. In some embodiments, the spacer sequence is SEQ ID NO. 16. In some embodiments, the spacer sequence is SEQ ID NO. 20. In some embodiments, the spacer sequence is SEQ ID NO 27. In some embodiments, the spacer sequence is SEQ ID NO. 28. In some embodiments, the spacer sequence is SEQ ID NO. 32. In some embodiments, the spacer sequence is SEQ ID NO. 33. In some embodiments, the spacer sequence is SEQ ID NO. 35. In some embodiments, the spacer sequence is SEQ ID NO. 1001. In some embodiments, the spacer sequence is SEQ ID NO. 1003. In some embodiments, the spacer sequence is SEQ ID NO 1005. In some embodiments, the spacer sequence is SEQ ID NO 1010. In some embodiments, the spacer sequence is SEQ ID NO 1012. In some embodiments, the spacer sequence is SEQ ID NO. 1013. In some embodiments, the spacer sequence is SEQ ID NO. 1016. In some embodiments, the spacer sequence is SEQ ID NO 1017. In some embodiments, the spacer sequence is SEQ ID NO. 1018.

In some embodiments, a composition is provided comprising a guide RNA or a nucleic acid encoding a guide RNA, wherein the guide RNA comprises a spacer sequence selected from any one of: SEQ ID NO 3022, 3023, 3028, 3029, 3030, 3031, 3038, 3039, 3052, 3053, 3054, 3055, 3062, 3063, 3064, 3065, 3068 and 3069 (for SaCas 9). In some embodiments, the spacer sequence is SEQ ID NO. 3022. In some embodiments, the spacer sequence is SEQ ID NO. 3023. In some embodiments, the spacer sequence is SEQ ID NO. 3028. In some embodiments, the spacer sequence is SEQ ID NO. 3029. In some embodiments, the spacer sequence is SEQ ID NO. 3030. In some embodiments, the spacer sequence is SEQ ID NO. 3031. In some embodiments, the spacer sequence is SEQ ID NO. 3038. In some embodiments, the spacer sequence is SEQ ID NO. 3039. In some embodiments, the spacer sequence is SEQ ID NO. 3052. In some embodiments, the spacer sequence is SEQ ID NO. 3053. In some embodiments, the spacer sequence is SEQ ID NO 3054. In some embodiments, the spacer sequence is SEQ ID NO. 3055. In some embodiments, the spacer sequence is SEQ ID NO 3062. In some embodiments, the spacer sequence is SEQ ID NO 3063. In some embodiments, the spacer sequence is SEQ ID NO 3064. In some embodiments, the spacer sequence is SEQ ID NO 3065. In some embodiments, the spacer sequence is SEQ ID NO 3068. In some embodiments, the spacer sequence is SEQ ID NO 3069.

In some embodiments, a composition is provided comprising a guide RNA or a nucleic acid encoding a guide RNA, wherein the guide RNA comprises a spacer sequence selected from any one of: 131, 134, 135, 136, 139, 140, 141, 144, 145, 146, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224, 225 (for slaucas 9) of SEQ ID NO. In some embodiments, the spacer sequence is SEQ ID NO. 131. In some embodiments, the spacer sequence is SEQ ID NO. 134. In some embodiments, the spacer sequence is SEQ ID NO. 135. In some embodiments, the spacer sequence is SEQ ID NO. 136. In some embodiments, the spacer sequence is SEQ ID NO 139. In some embodiments, the spacer sequence is SEQ ID NO. 140. In some embodiments, the spacer sequence is SEQ ID NO. 141. In some embodiments, the spacer sequence is SEQ ID NO. 144. In some embodiments, the spacer sequence is SEQ ID NO. 145. In some embodiments, the spacer sequence is SEQ ID NO. 146. In some embodiments, the spacer sequence is SEQ ID NO. 148. In some embodiments, the spacer sequence is SEQ ID NO:149. In some embodiments, the spacer sequence is SEQ ID NO. 150. In some embodiments, the spacer sequence is SEQ ID NO. 151. In some embodiments, the spacer sequence is SEQ ID NO. 179. In some embodiments, the spacer sequence is SEQ ID NO. 184. In some embodiments, the spacer sequence is SEQ ID NO. 201. In some embodiments, the spacer sequence is SEQ ID NO. 223. In some embodiments, the spacer sequence is SEQ ID NO 224. In some embodiments, the spacer sequence is SEQ ID NO 225.

In some embodiments, a composition is provided comprising a guide RNA or a nucleic acid encoding a guide RNA, wherein the guide RNA comprises a spacer sequence selected from any one of: 4062, 4063, 4068, 4069, 4070, 4071, 4072, 4073, 4078, 4079, 4088, 4089, 4096, 4097, 4098, 4099, 4100, 4101, 4102, 4103, 4158, 4159, 4168, 4169, 4202, 4203, 4220, 4221, 4246, 4247, 4248, 4249, 4250, 4251 (for slecas 9). In some embodiments, the spacer sequence is SEQ ID NO. 4062. In some embodiments, the spacer sequence is SEQ ID NO. 4063. In some embodiments, the spacer sequence is SEQ ID NO:4068. In some embodiments, the spacer sequence is SEQ ID NO:4069. In some embodiments, the spacer sequence is SEQ ID NO. 4070. In some embodiments, the spacer sequence is SEQ ID NO:4071. In some embodiments, the spacer sequence is SEQ ID NO:4072. In some embodiments, the spacer sequence is SEQ ID NO:4073. In some embodiments, the spacer sequence is SEQ ID NO:4078. In some embodiments, the spacer sequence is SEQ ID NO. 4079. In some embodiments, the spacer sequence is SEQ ID NO. 4088. In some embodiments, the spacer sequence is SEQ ID NO. 4089. In some embodiments, the spacer sequence is SEQ ID NO:4096. In some embodiments, the spacer sequence is SEQ ID NO. 4097. In some embodiments, the spacer sequence is SEQ ID NO. 4098. In some embodiments, the spacer sequence is SEQ ID NO. 4099. In some embodiments, the spacer sequence is SEQ ID NO:4100. In some embodiments, the spacer sequence is SEQ ID NO:4101. In some embodiments, the spacer sequence is SEQ ID NO:4102. In some embodiments, the spacer sequence is SEQ ID NO:4103. In some embodiments, the spacer sequence is SEQ ID NO:4158. In some embodiments, the spacer sequence is SEQ ID NO:4159. In some embodiments, the spacer sequence is SEQ ID NO:4168. In some embodiments, the spacer sequence is SEQ ID NO:4169. In some embodiments, the spacer sequence is SEQ ID NO 4202. In some embodiments, the spacer sequence is SEQ ID NO 4203. In some embodiments, the spacer sequence is SEQ ID NO:4220. In some embodiments, the spacer sequence is SEQ ID NO:4221. In some embodiments, the spacer sequence is SEQ ID NO:4246. In some embodiments, the spacer sequence is SEQ ID NO:4247. In some embodiments, the spacer sequence is SEQ ID NO:4248. In some embodiments, the spacer sequence is SEQ ID NO:4249. In some embodiments, the spacer sequence is SEQ ID NO:4250. In some embodiments, the spacer sequence is SEQ ID NO:4251.

In some embodiments, a composition is provided that comprises a guide RNA or a nucleic acid encoding a guide RNA, wherein the guide RNA further comprises a trRNA. In each of the compositions and method embodiments described herein, crRNA (comprising a spacer sequence) and trRNA can be combined as a single RNA (sgRNA) or can be on separate RNAs (dgrnas). In the case of sgrnas, the crRNA and trRNA components may be covalently linked, for example via phosphodiester bonds or other covalent bonds.

In one aspect, a composition is provided comprising a single nucleic acid molecule encoding or one of the following two nucleic acid molecules: 1) One or more guide RNAs comprising a guide sequence selected from any one of SEQ ID NOs 1-35, 1000-1078 or 3000-3069; and 2) SaCas9. In one aspect, a composition is provided comprising a single nucleic acid molecule encoding, or one of the molecules encoding, two of the following: 1) One or more guide RNAs comprising a guide sequence selected from any one of SEQ ID NOs 100-225, 2000-2116 or 4000-4251; and 2) slecas 9.

In one aspect, a composition is provided comprising a single nucleic acid molecule encoding, or one of the molecules encoding, two of the following: 1) One or more guide RNAs comprising a guide sequence at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91% or 90% identical to any of SEQ ID NOs 1-35, 1000-1078, 3000-3069; and 2) SaCas9. In one aspect, a composition is provided comprising a single nucleic acid molecule encoding: 1) One or more guide RNAs comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91% or 90% identical to any of SEQ ID NOs 100-225, 2000-2116 or 4000-4251; and 2) slecas 9.

In another aspect, a composition is provided comprising a single nucleic acid molecule encoding, or one of the molecules encoding, two of the following: 1) One or more guide RNAs comprising a guide sequence comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs 1-35, 1000-1078 or 3000-3069; and 2) SaCas9. In another aspect, a composition is provided comprising a single nucleic acid molecule encoding or one of the molecules encoding two of the following: 1) One or more guide RNAs comprising a guide sequence comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from any one of SEQ ID NOs 100-225, 2000-2116 or 4000-4251; and 2) slecas 9.

In any embodiment comprising a nucleic acid molecule encoding a guide RNA and/or Cas9, the nucleic acid molecule may be a vector. In some embodiments, a composition is provided comprising a single nucleic acid molecule encoding a guide RNA and Cas9, wherein the nucleic acid molecule is a vector.

Any type of carrier may be used, such as any of those described herein. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is a non-integrating viral vector (i.e., no sequences from the vector are inserted into the host chromosome). In some embodiments, the viral vector is an adeno-associated viral vector (AAV), a lentiviral vector, an integrase-deficient lentiviral vector, an adenoviral vector, a vaccinia viral vector, an alphaviral vector, or a herpes simplex viral vector. In some embodiments, the vector comprises a muscle-specific promoter. Exemplary muscle-specific promoters include the muscle creatine kinase promoter, the desmin promoter, the MHCK7 promoter, or the SPc5-12 promoter. See US 2004/0175727A1; wang et al, expert Opin Drug deliv. (2014) 11,345-364; wang et al, gene Therapy (2008) 15,1489-1499. In some embodiments, the muscle-specific promoter is a CK8 promoter. In some embodiments, the muscle-specific promoter is a CK8e promoter. In any of the preceding embodiments, the vector may be an adeno-associated viral vector (AAV).

In some embodiments, the muscle-specific promoter is a CK8 promoter. The CK8 promoter has the following sequence (SEQ ID No. 700):

in some embodiments, the cell-specific promoter of the muscle cell is a CK8 promoter variant, referred to as CK8e. In some embodiments, the CK8e promoter is 436bp in size. The CK8e promoter has the following sequence (SEQ ID No. 701):

in some embodiments, the vector comprises one or more of the U6, H1, or 7SK promoters. In some embodiments, the U6 promoter is a human U6 promoter (e.g., a U6L promoter or a U6S promoter). In some embodiments, the promoter is a murine U6 promoter. In some embodiments, the 7SK promoter is a human 7SK promoter. In some embodiments, the 7SK promoter is a 7SK1 promoter. In some embodiments, the 7SK promoter is a 7SK2 promoter. In some embodiments, the H1 promoter is a human H1 promoter (e.g., H1L promoter or H1S promoter). In some embodiments, the vector comprises a plurality of guide sequences, wherein each guide sequence is under the control of a separate promoter. In some implementations, each of the plurality of guide sequences includes a different sequence. In some implementations, each of the plurality of guide sequences includes the same sequence (e.g., each of the plurality of guide sequences includes the same spacer sequence). In some embodiments, each of the plurality of guide sequences comprises the same spacer sequence and the same backbone sequence. In some embodiments, each of the plurality of guide sequences comprises a different spacer sequence and a different framework sequence. In some implementations, each of the plurality of guide sequences includes the same spacer sequence, but includes a different framework sequence. In some embodiments, each of the plurality of guide sequences comprises a different spacer sequence and a different framework sequence. In some embodiments, the individual promoters each comprise the same nucleotide sequence (e.g., a U6 promoter sequence). In some embodiments, the individual promoters each comprise a different nucleotide sequence (e.g., U6, H1, and/or 7SK promoter sequences).

In some embodiments, the U6 promoter comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 702:

in some embodiments, the H1 promoter comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 703:

in some embodiments, the 7SK promoter comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO: 704:

in some embodiments, the U6 promoter is an hU6c promoter and comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID No. 705:

in some embodiments, the U6 promoter is a variant of the hU6c promoter. In some embodiments, the variant of the hc 6c promoter comprises a replacement nucleotide compared to the sequence SEQ ID No. 705. In some embodiments, variants of the hU6c promoter comprise fewer nucleotides than 249 nucleotides of SEQ ID NO. 705. In some embodiments, variants of the hU6c promoter have fewer nucleotides in the nucleosome binding sequence of the hU6c promoter of SEQ ID NO. 705. In some embodiments, variants of the hU6c promoter lack all or at least a portion (e.g., at least 5, 10, 15, 20, 25, or 30 nucleotides) of nucleotides corresponding to nucleotides 96-125 of SEQ ID NO: 705. In some embodiments, variants of the hU6c promoter lack all or at least a portion of the nucleotides (e.g., at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides) corresponding to nucleotides 81-140 of SEQ ID NO: 705. In some embodiments, variants of the hU6c promoter lack all or at least a portion of the nucleotides (e.g., at least 10, 20, 30, 40, 50, 60, 65, 70, 75, 80, or 85 nucleotides) corresponding to nucleotides 66-150 of SEQ ID NO: 705. In some embodiments, variants of the hU6c promoter lack all or at least a portion of the nucleotides (e.g., at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or 120 nucleotides) corresponding to nucleotides 51-170 of SEQ ID NO: 705. In some embodiments, variants of the hU6c promoter lack nucleotides corresponding to nucleotides 96-125 of SEQ ID NO. 705. In some embodiments, the variant of the hU6c promoter comprises 129-219 nucleotides. In some embodiments, the variant of the hU6c promoter comprises 219 nucleotides. In some embodiments, the variant of the hU6c promoter comprises 189 nucleotides. In some embodiments, the variant of the hU6c promoter comprises 159 nucleotides. In some embodiments, the variant of the hU6c promoter comprises 129 nucleotides.

In some embodiments, the U6 promoter is hU6d30 and comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID No. 9001:

in some embodiments, the U6 promoter is an hU6d60 promoter and comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 9002:

in some embodiments, the U6 promoter is an hU6d90 promoter and comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 9003:

in some embodiments, the U6 promoter is an hU6d120 promoter and comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to sequence SEQ ID No. 9004:

in some embodiments, the 7SK promoter is a 7SK2 promoter and comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 706:

In some embodiments, the 7SK promoter is a variant of the 7SK2 promoter. In some embodiments, the variant of the promoter comprises a replacement nucleotide compared to the sequence of SEQ ID NO. 706,7SK2. In some embodiments, variants of the 7SK2 promoter, for example, comprise fewer nucleotides than 243 nucleotides of SEQ ID NO. 706. In some embodiments, variants of the 7SK2 promoter have fewer nucleotides in the nucleosome binding sequence of the 7SK2 promoter of SEQ ID NO: 706. In some embodiments, variants of the 7SK2 promoter lack all or at least a portion of the nucleotides (e.g., at least 5, 10, 15, 20, 25, or 30 nucleotides) corresponding to nucleotides 95-124 of SEQ ID NO: 706. In some embodiments, variants of the 7SK2 promoter lack all or at least a portion of the nucleotides (e.g., at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides) corresponding to nucleotides 81-140 of SEQ ID NO: 706. In some embodiments, variants of the 7SK2 promoter lack all or at least a portion of the nucleotides (e.g., at least 10, 20, 30, 40, 50, 60, 65, 70, 75, 80, 85, or 90 nucleotides) corresponding to nucleotides 67-156 of SEQ ID NO: 706. In some embodiments, variants of the 7SK2 promoter lack all or at least a portion of the nucleotides (e.g., at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or 120 nucleotides) corresponding to nucleotides 52-171 of SEQ ID NO: 706. In some embodiments, the variant of the 7SK2 promoter comprises 123-213 nucleotides. In some embodiments, the variant of the 7SK2 promoter comprises 213 nucleotides. In some embodiments, the variant of the 7SK2 promoter comprises 183 nucleotides. In some embodiments, the variant of the 7SK2 promoter comprises 153 nucleotides. In some embodiments, the variant of the 7SK2 promoter comprises 123 nucleotides.

In some embodiments, the 7SK promoter is 7SKd and comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 9006:

in some embodiments, the 7SK promoter is 7SKd and comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO: 9007:

in some embodiments, the 7SK promoter is 7SKd and comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 9008:

in some embodiments, the 7SK promoter is 7SKd and comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO: 9009:

in some embodiments, the H1 promoter is an H1m or mH1 promoter and comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 707:

In some embodiments, the Ck8e promoter comprises a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 701:

in some embodiments, the vector comprises a plurality of Inverted Terminal Repeats (ITRs). These ITRs may be AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 serotypes. In some embodiments, the ITR is an AAV2 serotype. In some embodiments, the 5' itr comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO: 709:

in some embodiments, the 3' itr comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to sequence SEQ ID NO: 710:

in some embodiments, a vector is provided comprising a single nucleic acid molecule encoding: 1) One or more guide RNAs comprising any one or more spacer sequences of SEQ ID NOs 1-35, 100-225, 1000-1078, 2000-2116, 3000-3069 or 4000-4251; and 2) SaCas9 (for SEQ ID NOS: 1-35, 1000-1078 and 3000-3069) or SlucAs9 (for SEQ ID NOS: 100-225, 2000-2116 and 4000-4251). In some embodiments, the vector is an AAV vector. In some embodiments, an AAV vector is administered to a subject to treat DMD. In some embodiments, only one vector is required as specific guide sequences are used that are suitable in the context of SaCas9 or slaucas 9.

In some embodiments, the vector comprises a nucleic acid encoding a Cas9 protein (e.g., a SaCas9 or slaucas 9 protein) and further comprises a nucleic acid encoding one or more single guide RNAs. In some embodiments, the nucleic acid encoding the Cas9 protein is under the control of a CK8e promoter. In some embodiments, the nucleic acid encoding the guide RNA sequence is under the control of the nu 6c promoter. In some embodiments, the vector is AAV9.

In some embodiments, the vector comprises a plurality of nucleic acids encoding more than one guide RNA. In some embodiments, the vector comprises two nucleic acids encoding two guide RNA sequences.

In some embodiments, the vector comprises a nucleic acid encoding a Cas9 protein (e.g., a SaCas9 protein or a slaucas 9 protein), a nucleic acid encoding a first guide RNA, and a nucleic acid encoding a second guide RNA. In some embodiments, the vector does not comprise nucleic acids encoding more than two guide RNAs. In some embodiments, the nucleic acid encoding the first guide RNA is the same as the nucleic acid encoding the second guide RNA. In some embodiments, the nucleic acid encoding the first guide RNA is different from the nucleic acid encoding the second guide RNA. In some embodiments, the vector comprises a single nucleic acid molecule, wherein the single nucleic acid molecule comprises a nucleic acid encoding a Cas9 protein, a nucleic acid encoding a first guide RNA, and a nucleic acid that is the reverse complement of the coding sequence of a second guide RNA. In some embodiments, the vector comprises a single nucleic acid molecule, wherein the single nucleic acid molecule comprises a nucleic acid encoding a Cas9 protein, a nucleic acid that is the reverse complement of the coding sequence of the first guide RNA, and a nucleic acid that is the reverse complement of the coding sequence of the second guide RNA. In some embodiments, the nucleic acid encoding the Cas9 protein (e.g., the SaCas9 or slaucas 9 protein) is under the control of a CK8e promoter. In some embodiments, the first guide is under the control of a 7SK2 promoter and the second guide is under the control of an H1m promoter. In some embodiments, the first guide is under the control of an H1m promoter and the second guide is under the control of a 7SK2 promoter. In some embodiments, the first guide is under the control of the hU6c promoter and the second guide is under the control of the H1m promoter. In some embodiments, the first guide is under the control of the H1m promoter and the second guide is under the control of the hU6c promoter. In some embodiments, the nucleic acid encoding the Cas9 protein is between: a) Nucleic acids encoding guide RNAs; b) Nucleic acid sequence as the reverse complement of the coding sequence of the guide RNA; c) Between a nucleic acid encoding a first guide RNA and a nucleic acid that is the reverse complement of the coding sequence of a second guide RNA; d) Between the nucleic acid encoding the second guide RNA and the nucleic acid that is the reverse complement of the coding sequence of the first guide RNA; e) 5' to a nucleic acid encoding a guide RNA; f) 5' to a nucleic acid that is the reverse complement of the coding sequence of the guide RNA; g) 5 'to a nucleic acid encoding one of the guide RNAs and 5' to a nucleic acid that is the reverse complement of the coding sequence of the other guide RNAs; h) 3' to a nucleic acid encoding a guide RNA; i) 3' to a nucleic acid that is the reverse complement of the coding sequence of the guide RNA; or j) 3 'to a nucleic acid encoding one of the guide RNAs and 3' to a nucleic acid that is the reverse complement of the coding sequence of the other guide RNA. In some embodiments, any of the vectors disclosed herein is AAV9. In a preferred embodiment, the AAV9 vector is less than 5kb in size from ITR to ITR (including both ITRs). In particular embodiments, the AAV9 vector has a size from ITR to ITR (including two ITRs) of less than 4.9kb. In other embodiments, the AAV9 vector has a size from ITR to ITR (including two ITRs) of less than 4.85kb. In other embodiments, the AAV9 vector has a size from ITR to ITR (including two ITRs) of less than 4.8kb. In other embodiments, the AAV9 vector has a size from ITR to ITR (including two ITRs) of less than 4.75kb. In other embodiments, the AAV9 vector has a size from ITR to ITR (including two ITRs) of less than 4.7kb. In some embodiments, the size of the vector from ITR to ITR (including both ITRs) is between 3.9-5kb, 4-5kb, 4.2-5kb, 4.4-5kb, 4.6-5kb, 4.7-5kb, 3.9-4.9kb, 4.2-4.9kb, 4.4-4.9kb, 4.7-4.9kb, 3.9-4.85kb, 4.2-4.85kb, 4.4-4.85kb, 4.6-4.85kb, 4.7-4.9kb, 3.9-4.8kb, 4.2-4.8kb, 4.4-4.8kb, or 4.6-4.8 kb. In some embodiments, the size of the vector from ITR to ITR (including two ITRs) is between 4.4-4.85 kb. In some embodiments, the vector is an AAV9 vector.

In some embodiments, any of the vectors disclosed herein comprise a nucleic acid encoding at least a first guide RNA and a second guide RNA. In some embodiments, the nucleic acid comprises a spacer coding sequence of a first guide RNA, a backbone coding sequence of a first guide RNA, a spacer coding sequence of a second guide RNA, and a backbone coding sequence of a second guide RNA. In some embodiments, the spacer coding sequence of the first guide RNA (e.g., encoding any of the spacer sequences disclosed herein) is identical to the spacer coding sequence of the second guide RNA. In some embodiments, the spacer coding sequence of the first guide RNA (e.g., encoding any of the spacer sequences disclosed herein) is different from the spacer coding sequence of the second guide RNA. In some embodiments, the backbone coding sequence of the first guide RNA is identical to the backbone coding sequence of the second guide RNA. In some embodiments, the backbone coding sequence of the first guide RNA is different from the backbone coding sequence of the nucleic acid encoding the second guide RNA. In some embodiments, the backbone coding sequence of the first guide RNA comprises a sequence selected from the group consisting of SEQ ID NOS: 901-916, and the backbone coding sequence of the second guide RNA comprises a different sequence selected from the group consisting of SEQ ID NOS: 901-916. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 902. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 903. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 904. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 905. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 906. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 907. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 908. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO:901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO:909. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 910. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 911. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 912. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 913. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 914. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 915. In some embodiments, the backbone coding sequence of the first guide RNA comprises the sequence SEQ ID NO. 901 and the backbone coding sequence of the second guide RNA comprises the sequence SEQ ID NO. 916. In some embodiments, the spacer coding sequence of the first guide RNA is identical to the spacer coding sequence in the second guide RNA, and the backbone coding sequence of the first guide RNA is different from the backbone coding sequence of the nucleic acid encoding the second guide RNA.

The present disclosure provides novel AAV vector configurations. Some examples of these novel AAV vector configurations are provided herein, and the order of elements in these exemplary vectors are mentioned in a 5 'to 3' manner with respect to the positive strand. For these configurations, it is to be understood that the elements may not be directly contiguous and that there may be one or more nucleotides or one or more additional elements between the elements. However, in some embodiments, no nucleotides or additional elements may be present between the elements. Furthermore, unless otherwise indicated, "promoter for expression of element X" means that the promoter is oriented in a manner that promotes expression of said element X. In addition, unless otherwise indicated, reference to "an sgRNA backbone sequence" or "a guide RNA backbone sequence" is synonymous with "a nucleotide sequence/nucleic acid encoding an sgRNA backbone sequence" or "a nucleotide sequence/nucleic acid encoding a guide RNA backbone sequence". In some embodiments, the present disclosure provides nucleic acids encoding SaCas9 (e.g., saCas 9-KKH) or slaucas 9. In some embodiments, the nucleic acid encodes one or more nuclear localization signals (e.g., SV40NLS and/or C-Myc NLS) located on the C-terminus of the encoded SaCas9 or slaucas 9. In some embodiments, the nucleic acid encodes one or more NLSs (e.g., SV40NLS and/or C-Myc NLS) located on the C-terminus of the encoded SaCas9 or slaucas 9, and the nucleic acid does not encode an NLS located on the N-terminus of the encoded SaCas9 or slaucas 9. In some embodiments, the nucleic acid encodes one or more nuclear localization signals (e.g., SV40NLS and/or c-Myc NLS) located on the N-terminus of the encoded SaCas9 or slaucas 9. In some embodiments, the nucleic acid encodes one or more NLSs (e.g., SV40NLS and/or C-Myc NLS) located on the N-terminus of the encoded SaCas9 or slaucas 9, and the nucleic acid does not encode an NLS located on the C-terminus of the encoded SaCas9 or slaucas 9. In some embodiments, the nucleic acid encodes one or more nuclear localization signals (e.g., SV40NLS and/or C-Myc NLS) located on the C-terminus of the encoded SaCas9 or slaucas 9 and also encodes one or more NLS (e.g., SV40NLS and/or C-Myc NLS) located on the N-terminus of the encoded SaCas9 or slaucas 9. In some embodiments, the nucleic acid encodes one NLS. In some embodiments, the nucleic acid encodes two NLSs. In some embodiments, the nucleic acid encodes three NLS. One, two or three NLSs may be located at the C-terminus, the N-terminus, or any combination of the C-terminus and the N-terminus. The NLS may be fused/linked directly to the C-terminus or N-terminus or to another NLS, or may be fused/linked indirectly via a linker. In some embodiments, another domain may be in the presence or absence of a linker: a) Fusion to the N-terminus or C-terminus of a Cas protein (e.g., cas9 protein); b) Fusion with the N-terminus of the NLS, which is fused with the N-terminus of the Cas protein; or C) fused to the C-terminus of the NLS fused to the C-terminus of the Cas protein. In some embodiments, the NLS is fused to the N-terminus and/or the C-terminus of the Cas protein by a linker. In some embodiments, the NLS is fused to the N-terminus of the N-terminally fused NLS on the Cas protein by a linker, and/or the NLS is fused to the C-terminus of the C-terminally fused NLS on the Cas protein by a linker. In some embodiments, the linker is GSVD (SEQ ID NO: 550) or GSGS (SEQ ID NO: 551). In some embodiments, the Cas protein comprises a c-Myc NLS fused to the N-terminus of the Cas protein (or to an N-terminally fused NLS on the Cas protein), optionally through a linker. In some embodiments, the Cas protein comprises an SV40NLS fused to the C-terminus of the Cas protein (or a C-terminally fused NLS on the Cas protein), optionally through a linker. In some embodiments, the Cas protein comprises a nucleoplasmin NLS fused to the C-terminus of the Cas protein (or to a C-terminally fused NLS on the Cas protein), optionally through a linker. In some embodiments, the Cas protein comprises: a) c-Myc NLS fused to the N-terminus of Cas protein, optionally through a linker; b) SV40NLS fused to the C-terminus of Cas protein, optionally through a linker; and C) a nucleoplasmin NLS fused to the C-terminus of the SV40NLS, optionally via a linker. In some embodiments, the Cas protein comprises: a) c-Myc NLS fused to the N-terminus of Cas protein, optionally through a linker; b) A nucleoplasmin NLS fused to the C-terminus of the Cas protein, optionally through a linker; and C) SV40NLS fused to the C-terminus of the nucleoplasmin NLS, optionally through a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': a reverse complement of the first sgRNA backbone sequence, a reverse complement of a nucleic acid encoding the first sgRNA guide sequence, a reverse complement of a promoter for expressing the nucleic acid encoding the first sgRNA, a promoter (e.g., CK8 e) for expressing the nucleic acid encoding SaCas9, a polyadenylation sequence, a promoter for expressing the second sgRNA, a second sgRNA guide sequence, and a second sgRNA backbone sequence. In some embodiments, the promoter used to express the nucleic acid encoding the first sgRNA is any of the nu 6c promoters disclosed herein. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 705. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9001. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9002. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9003. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9004. In some embodiments, the promoter used to express the nucleic acid encoding the first sgRNA is any of the 7SK2 promoters disclosed herein. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 705. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9006. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9007. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9008. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9009. In some embodiments, the promoter used to express the nucleic acid encoding the second sgRNA is any of the nu 6c promoters disclosed herein. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 705. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9001. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9002. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9003. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9004. In some embodiments, the promoter used to express the nucleic acid encoding the second sgRNA is any of the 7SK2 promoters disclosed herein. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 705. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9006. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9007. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9008. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9009. In some embodiments, the promoter used to express the nucleic acid encoding the second sgRNA is any of the H1m promoters disclosed herein. In some embodiments, the promoter of SaCas9 is a CK8e promoter. In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to SaCas9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': the reverse complement of the first sgRNA backbone sequence, the reverse complement of the nucleic acid encoding the first sgRNA guide sequence, the reverse complement of the hU6c promoter for expressing the nucleic acid encoding the first sgRNA, the promoter (e.g., CK8 e) for expressing the nucleic acid encoding SaCas9, the polyadenylation sequence, the hU6c promoter for expressing the second sgRNA, the second sgRNA guide sequence, and the second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 16 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1010. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1012. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1013. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 1016. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1017 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 1018 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 16 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1010 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1012 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1013 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1016 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1017. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1018. In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to SaCas9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': a reverse complement of the first sgRNA backbone sequence, a reverse complement of a nucleic acid encoding the first sgRNA guide sequence, a reverse complement of a hU6c promoter for expressing a nucleic acid encoding the first sgRNA, a promoter (e.g., CK8 e) for expressing a nucleic acid encoding SaCas9, a polyadenylation sequence, a 7SK promoter for expressing the second sgRNA, a second sgRNA guide sequence, and a second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 16 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1010. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1012. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1013. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 1016. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1017 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 1018 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 16 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1010 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1012 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1013 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1016 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1017. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1018. In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to SaCas9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': a reverse complement of the first sgRNA backbone sequence, a reverse complement of a nucleic acid encoding the first sgRNA guide sequence, a reverse complement of a hU6c promoter for expressing a nucleic acid encoding the first sgRNA, a promoter (e.g., CK8 e) for expressing a nucleic acid encoding SaCas9, a polyadenylation sequence, an H1m promoter for expressing the second sgRNA, a second sgRNA guide sequence, and a second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 16 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1010. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1012. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1013. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 1016. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1017 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 1018 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 16 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1010 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1012 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1013 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1016 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1017. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1018. In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to SaCas9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': a reverse complement of the first sgRNA backbone sequence, a reverse complement of a nucleic acid encoding the first sgRNA guide sequence, a reverse complement of a 7SK promoter for expressing a nucleic acid encoding the first sgRNA, a promoter (e.g., CK8 e) for expressing a nucleic acid encoding SaCas9, a polyadenylation sequence, an H1m promoter for expressing the second sgRNA, a second sgRNA guide sequence, and a second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 16 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1010. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1012. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1013. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 1016. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1017 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 1018 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 16 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1010 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1012 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1013 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1016 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1017. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1018. In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to SaCas9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': the reverse complement of the first sgRNA backbone sequence, the reverse complement of the nucleic acid encoding the first sgRNA guide sequence, the reverse complement of the nu 6c promoter for expressing the nucleic acid encoding the first sgRNA, the promoter (e.g., CK8 e) for expressing the nucleic acid encoding SaCas9, the nucleic acid encoding SaCas9-KKH (e.g., a sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID No. 715 or a functional fragment thereof), the polyadenylation sequence, the nu 6c promoter for expressing the second sgRNA, the second sgRNA guide sequence, and the second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 16 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1010. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1012. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1013. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 1016. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1017 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 1018 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 16 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1010 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1012 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1013 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1016 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1017. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1018. In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to SaCas9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': the reverse complement of the first sgRNA backbone sequence, the reverse complement of the nucleic acid encoding the first sgRNA guide sequence, the reverse complement of the nu 6c promoter for expressing the nucleic acid encoding the first sgRNA, the promoter (e.g., CK8 e) for expressing the nucleic acid encoding SaCas9, the nucleic acid encoding SaCas9-KKH (e.g., a sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID No. 715 or a functional fragment thereof), the polyadenylation sequence, the 7SK promoter for expressing the second sgRNA, the second sgRNA guide sequence, and the second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 16 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1010. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1012. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1013. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 1016. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1017 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 1018 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 16 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1010 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1012 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1013 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1016 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1017. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1018. In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to SaCas9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': the reverse complement of the first sgRNA backbone sequence, the reverse complement of the nucleic acid encoding the first sgRNA guide sequence, the reverse complement of the nu 6c promoter for expressing the nucleic acid encoding the first sgRNA, the promoter (e.g., CK8 e) for expressing the nucleic acid encoding SaCas9, the nucleic acid encoding SaCas9-KKH (e.g., a sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID No. 715 or a functional fragment thereof), the polyadenylation sequence, the H1m promoter for expressing the second sgRNA, the second sgRNA guide sequence, and the second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 16 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1010. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1012. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1013. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 1016. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1017 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 1018 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 16 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1010 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1012 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1013 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1016 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1017. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1018. In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to SaCas9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': the reverse complement of the first sgRNA backbone sequence, the reverse complement of the nucleic acid encoding the first sgRNA guide sequence, the reverse complement of the 7SK promoter for expressing the nucleic acid encoding the first sgRNA, the promoter (e.g., CK8 e) for expressing the nucleic acid encoding SaCas9, the nucleic acid encoding SaCas9-KKH (e.g., a sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID No. 715 or a functional fragment thereof), the polyadenylation sequence, the H1m promoter for expressing the second sgRNA, the second sgRNA guide sequence, and the second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 15. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1001 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 1005. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 16 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1010. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1012. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 12 and 1013. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 10 and 1016. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1017 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 1018 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 15 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 16 and 1001. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1005 and 1003. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1003 and 16. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1010 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1012 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1013 and 12. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 1016 and 10. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1017. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 16 and 1018. In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding SaCas9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to SaCas9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': a reverse complement of the first sgRNA backbone sequence, a reverse complement of a nucleic acid encoding the first sgRNA guide sequence, a reverse complement of a promoter for expressing the nucleic acid encoding the first sgRNA, a promoter (e.g., CK8 e) for expressing the nucleic acid encoding the slaucas 9, a polyadenylation sequence, a promoter for expressing the second sgRNA, the second sgRNA guide sequence, and the second sgRNA backbone sequence. In some embodiments, the promoter used to express the nucleic acid encoding the first sgRNA is any of the nu 6c promoters disclosed herein. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 705. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9001. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9002. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9003. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9004. In some embodiments, the promoter used to express the nucleic acid encoding the first sgRNA is any of the 7SK2 promoters disclosed herein. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 7005. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9006. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9007. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9008. In some embodiments, the promoter for expressing the nucleic acid encoding the first sgRNA comprises SEQ ID NO 9009. In some embodiments, the promoter used to express the nucleic acid encoding the second sgRNA is any of the nu 6c promoters disclosed herein. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 705. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9001. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9002. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9003. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9004. In some embodiments, the promoter used to express the nucleic acid encoding the second sgRNA is any of the 7SK2 promoters disclosed herein. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 705. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9006. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9007. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9008. In some embodiments, the promoter for expressing the nucleic acid encoding the second sgRNA comprises SEQ ID NO 9009. In some embodiments, the promoter used to express the nucleic acid encoding the second sgRNA is any of the H1m promoters disclosed herein. In some embodiments, the promoter of slaucas 9 is a CK8e promoter. In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to the slacas 9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': the reverse complement of the first sgRNA backbone sequence, the reverse complement of the nucleic acid encoding the first sgRNA guide sequence, the reverse complement of the hU6c promoter for expressing the nucleic acid encoding the first sgRNA, the promoter (e.g., CK8 e) for expressing the nucleic acid encoding the slacas 9, the polyadenylation sequence, the hU6c promoter for expressing the second sgRNA, the second sgRNA guide sequence, and the second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 134. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 149 and 135. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 150 and 135. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 136. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 136. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 139 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 140 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 140 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 141 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 144 and 149. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 144 and 150. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 145 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 145 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 146 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 134 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 135 and 149. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 135 and 150. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 136 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 136 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 139. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 140. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 140. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 141. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 149 and 144. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 150 and 144. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 145. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 145. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 146. In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to the slacas 9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': the reverse complement of the first sgRNA backbone sequence, the reverse complement of the nucleic acid encoding the first sgRNA guide sequence, the reverse complement of the hU6c promoter for expressing the nucleic acid encoding the first sgRNA, the promoter (e.g., CK8 e) for expressing the nucleic acid encoding the slacas 9, the polyadenylation sequence, the 7SK promoter for expressing the second sgRNA, the second sgRNA guide sequence, and the second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 134. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 149 and 135. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 150 and 135. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 136. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 136. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 139 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 140 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 140 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 141 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 144 and 149. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 144 and 150. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 145 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 145 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 146 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 134 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 135 and 149. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 135 and 150. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 136 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 136 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 139. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 140. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 140. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 141. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 149 and 144. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 150 and 144. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 145. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 145. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 146. In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to the slacas 9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': the reverse complement of the first sgRNA backbone sequence, the reverse complement of the nucleic acid encoding the first sgRNA guide sequence, the reverse complement of the hU6c promoter for expressing the nucleic acid encoding the first sgRNA, the promoter (e.g., CK8 e) for expressing the nucleic acid encoding the slacas 9, the polyadenylation sequence, the H1m promoter for expressing the second sgRNA, the second sgRNA guide sequence, and the second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 134. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 149 and 135. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 150 and 135. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 136. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 136. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 139 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 140 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 140 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 141 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 144 and 149. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 144 and 150. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 145 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 145 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 146 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 134 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 135 and 149. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 135 and 150. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 136 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 136 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 139. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 140. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 140. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 141. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 149 and 144. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 150 and 144. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 145. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 145. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 146. In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to the slacas 9 via a linker.

In some embodiments, the AAV vector comprises, in terms of positive strand, from 5 'to 3': a reverse complement of the first sgRNA backbone sequence, a reverse complement of a nucleic acid encoding the first sgRNA guide sequence, a reverse complement of a 7SK promoter for expressing the nucleic acid encoding the first sgRNA, a promoter (e.g., CK8 e) for expressing the nucleic acid encoding the slacas 9, a polyadenylation sequence, an H1m promoter for expressing the second sgRNA, the second sgRNA guide sequence, and the second sgRNA backbone sequence. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 134. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 149 and 135. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 150 and 135. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 136. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 136. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 139 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 140 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 140 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOs 141 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 144 and 149. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 144 and 150. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 145 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS: 145 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 146 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 134 and 148. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 135 and 149. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 135 and 150. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 136 and 131. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 136 and 151. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 139. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 140. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 140. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 141. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 149 and 144. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 150 and 144. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS.131 and 145. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 151 and 145. In some embodiments, the first sgRNA and the second sgRNA comprise the sequences of SEQ ID NOS 148 and 146. In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, the nucleic acid sequence encoding slaucas 9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS). In some embodiments, one or more NLSs are SV40 NLSs. In some embodiments, one or more NLS is a c-Myc NLS. In some embodiments, the NLS is fused to the slacas 9 via a linker.

In some embodiments, the present disclosure provides compositions comprising at least two nucleic acids. In some embodiments, the composition comprises at least two nucleic acid molecules, wherein a first nucleic acid molecule comprises a sequence encoding any of the endonucleases disclosed herein (e.g., saCas9 or slaucas 9), wherein a second nucleic acid molecule encodes a first guide RNA and a second guide RNA, wherein the first guide RNA is not the same sequence as the second guide RNA, and wherein the second nucleic acid molecule does not encode an endonuclease. In some embodiments, the first nucleic acid molecule also encodes a copy of the first guide RNA and a copy of the second guide RNA. In some embodiments, the first nucleic acid molecule does not encode any guide RNAs. In some embodiments, the second nucleic acid molecule encodes two copies of the first guide RNA and two copies of the second guide RNA. In some embodiments, the second nucleic acid molecule encodes two copies of the first guide RNA and one copy of the second guide RNA. In some embodiments, the second nucleic acid molecule encodes one copy of the first guide RNA and two copies of the second guide RNA. In some embodiments, the second nucleic acid molecule comprises two copies of the first guide RNA and three copies of the second guide RNA. In some embodiments, the second nucleic acid molecule comprises three copies of the first guide RNA and two copies of the second guide RNA. In some embodiments, the second nucleic acid molecule encodes three copies of the first guide RNA and three copies of the second guide RNA. In some embodiments, the first nucleic acid molecule comprises, in terms of the positive strand, from 5 'to 3': a reverse complement of the first guide RNA backbone sequence, a reverse complement of a nucleotide sequence encoding the first guide RNA sequence, a reverse complement of a promoter for expressing the nucleotide sequence encoding the first guide RNA sequence, a promoter for expressing the nucleotide sequence encoding an endonuclease, a polyadenylation sequence, a promoter for expressing the second guide RNA in the same direction as the promoter of the endonuclease, a second guide RNA sequence, and a second guide RNA backbone sequence. In some embodiments, the promoter used to express the nucleotide sequence encoding the first guide RNA sequence in the first nucleic acid molecule is a U6 promoter and the promoter used to express the nucleotide sequence encoding the second guide RNA in the first nucleic acid molecule is a U6 promoter. In some embodiments, the first nucleic acid molecule encodes a staphylococcus aureus Cas9 (SaCas 9) endonuclease, and the first guide RNA comprises a first sequence and the second guide RNA comprises a second sequence selected from any one of the following sequence pairs: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018. In some embodiments, the first guide RNA comprises the sequence SEQ ID NO. 12 and the second guide RNA comprises the sequence SEQ ID NO. 1013. In some embodiments, the first guide RNA comprises the sequence SEQ ID NO:1013 and the second guide RNA comprises the sequence SEQ ID NO:12. In some embodiments, the first nucleic acid molecule encodes a staphylococcus lucas9 endonuclease, and wherein the first guide RNA comprises a first sequence and the second guide RNA comprises a second sequence selected from any one of the following sequence pairs: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146. In some embodiments, a) the first guide RNA comprises the sequence SEQ ID NO. 148 and the second guide RNA comprises the sequence SEQ ID NO. 134; b) The second guide RNA comprises the sequence SEQ ID NO. 145 and the second guide RNA comprises the sequence SEQ ID NO. 131; c) The first guide RNA comprises the sequence SEQ ID NO. 134 and the second guide RNA comprises the sequence SEQ ID NO. 148; d) The second guide RNA comprises the sequence SEQ ID NO. 131 and the second guide RNA comprises the sequence SEQ ID NO. 145.

In some embodiments, the first nucleic acid molecule is in a first vector (e.g., AAV 9) and the second nucleic acid is in a separate second vector. In some embodiments, the first vector is AAV9. In some embodiments, the second vector is AAV9. In a preferred embodiment, the AAV9 vector is less than 5kb in size from ITR to ITR (including both ITRs). In particular embodiments, the AAV9 vector has a size from ITR to ITR (including two ITRs) of less than 4.9kb. In other embodiments, the AAV9 vector has a size from ITR to ITR (including two IT rs) of less than 4.85kb. In other embodiments, the AAV9 vector is less than 4.8kb in size from ITR to IT R (including two ITRs). In other embodiments, the AAV9 vector has a size from ITR to ITR (including two ITRs) of less than 4.75kb. In other embodiments, the AAV9 vector has a size from ITR to ITR (including two ITRs) of less than 4.7kb. In some embodiments, the second vector comprises, in terms of the plus strand, from 5 'to 3': a promoter for expressing a first copy of a first guide RNA (e.g., a U6 promoter), a first copy of a nucleotide sequence encoding a first guide RNA backbone, a promoter for expressing a second copy of a first guide RNA (e.g., an H1 promoter), a second copy of a nucleotide sequence encoding a first guide RNA backbone, a promoter for expressing a second guide RNA (e.g., a 7SK promoter), a nucleotide sequence encoding a second guide RNA, and a nucleotide sequence encoding a second guide RNA backbone. In some embodiments, the second vector comprises, in terms of the plus strand, from 5 'to 3': a promoter for expressing a first guide RNA (e.g., U6 promoter), a nucleotide sequence encoding a first guide RNA backbone, a promoter for expressing a second guide RNA (e.g., 7SK promoter), a nucleotide sequence encoding a second guide RNA, and a nucleotide sequence encoding a second guide RNA backbone. In some embodiments, the second vector comprises a stuffer sequence (e.g., a 3' utr junction protein sequence) interposed between the nucleotide sequence encoding the first guide backbone sequence and the promoter used to express the second guide sequence. In some embodiments, the second vector comprises, in terms of the plus strand, from 5 'to 3': a reverse complement of a nucleotide sequence encoding a first guide RNA backbone, a reverse complement of a nucleotide sequence encoding a first guide RNA, a reverse complement of a promoter for expressing a first guide RNA (e.g., a U6c promoter), a promoter for expressing a second guide RNA (e.g., a U6c promoter), a nucleotide sequence encoding a second guide RNA, and a nucleotide sequence encoding a second guide RNA backbone. In some embodiments, the second vector comprises a stuffer sequence (e.g., a 3' utr desmin sequence) between a promoter for expressing the first guide RNA and a reverse complement of a promoter for expressing the second guide RNA. In some embodiments, the second vector comprises, in terms of the plus strand, from 5 'to 3': a reverse complement of a nucleotide sequence encoding a first copy of a first guide RNA backbone, a reverse complement of a nucleotide sequence encoding a first copy of a first guide RNA, a reverse complement of a promoter (e.g., a 7SK2 promoter) encoding a first copy of a first guide RNA backbone, a reverse complement of a second copy of a nucleotide sequence encoding a first guide RNA, a reverse complement of a promoter (e.g., an hU6c promoter) encoding a second copy of a nucleotide sequence encoding a first guide RNA, a promoter (e.g., an hU6c promoter) encoding a first copy of a first guide RNA, a first copy of a nucleotide sequence encoding a second guide RNA backbone, a promoter (e.g., a 7SK2 promoter) encoding a second copy of a second guide RNA, a second copy of a nucleotide sequence encoding a second guide RNA, and a second copy of a nucleotide sequence encoding a second guide RNA backbone. In some embodiments, the second vector comprises a stuffer sequence (e.g., a 3' utr desmin sequence) between a promoter for expressing the second copy of the first guide RNA and a reverse complement of a promoter for expressing the first copy of the second guide RNA. In some embodiments, the second vector comprises, in terms of the plus strand, from 5 'to 3': a reverse complement of a nucleotide sequence encoding a first copy of the first guide RNA backbone, a reverse complement of a first copy of a nucleotide sequence encoding the first guide RNA, a reverse complement of a promoter (e.g., 7SK2 promoter) encoding the first copy of the first guide RNA backbone, a reverse complement of a first copy of a nucleotide sequence encoding the second guide RNA backbone, a reverse complement of a nucleotide sequence encoding the first copy of the second guide RNA, a reverse complement of a promoter (e.g., hU6c promoter) encoding the first copy of the second guide RNA, a promoter (e.g., hU6c promoter) encoding the second copy of the second guide RNA, a second copy of a nucleotide sequence encoding the second guide RNA backbone, a promoter (e.g., 7SK2 promoter) encoding the second copy of the first guide RNA backbone, a second copy of a nucleotide sequence encoding the first guide RNA, and a second copy of a nucleotide sequence encoding the first guide RNA backbone. In some embodiments, the second vector comprises a stuffer sequence (e.g., a 3' utr desmin sequence) between a promoter for expressing the first copy of the second guide RNA and a reverse complement of a promoter for expressing the second copy of the first guide RNA. In some embodiments, the second vector comprises, in terms of the plus strand, from 5 'to 3': a reverse complement of a nucleotide sequence encoding a first guide RNA backbone, a reverse complement of a nucleotide sequence encoding a first guide RNA, a reverse complement of a promoter for expressing a first guide RNA (e.g., an hU6c promoter), a promoter for expressing a second guide RNA (e.g., an hU6c promoter), a nucleotide sequence encoding a second guide RNA, and a nucleotide sequence encoding a second guide RNA backbone. In some embodiments, the second vector comprises a stuffer sequence (e.g., a 3' utr desmin sequence) between a promoter for expressing the first guide RNA and a reverse complement of a promoter for expressing the second guide RNA. In certain embodiments, the first guide RNA is different from the second guide RNA. In some embodiments, the first guide RNA comprises the sequence SEQ ID NO. 12 and the second guide RNA comprises the sequence SEQ ID NO. 1013. In some embodiments, the first guide RNA comprises the sequence SEQ ID NO:1013 and the second guide RNA comprises the sequence SEQ ID NO:12. In some embodiments, a) the first guide RNA comprises the sequence SEQ ID NO. 148 and the second guide RNA comprises the sequence SEQ ID NO. 134; b) The second guide RNA comprises the sequence SEQ ID NO. 145 and the second guide RNA comprises the sequence SEQ ID NO. 131; c) The first guide RNA comprises the sequence SEQ ID NO. 134 and the second guide RNA comprises the sequence SEQ ID NO. 148; or d) the second guide RN A comprises the sequence SEQ ID NO:131 and the second guide RNA comprises the sequence SEQ ID NO:145. In some embodiments, the backbone of the first guide RNA comprises the sequence SEQ ID NO. 901. In some embodiments, the backbone of the second guide RNA comprises the sequence SEQ ID NO. 901. In some embodiments, any one of the second vectors comprises a stuffer sequence. In some embodiments, the stuffer sequence is a 3' utr sequence. In some embodiments, the 3' UTR binding protein sequence comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to sequence SEQ ID NO 552 (taattaacagatttgt taatgaagaggaaatatacaaatattaatgaacaaaatagtgtgtttagaacaagactcacatacaggagacatacacatgttaaaggaggcattttgaatttgtggggaaaacttacaaattcagtatagggtttggagcactttgatagctaagaggtggggtagggggcagagtgaaggctgtctctcttttactccttctaaaaatattccagtggatcaaagatgtaggaaacgatggatccatgtaggcctcagccttcaagtttctcctctgagatttcagggattatcctttaaaggagtcaggaagagggtagagatcacaaagataataagctcagacagtttgtatgttaaataaacctcaggaggttttagtcttaaggtccttaatctgaccttccaaactgacttttccagaaacttccaaaagcctctc) or a fragment thereof.

In some embodiments, if the composition comprises one or more nucleic acids encoding the RNA-targeting endonuclease and one or more guide RNAs, the one or more nucleic acids are designed such that they express one or more guide RNAs at levels equivalent to or higher than (e.g., greater than the number of copies of the transgene expressed) the expression level of the RNA-targeting endonuclease. In some embodiments, the one or more nucleic acids are designed such that they express (e.g., on average 100 cells) the level of the one or more guide RNAs at least 1.1, 1.2, 1.3, 1.4, or 1.5 times the expression level of the RNA-targeting endonuclease (e.g., greater number of expressed transgenic copies). In some embodiments, the one or more nucleic acids are designed such that they express the one or more guide RNAs at a level of 1.01-1.5, 1.01-1.4, 1.01-1.3, 1.01-1.2, 1.01-1.1, 1.1-2.0, 1.1-1.8, 1.1-1.6, 1.1-1.4, 1.1-1.3, 1.2-2.0, 1.2-1.8, 1.2-1.6, 1.2-1.4, 1.4-2.0, 1.4-1.8, 1.4-1.6, 1.6-2.0, 1.6-1.8, or 1.8-2.0 times the level of expression of the targeted RNA endonuclease (e.g., the number of copies of the transgene expressed is greater). In some embodiments, one or more guide RNAs are designed to express a higher level of endonuclease than the targeting RNA, as follows: a) Using one or more regulatory elements (e.g., promoters or enhancers) that express higher levels of one or more guide RNAs than the regulatory elements (e.g., promoters or enhancers) used to express the targeted RNA endonuclease; and/or b) the copy number of the one or more guide RNAs expressed is greater than the copy number of the RNA-targeting endonuclease (e.g., the copy number of the nucleotide sequence encoding the one or more guide RNAs is 2-fold or 3-fold greater than the copy number of the nucleotide sequence encoding the RNA-targeting endonuclease). For example, in some embodiments, the composition comprises a plurality of nucleic acid molecules (e.g., in a plurality of vectors), wherein for each nucleotide sequence of an endonuclease encoding a targeting RNA in a nucleic acid molecule in the composition, there are two or three copies of the nucleotide sequence encoding a guide RNA in the nucleic acid molecule in the composition. In some embodiments, the composition comprises a first guide RNA and a second guide RNA, wherein the first guide RNA is not identical to the second guide RNA (e.g., any pair of guide RNAs disclosed herein), and there are two or three copies of the nucleotide sequence encoding the first guide RNA and/or the second guide RNA for each nucleotide sequence of the endonuclease encoding the target RNA in the nucleic acid molecule in the composition.

In some embodiments, any of the nucleic acids disclosed herein encode an RNA-targeting endonuclease. In some embodiments, the RNA-targeting endonuclease has a lyase activity, which may also be referred to as a double-stranded endonuclease activity. In some embodiments, the RNA-targeting endonuclease comprises a Cas nuclease. Examples of Cas9 nucleases include Cas9 nucleases of the type II CRISPR system and modified (e.g., engineered or mutant) versions thereof of streptococcus pyogenes, staphylococcus aureus, and other prokaryotes (see the list in the next paragraph). See, for example, US2016/0312198A1; US 2016/0312199 A1. In particular embodiments, the RNA-targeting endonuclease is a type II CRISPR Cas enzyme. Other examples of Cas nucleases include Csm or Cmr complexes of type III CRISPR systems or Cas10, csm1 or Cmr2 subunits thereof; and a cascade complex of a type I CRISPR system or a Cas3 subunit thereof. In some embodiments, the Cas nuclease can be from a type IIA, type IIB, or type IIC system. For a discussion of various CRISPR systems and Cas nucleases, see, e.g., makarova et al, nat. Rev. Microbiol.9:467-477 (2011); makarova et al, NAT. REV. MICROBIOL,13:722-36 (2015); shmakov et al, MOLECULAR CELL,60:385-397 (2015).

Non-limiting exemplary species from which Cas nucleases can be derived include streptococcus pyogenes, streptococcus thermophilus (Streptococcus thermophilus), streptococcus, staphylococcus aureus, listeria innocua (Listeria pinnatifida), lactobacillus gasseri (Lactobacillus gasseri), franciscensis novacell (Francisella novicida), waldens succinate (Wolinella succinogenes), chet's disease (3835), proteus gamma (gammaproteium), neisseria meningitidis (Neisseria meningitidis), campylobacter jejuni (Campylobacter jejuni), pasteurella multocida (Pasteurella multocida), fibric acid producing bacteria (Fibrobacter succinogene), rhodospirillum profundum (Rhodospirillum rubrum), pinus (Nocardiopsis dassonvillei), streptomyces viridis (Streptomyces pristinaespiralis), streptomyces viridis (Streptomyces viridochromogenes), streptomyces viridis, rhodosporum (Streptosporangium roseum), rhodosporum, thermocycla acidophila (Alicyclobacillus acidocaldarius), pseudomonas (Bacillus pseudomycoides), bacillus arsenicum (Bacillus selenitireducens), siberia (4837), lactobacillus salivarius (Dai Baishi), pseudomonas fragrans (Dai Baishi), pseudomonas fragilis (Dai Baishi), pseudomonas fragi (Dai Baishi), pseudomonas (Dai Baishi), rhodobacter sp (Dai Baishi), and pseudomonas (Dai Baishi) which are derived from the bacteria, alligator, microcystis aeruginosa (Microcystis aeruginosa), synechococcus (Synechococcus sp.), acetobacter arabicum (Acetohalobium arabaticum), ammonia (Ammonifex degensii), cellobacterium pyrolyseum (Caldicelulosiruptor becscii), candida desulfur (Candidatus Desulforudis), clostridium botulinum (Clostridium botulinum), clostridium difficile (Clostridium difficile), phanerochaete (Finelhardia magnna), thermoanaerobacter thermophilum (Natranaerobius thermophilus), thermoanaerobacter thermophilus (Pelotomaculum thermopropionicum), thermomyces acidophilus (Acidithiobacillus caldus), thiobacillus acidophilus (Acidithiobacillus ferrooxidans), isochromonas vinum (Allochromatium vinosum), haibacterium, nitrococcus halophilus (Nitrosococcus halophilus), nitrococcus vachelli (Nitrosococcus watsoni), pseudomonas natans (Pseudoalteromonas haloplanktis), celastomere (Ktedonobacter racemifer), candida variabilis (Anabaena variabilis), nostoc, phanerochaete (Arthrospira maxima), protoxacum (Arthrospira maxima), rhodococcus (Arthrospira maxima), proteus (Arthrospira maxima) and Proteus (Arthrospira maxima) are described herein Corynebacterium diphtheriae (Corynebacterium diphtheria), amino acid coccus (Acidococcus sp.), mao Luoke bacteria (Lachnospiraceae bacterium) ND2006, and marine anucleate chlorine bacteria (Acaryochloris marina).

In some embodiments, the nucleic acid encoding SaCas9 encodes a SaCas9 comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO 711:

in some embodiments, the nucleic acid encoding SaCas9 comprises the nucleic acid of SEQ ID NO: 9014:

/>

in some embodiments comprising a nucleic acid encoding SaCas9, saCas9 comprises the amino acid sequence SEQ ID NO 711.

In some embodiments, saCas9 is a variant of amino acid sequence SEQ ID NO:711. In some embodiments, saCas9 comprises an amino acid other than E at a position corresponding to position 781 of SEQ ID NO:711. In some embodiments, saCas9 comprises an amino acid other than N at a position corresponding to position 967 of SEQ ID NO:711. In some embodiments, saCas9 comprises an amino acid other than R at a position corresponding to position 1014 of SEQ ID NO:711. In some embodiments, saCas9 comprises K at a position corresponding to position 781 of SEQ ID NO:711. In some embodiments, saCas9 comprises K at a position corresponding to position 967 of SEQ ID NO:711. In some embodiments, saCas9 comprises H at a position corresponding to position 1014 of SEQ ID NO:711. In some embodiments, saCas9 comprises an amino acid other than E at a position corresponding to position 781 of SEQ ID NO: 711; amino acids other than N are included at positions corresponding to position 967 of SEQ ID NO. 711; and comprises amino acids other than R at positions corresponding to position 1014 of SEQ ID NO. 711. In some embodiments, saCas9 comprises K at position 781 corresponding to SEQ ID NO. 711; k is contained at a position corresponding to position 967 of SEQ ID NO. 711; and comprises H at a position corresponding to position 1014 of SEQ ID NO:711.

In some embodiments, saCas9 comprises an amino acid other than R at position 244 corresponding to position 711 of SEQ ID NO. In some embodiments, saCas9 comprises an amino acid other than N at a position corresponding to position 412 of SEQ ID NO: 711. In some embodiments, saCas9 comprises an amino acid other than N at a position corresponding to position 418 of SEQ ID NO: 711. In some embodiments, saCas9 comprises an amino acid other than R at a position corresponding to position 653 of SEQ ID NO: 711. In some embodiments, saCas9 comprises an amino acid other than R at position 244 corresponding to position 711 of SEQ ID NO; amino acids other than N are included at positions corresponding to position 412 of SEQ ID NO. 711; amino acids other than N are included at positions corresponding to position 418 of SEQ ID NO. 711; and comprises an amino acid other than R at a position corresponding to position 653 of SEQ ID NO. 711. In some embodiments, saCas9 comprises A at a position corresponding to position 244 of SEQ ID NO: 711. In some embodiments, saCas9 comprises A at a position corresponding to position 412 of SEQ ID NO: 711. In some embodiments, saCas9 comprises A at a position corresponding to position 418 of SEQ ID NO: 711. In some embodiments, saCas9 comprises A at a position corresponding to position 653 of SEQ ID NO: 711. In some embodiments, saCas9 comprises A at position 244 corresponding to SEQ ID NO: 711; a is contained at position corresponding to position 412 of SEQ ID No. 711; a is contained at a position corresponding to position 418 of SEQ ID No. 711; and contains A at a position corresponding to position 653 of SEQ ID NO: 711.

In some embodiments, saCas9 comprises an amino acid other than R at position 244 corresponding to position 711 of SEQ ID NO; amino acids other than N are included at positions corresponding to position 412 of SEQ ID NO. 711; amino acids other than N are included at positions corresponding to position 418 of SEQ ID NO. 711; amino acids other than R are included at positions corresponding to position 653 of SEQ ID NO. 711; amino acids other than E are included at positions 781 corresponding to SEQ ID NO. 711; amino acids other than N are included at positions corresponding to position 967 of SEQ ID NO. 711; and comprises amino acids other than R at positions corresponding to position 1014 of SEQ ID NO. 711. In some embodiments, saCas9 comprises A at position 244 corresponding to SEQ ID NO: 711; a is contained at position corresponding to position 412 of SEQ ID No. 711; a is contained at a position corresponding to position 418 of SEQ ID No. 711; a is contained at a position corresponding to position 653 of SEQ ID No. 711; k is contained at a position corresponding to position 781 of SEQ ID NO. 711; k is contained at a position corresponding to position 967 of SEQ ID NO. 711; and comprises H at a position corresponding to position 1014 of SEQ ID NO: 711.

In some embodiments, saCas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO 715 (referred to herein as SaCas9-KKH or SACAS9 KKH).

In some embodiments, saCas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO:716 (referred to herein as SaCas 9-HF):

in some embodiments, saCas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO 717 (referred to herein as SaCas 9-KKH-HF):

in some embodiments, the nucleic acid encoding a slaucas 9 encodes a slaucas 9 comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 712:

in some embodiments, slucas9 is a variant of amino acid sequence SEQ ID NO: 712. In some embodiments, slucAs9 comprises amino acids other than Q at positions 781 corresponding to positions 712 of SEQ ID NO. In some embodiments, slucAs9 comprises amino acids other than R at positions 1013 corresponding to SEQ ID NO 712. In some embodiments, slucas9 comprises K at a position corresponding to position 781 of SEQ ID NO: 712. In some embodiments, slucas9 comprises K at a position corresponding to position 966 of SEQ ID NO: 712. In some embodiments, slucas9 comprises H at a position corresponding to position 1013 of SEQ ID NO: 712. In some embodiments, slucAs9 comprises amino acids other than Q at positions 781 corresponding to positions 712 of SEQ ID NO; and comprises amino acids other than R at positions 1013 corresponding to position 712 of SEQ ID NO. In some embodiments, slucAs9 comprises K at a position corresponding to position 781 of SEQ ID NO 712; k is included at a position corresponding to position 966 of SEQ ID NO 712; and comprises H at a position corresponding to position 1013 of SEQ ID NO: 712.

In some embodiments, slucAs9 comprises amino acids other than R at positions corresponding to position 246 of SEQ ID NO: 712. In some embodiments, slucAs9 comprises an amino acid other than N at a position corresponding to position 414 of SEQ ID NO: 712. In some embodiments, slucAs9 comprises amino acids other than T at positions corresponding to position 420 of SEQ ID NO: 712. In some embodiments, slucAs9 comprises amino acids other than R at positions corresponding to position 655 of SEQ ID NO: 712. In some embodiments, slucAS9 comprises amino acids other than R at positions corresponding to position 246 of SEQ ID NO 712; amino acids other than N are included at positions corresponding to position 414 of SEQ ID NO 712; amino acids other than T are included at positions corresponding to position 420 of SEQ ID NO 712; and comprises an amino acid other than R at a position corresponding to position 655 of SEQ ID NO: 712. In some embodiments, slucas9 comprises A at a position corresponding to position 246 of SEQ ID NO: 712. In some embodiments, slucas9 comprises A at a position corresponding to position 414 of SEQ ID NO: 712. In some embodiments, slucas9 comprises A at a position corresponding to position 420 of SEQ ID NO: 712. In some embodiments, slucas9 comprises A at a position corresponding to position 655 of SEQ ID NO: 712. In some embodiments, slucAs9 comprises A at a position corresponding to position 246 of SEQ ID NO 712; a is contained at a position corresponding to position 414 of SEQ ID No. 712; a is contained at position 420 corresponding to position 712 of SEQ ID No.; and comprises A at a position corresponding to position 655 of SEQ ID NO: 712.

In some embodiments, slucAS9 comprises amino acids other than R at positions corresponding to position 246 of SEQ ID NO 712; amino acids other than N are included at positions corresponding to position 414 of SEQ ID NO 712; amino acids other than T are included at positions corresponding to position 420 of SEQ ID NO 712; amino acids other than R are included at positions corresponding to position 655 of SEQ ID NO 712; amino acids other than Q are included at positions 781 corresponding to positions 712 of SEQ ID NO; k is included at a position corresponding to position 966 of SEQ ID NO 712; and comprises amino acids other than R at positions 1013 corresponding to position 712 of SEQ ID NO. In some embodiments, slucAs9 comprises A at a position corresponding to position 246 of SEQ ID NO 712; a is contained at a position corresponding to position 414 of SEQ ID No. 712; a is contained at position 420 corresponding to position 712 of SEQ ID No.; a is contained at a position corresponding to position 655 of SEQ ID No. 712; k is contained at a position corresponding to position 781 of SEQ ID NO. 712; k is included at a position corresponding to position 966 of SEQ ID NO 712; and comprises H at a position corresponding to position 1013 of SEQ ID NO: 712.

In some embodiments, the slaucas 9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO:718 (referred to herein as slaucas 9-KH or SluCas9 KH):

in some embodiments, the slaucas 9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO:719 (referred to herein as slaucas 9-HF):

in some embodiments, the slaucas 9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO:720 (referred to herein as slaucas 9-HF-KH).

In some embodiments, the Cas protein is any one of the engineered Cas proteins disclosed in the following documents: schmidt et al 2021,Nature Communications, "Improved CRISPR genome editing using small highly active and specific engineered RNA-guided nucleic acids".

In some embodiments, cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 7021 (referred to herein as sRGN 1):

In some embodiments, cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 7022 (referred to herein as sRGN 2):

in some embodiments, cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO:7023 (referred to herein as sRGN 3):

in some embodiments, cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 7024 (referred to herein as srgn 3.1):

in some embodiments, cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 7025 (referred to herein as srgn 3.2):

in some embodiments, cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO:7026 (referred to herein as srgn 3.3):

In some embodiments, cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 7027 (referred to herein as sRGN 4).

In some embodiments, cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 7028 (referred to herein as staphylococcus suis Cas9 or ShyCas 9).

In some embodiments, cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to sequence SEQ ID NO 7029 (referred to herein as staphylococcus parvus (Staphylococcus microti) Cas9 or Smi Cas 9).

In some embodiments, cas9 comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to sequence SEQ ID NO 7030 (referred to herein as staphylococcus baryophilus (Staphylococcus pasteuri) Cas9 or Spa Cas 9).

In some embodiments, the Cas protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 7031 (referred to herein as Cas12i 1):

in some embodiments, the Cas protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 7032 (referred to herein as Cas12i 2):

in some embodiments, the Cas protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence SEQ ID NO 7033 (referred to herein as SpCas 9).

Modified guide RNAs

In some embodiments, the guide RNA is chemically modified. A guide RNA comprising one or more modified nucleosides or nucleotides is referred to as a "modified" guide RNA or a "chemically modified" guide RNA to describe the presence of one or more components or configurations that are non-natural and/or naturally occurring that are used in place of or in addition to the typical A, G, C and U residues. In some embodiments, the modified guide RNA is synthesized from atypical nucleosides or nucleotides, referred to herein as "modifications". The modified nucleosides and nucleotides can include one or more of the following: (i) Alterations, such as substitutions (exemplary backbone modifications), of one or two non-linked phosphate oxygens and/or one or more linked phosphate oxygens in the phosphodiester backbone linkages; (ii) Alterations in ribose moiety (e.g., 2' hydroxyl on ribose), such as substitutions (exemplary sugar modifications); (iii) Batch displacement of phosphate moieties (exemplary backbone modifications) with "dephosphorylation" linkers; (iv) Modification or substitution of naturally occurring nucleobases, including modification or substitution with atypical nucleobases (exemplary base modifications); (v) Substitution or modification of the ribose-phosphate backbone (exemplary backbone modifications); (vi) Modification of the 3 'or 5' end of the oligonucleotide, such as removal, modification or substitution of a terminal phosphate group, or conjugation of a moiety, cap or linker (such 3 'or 5' cap modification may comprise sugar and/or backbone modifications); and (vii) modification or substitution of sugar (exemplary sugar modifications).

Chemical modifications, such as those listed above, can be combined to provide a modified guide RNA comprising nucleosides and nucleotides (collectively "residues") that can have two, three, four, or more modifications. For example, the modified residue may have a modified sugar and a modified nucleobase, or a modified sugar and a modified phosphodiester. In some embodiments, each base in the guide RNA is modified, e.g., all bases have a modified phosphate group, e.g., a phosphorothioate group. In certain embodiments, all or substantially all of the phosphate groups in the guide RNA molecule are replaced with phosphorothioate groups. In some embodiments, the modified guide RNA comprises at least one modified residue at or near the 5' end of the RNA. In some embodiments, the modified guide RNA comprises at least one modified residue at or near the 3' end of the RNA.

In some embodiments, the guide RNA comprises one, two, three, or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%) of the positions in the modified guide RNA are modified nucleosides or nucleotides.

Unmodified nucleic acids can be readily degraded by, for example, intracellular nucleases or those found in serum. For example, nucleases can hydrolyze nucleic acid phosphodiester bonds. Thus, in one aspect, the guide RNAs described herein may contain one or more modified nucleosides or nucleotides, for example, to introduce stability to an intracellular nuclease or serum-based nuclease. In some embodiments, the modified guide RNA molecules described herein, when introduced into a population of cells, can exhibit reduced innate immune responses in vivo and ex vivo. The term "innate immune response" includes cellular responses to exogenous nucleic acids, including single-stranded nucleic acids, that involve induction of cytokine (in particular, interferon) expression and release, as well as cell death.

In some embodiments of backbone modification, the phosphate groups in the modified residues may be modified by replacing one or more oxygens with different substituents. Furthermore, modified residues, such as those present in modified nucleic acids, may include batch substitution of unmodified phosphate moieties with modified phosphate groups as described herein. In some embodiments, backbone modification of the phosphate backbone may include alterations that produce uncharged linkers or charged linkers with asymmetric charge distribution.

Examples of modified phosphate groups include phosphorothioates, phosphoroselenos, phosphoroborates, phosphorohydrogenates, phosphoroamidates, alkyl phosphonates or aryl phosphonates, and phosphotriesters. The phosphorus atom in the unmodified phosphate group is achiral. However, substitution of one of the non-bridging oxygens with one of the atoms or groups of atoms described above may render the phosphorus atom chiral. The sterically symmetrical phosphorus atom may have an "R" configuration (herein Rp) or an "S" configuration (herein Sp). The backbone can also be modified by replacing the bridging oxygen (i.e., the oxygen linking the phosphate to the nucleoside) with nitrogen (bridging phosphoramidate), sulfur (bridging phosphorothioate), and carbon (bridging methylphosphonate). Substitution may occur at either or both of the linking oxygens.

The phosphate groups may be replaced in certain backbone modifications by phosphorus-free linking groups. In some embodiments, the charged phosphate groups may be replaced with neutral moieties. Examples of moieties of the replaceable phosphate groups may include, but are not limited to, for example, methyl phosphonate, hydroxyamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thiomethylal, methylal, oxime, methyleneimino, methylenehydrazine, methylenedimethylhydrazine, and methylenemethyleneimino.

Backbones that can mimic nucleic acids can also be constructed in which phosphate linkers and riboses are replaced with nuclease resistant nucleosides or nucleotide substitutes. Such modifications may include backbone and sugar modifications. In some embodiments, nucleobases can be tethered by alternative backbones. Examples may include, but are not limited to, N-morpholino, cyclobutyl, pyrrolidine, and Peptide Nucleic Acid (PNA) nucleoside substitutes.

Modified nucleosides and modified nucleotides can include one or more modifications to the sugar moiety, i.e., sugar modifications. For example, the 2' hydroxyl (OH) group may be modified, e.g., replaced with a plurality of different "oxy" or "deoxy" substituents. In some embodiments, modification of the 2 'hydroxyl group may enhance the stability of the nucleic acid, as the hydroxyl group may no longer undergo deprotonation to form a 2' -alkanol ion.

Examples of 2' hydroxyl modifications may include alkoxy OR aryloxy (OR, where "R" may be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, OR sugar); polyethylene glycol (PEG); o (CH) ₂ CH ₂ O) _n CH ₂ CH ₂ OR, where R may be, for example, H OR optionally substituted alkyl, and n may be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20). In some embodiments, the 2 'hydroxyl modification may be 2' -O-Me. In some embodiments, the 2' hydroxyl modification may be a 2' -fluoro modification that replaces the 2' hydroxyl with fluorine. In some embodiments, the 2 'hydroxyl modification may include a "locked" nucleic acid (LNA), where the 2' hydroxyl may be modified by, for example, C _1-6 Alkylene or C _1-6 The alkylene bridge is attached to the 4' carbon of the same ribose, wherein exemplary bridges may include methylene, propylene, ether, or amino bridges; o-amino (wherein amino may be, for example, NH) ₂ The method comprises the steps of carrying out a first treatment on the surface of the Alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine or polyamino) and aminoalkoxy, O (CH ₂ ) _n Amino (wherein amino may be, for example, NH) ₂ The method comprises the steps of carrying out a first treatment on the surface of the Alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine or polyamino). In some casesIn embodiments, the 2' hydroxyl modification may include a "non-locked" nucleic acid (unlocked nucleic acid; UNA) in which the ribose ring lacks a C2' -C3' linkage. In some embodiments, the 2' hydroxyl modification may include Methoxyethyl (MOE) (OCH) ₂ CH ₂ OCH ₃ For example PEG derivatives).

"deoxy" 2' modifications may include hydrogen (i.e., deoxyribose, e.g., located in a protruding portion of a partial dsRNA); halo (e.g., bromo, chloro, fluoro, or iodo); amino (where amino may be, for example, NH ₂ The method comprises the steps of carrying out a first treatment on the surface of the Alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH (CH) ₂ CH ₂ NH) _n CH2CH ₂ -amino (wherein amino may be, for example, as described herein), -NHC (O) R (wherein R may be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano; a mercapto group; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl groups optionally substituted with amino groups, e.g., as described herein.

The sugar modification may comprise a sugar group which may also contain one or more carbons having a stereochemical configuration opposite the corresponding carbon in ribose. Thus, a modified nucleic acid may include a nucleotide containing, for example, arabinose as a sugar. Modified nucleic acids may also include abasic sugars. These abasic sugars may also be further modified at one or more of the constituent sugar atoms. The modified nucleic acid may also include one or more sugars in the L form, such as L-nucleosides.

The modified nucleosides and modified nucleotides described herein that can be incorporated into a modified nucleic acid can include modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or substituted in their entirety to provide modified residues that can be incorporated into modified nucleic acids. The nucleobases of the nucleotides may be independently selected from purines, pyrimidines, purine analogues or pyrimidine analogues. In some embodiments, nucleobases can include, for example, naturally occurring base derivatives and synthetic base derivatives.

In embodiments using dual guide RNAs, each of the crRNA and tracr RNA may contain modifications. Such modifications may be located at one or both ends of the crRNA and/or tracr RNA. In embodiments comprising the sgrnas, one or more residues at one or both ends of the sgrnas may be chemically modified and/or the internal nucleosides may be modified and/or the entire sgrnas may be chemically modified. Certain embodiments comprise a 5' modification. Certain embodiments comprise a 3' modification.

Modifications of the 2' -O-methyl group are contemplated.

Another chemical modification that has been shown to affect the sugar ring of a nucleotide is a halogen substitution. For example, 2 '-fluoro (2' -F) substitution on the nucleotide sugar ring can increase oligonucleotide binding affinity and nuclease stability. Modifications of 2 '-fluoro (2' -F) are contemplated.

Phosphorothioate (PS) linkages or linkages refer to a linkage in which one non-bridging phosphate oxygen in a phosphodiester linkage (e.g., a linkage between nucleotide bases) is replaced with sulfur. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligonucleotides.

Abasic nucleotides refer to those nucleotides that lack a nitrogenous base.

Reverse bases refer to those bases whose linkages are reverse (i.e., 5 'to 5' linkages or 3 'to 3' linkages) relative to standard 5 'to 3' linkages.

The abasic nucleotides may be linked via reverse linkages. For example, an abasic nucleotide may be linked to a terminal 5 'nucleotide via a 5' to 5 'linkage, or an abasic nucleotide may be linked to a terminal 3' nucleotide via a 3 'to 3' linkage. Inverted abasic nucleotides at the terminal 5 'or 3' nucleotide may also be referred to as inverted abasic end caps.

In some embodiments, one or more of the first three, four, or five nucleotides of the 5 'end and one or more of the last three, four, or five nucleotides of the 3' end are modified. In some embodiments, the modification is a 2'-O-Me, 2' -F, inverted abasic nucleotide, PS linkage, or other nucleotide modification that may enhance stability and/or performance as is well known in the art.

In some embodiments, the first four nucleotides of the 5 'end and the last four nucleotides of the 3' end are linked via Phosphorothioate (PS) linkages.

In some embodiments, the first three nucleotides at the 5 'end and the last three nucleotides at the 3' end comprise 2 '-O-methyl (2' -O-Me) modified nucleotides. In some embodiments, the first three nucleotides of the 5 'end and the last three nucleotides of the 3' end comprise 2 '-fluoro (2' -F) modified nucleotides.

Ribonucleoprotein complexes

In some embodiments, contemplated compositions comprise: a) One or more guide RNAs comprising one or more guide sequences of table 1A, table 1B, or table 5 and B) saCas9 (when combined with a gRNA comprising any one or combination of SEQ ID NOs 1-35, 1000-1078, and 3000-3069) or slocas 9 (when combined with a gRNA comprising any one or combination of SEQ ID NOs 100-225, 2000-2116, and 4000-4251), or any mutant Cas9 protein disclosed herein. In some embodiments, the guide RNA together with Cas9 is referred to as a ribonucleoprotein complex (RNP).

In some embodiments, the invention provides an RNP complex, wherein a guide RNA (e.g., any of the guide RNAs disclosed herein) binds to or is capable of binding to a target sequence (e.g., a splice acceptor site or splice donor site of exon 45, 51, or 53) in an dystrophin gene, including, for example, an exon 51 intron-exon junction having sequence ccagagtaacagtctgagtaggagctaaaatattttgggtttttgcaa (SEQ ID NO: 721), or a target sequence bound by any of the sequences disclosed in tables 1A, 1B, and 5), wherein the dystrophin gene comprises a PAM recognition sequence at a position upstream of the target sequence, and wherein the RNP cleaves the dystrophin gene at a position (-3) 3 nucleotides upstream of PAM. In some embodiments, the RNP also cleaves the dystrophin gene at a position 2 nucleotides upstream (-2), 4 nucleotides upstream (-4), 5 nucleotides upstream (-5), or 6 nucleotides upstream (-6) of PAM. In some embodiments, the RNP cleaves the dystrophin gene at a position 3 nucleotides (-3) upstream and 4 nucleotides (-4) upstream of PAM.

In some embodiments, a chimeric Cas9 (SaCas 9 or slaucas 9) nuclease is used, wherein one domain or region of a protein is replaced with a portion of a different protein. In some embodiments, the Cas9 nuclease domain can be replaced with a domain from a different nuclease (e.g., fok 1). In some embodiments, the Cas9 nuclease can be a modified nuclease.

In some embodiments, cas9 is modified to contain only one nuclease domain. For example, the agent protein may be modified such that one nuclease domain is mutated or deleted entirely or partially to reduce its nucleic acid cleavage activity.

In some embodiments, conservative amino acids within the Cas9 protein nuclease domain are substituted to reduce or alter nuclease activity. In some embodiments, the Cas9 nuclease may comprise amino acid substitutions in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in RuvC or RuvC-like nuclease domains include D10A (based on streptococcus pyogenes Cas9 protein). See, for example, zetsche et al (2015) Cell, 22 months, 163 (3): 759-771. In some embodiments, the Cas9 nuclease may comprise an amino acid substitution in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A and D986A (based on streptococcus pyogenes Cas9 protein). See, e.g., zetsche et al (2015). Other exemplary amino acid substitutions include D917A, E A and D1255A (based on the New inland Francisella (Francisella novicida) U112 Cpf1 (FNCpf 1) sequence (UniProtKB-A0Q 7Q2 (CPF1_FRATN)). Other exemplary amino acid substitutions include D10A and N580A (based on the Staphylococcus aureus Cas9 protein.) see, e.g., friedland et al 2015, genome Biol, 16:257.

In some embodiments, cas9 lacks lyase activity. In some embodiments, cas9 comprises a dCas DNA binding polypeptide. dCas polypeptides have DNA binding activity and are substantially devoid of catalytic (lyase/nickase) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the Cas9 or dCas DNA binding polypeptide lacking lyase activity is a form of Cas nuclease (e.g., cas9 nuclease discussed above), wherein its endonuclease active site is inactivated, e.g., by one or more alterations (e.g., point mutations) of its catalytic domain. See, for example, US 2014/0186958 A1; US 2015/0166980A1.

In some embodiments, cas9 comprises one or more heterologous functional domains (e.g., is or comprises a fusion polypeptide).

In some embodiments, the heterologous functional domain may facilitate transport of Cas9 into the nucleus. For example, the heterologous functional domain may be a Nuclear Localization Signal (NLS). In some embodiments, cas9 may be fused to 1-10 NLS. In some embodiments, cas9 may be fused to 1-5 NLS. In some embodiments, cas9 may be fused to 1-3 NLS. In some embodiments, cas9 may be fused to one NLS. In the case of one NLS, the NLS may be linked at the N-terminus or C-terminus of the Cas9 sequence, and may be fused/linked directly or via a linker. It may also be inserted within the Cas9 sequence. In other embodiments, cas9 may be fused to more than one NLS. In some embodiments, cas9 may be fused to 2, 3, 4, or 5 NLS. In some embodiments, cas9 may be fused to two NLS. In some cases, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the Cas9 protein is fused to one or more SV40 NLS. In some embodiments, the SV40 NLS comprises the amino acid sequence SEQ ID NO:713 (PKKKRKV). In some embodiments, the Cas9 protein (e.g., a SaCas9 or slaucas 9 protein) is fused to one or more nucleoplasmin NLS. In some embodiments, the Cas protein is fused to one or more c-myc NLS. In some embodiments, the Cas protein is fused to one or more E1 ANLS. In some embodiments, the Cas protein is fused to one or more BP (bi-parting) NLS. In some embodiments, the nucleoplasmin NLS comprises the amino acid sequence SEQ ID NO 714 (KRPAATKKAGQAKKKK). In some embodiments, the Cas9 protein is fused to a c-Myc NLS. In some embodiments, the c-Myc NLS is encoded by the nucleic acid sequence SEQ ID NO 722 (CCGGCAGCTAAGAAAAAGAAACTGGAT). In some embodiments, cas9 is fused to two SV40 NLS sequences that are carboxy-terminal linked. In some embodiments, cas9 may be fused to two NLS: one NLS is N-terminally linked and one NLS is C-terminally linked. In some embodiments, cas9 may be fused to 3 NLS. In some embodiments, cas9 may be fused to 3 NLS: two NLS are connected at the N-terminus and one at the C-terminus. In some embodiments, cas9 may be fused to 3 NLS: one NLS is connected at the N-terminus and two NLS are connected at the C-terminus. In some embodiments, cas9 may not be fused to an NLS. In some embodiments, cas9 may be fused to one NLS. In some embodiments, cas9 may be fused to the NLS at the C-terminus and does not comprise an NLS fused at the N-terminus. In some embodiments, cas9 may be fused to the NLS at the N-terminus and does not comprise a fused NLS at the C-terminus. In some embodiments, the Cas9 protein is fused to the SV40 NLS and the nucleoplasmin NLS. In some embodiments, the Cas9 protein is fused to the SV40 NLS and c-Myc NLS. In some embodiments, the SV40 NLS is fused to the C-terminus of Cas9, while the nucleoplasmin NLS is fused to the N-terminus of Cas9 protein. In some embodiments, the SV40 NLS is fused to the C-terminus of Cas9, while the C-Myc NLS is fused to the N-terminus of Cas9 protein. In some embodiments, the SV40 NLS is fused to the N-terminus of Cas9, while the nucleoplasmin NLS is fused to the C-terminus of Cas9 protein. In some embodiments, the SV40 NLS is fused to the N-terminus of Cas9, while the C-Myc NLS is fused to the C-terminus of Cas9 protein. In some embodiments, the SV40 NLS is fused to the Cas9 protein by a linker. In some embodiments, the SV40 NLS and linker are encoded by the nucleic acid sequence SEQ ID NO:723 (ATGATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGA GTCCCAGCAGCC). In some embodiments, the nucleoplasmin NLS is fused to the Cas9 protein by a linker. In some embodiments, the c-Myc NLS is fused to the Cas9 protein by a linker. In some embodiments, another domain may: a) Fusion to the N-terminus or C-terminus of a Cas protein (e.g., cas9 protein); b) Fusion with the N-terminus of the NLS, which is fused with the N-terminus of the Cas protein; or C) fused to the C-terminus of the NLS fused to the C-terminus of the Cas protein. In some embodiments, the NLS is fused to the N-terminus and/or the C-terminus of the Cas protein by a linker. In some embodiments, the NLS is fused to the N-terminus of the N-terminally fused NLS on the Cas protein by a linker, and/or the NLS is fused to the C-terminus of the C-terminally fused NLS on the Cas protein by a linker. In some embodiments, the linker is GSVD (SEQ ID NO: 550) or GSGS (SEQ ID NO: 551). In some embodiments, the Cas protein comprises a c-Myc NLS fused to the N-terminus of the Cas protein (or to an N-terminally fused NLS on the Cas protein), optionally through a linker. In some embodiments, the Cas protein comprises an SV40 NLS fused to the C-terminus of the Cas protein (or a C-terminally fused NLS on the Cas protein), optionally through a linker. In some embodiments, the Cas protein comprises a nucleoplasmin NLS fused to the C-terminus of the Cas protein (or to a C-terminally fused NLS on the Cas protein), optionally through a linker. In some embodiments, the Cas protein comprises: a) c-Myc NLS fused to the N-terminus of Cas protein, optionally through a linker; b) SV40 NLS fused to the C-terminus of Cas protein, optionally through a linker; and C) a nucleoplasmin NLS fused to the C-terminus of the SV40 NLS, optionally via a linker. In some embodiments, the Cas protein comprises: a) c-Myc NLS fused to the N-terminus of Cas protein, optionally through a linker; b) A nucleoplasmin NLS fused to the C-terminus of the Cas protein, optionally through a linker; and C) SV40 NLS fused to the C-terminus of the nucleoplasmin NLS, optionally through a linker.

In some embodiments, the heterologous functional domain is capable of modulating the intracellular half-life of Cas 9. In some embodiments, cas9 half-life may be extended. In some embodiments, cas9 half-life may be shortened. In some embodiments, the heterologous functional domain is capable of enhancing Cas9 stability. In some embodiments, the heterologous functional domain is capable of reducing Cas9 stability. In some embodiments, the heterologous functional domain can serve as a signal peptide for protein degradation. In some embodiments, protein degradation may be mediated by proteolytic enzymes, such as proteasome, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain may comprise a PEST sequence. In some embodiments, cas9 may be modified by the addition of ubiquitin or polyubiquitin chains. In some embodiments, the ubiquitin can be ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like regulatory factor (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon stimulatory gene-15 (ISG 15)), ubiquitin-related regulatory factor-1 (URM 1), down-regulated protein-8 expressed by neuronal precursor cells (NEDD 8, also known as Rub1 in saccharomyces cerevisiae (s. Cerevisae)), human leukocyte F-related antigen (FAT 10), autophagy-8 (ATG 8) and autophagy-12 (ATG 12), fau ubiquitin-like protein (FUB 1), membrane anchored UBL (MUB), ubiquitin folding regulatory factor-1 (UFM 1) and ubiquitin-like protein-5 (UBL 5).

In some embodiments, the heterologous functional domain may be a tag domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include Green fluorescent proteins (e.g., GFP-2, tagGFP, turboGFP, sfGFP, EGFP, emerald, azami Green (Azami Green), monomeric Azami Green, copGFP, aceGFP, zsGreen 1), yellow fluorescent proteins (e.g., YFP, EYFP, citrine, venus, YPet, phiYFP, zsYellow 1), blue fluorescent proteins (e.g., EBFP2, azurite, mKalamal, GFPuv, sapphire, T-sapphire), cyano fluorescent proteins (e.g., ECFP, cerulean, cyPet, amCyan1, midorisishi-Cyan), red fluorescent proteins (e.g., mKate2, mPlum, dsRed monomer, mCherry, mRFP1, dsRed-Express, dsRed, dsRed monomer, hcRed-Tandmem, hcRed1, asRed2, FP611, mRasberry, mStrawberry, jred), and orange fluorescent proteins (mOrange, mKO, kusabira orange, monomeric Kusabira, mTangerine, tdTomato) or any other suitable fluorescent protein. In other embodiments, the tag domain may be a purification tag and/or an epitope tag. Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin Binding Protein (CBP), maltose Binding Protein (MBP), thioredoxin (TRX), poly (NANP), tandem affinity purification (tandem affinity purification, TAP) tag, myc, acV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, softag 1, softag 3, strep, SBP, glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin Carboxy Carrier Protein (BCCP), polyHis, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol Acetyl Transferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or fluorescent proteins.

In additional embodiments, the heterologous functional domain can target Cas9 to a specific organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain can target Cas9 to a muscle.

In other embodiments, the heterologous functional domain may be an effector domain. When Cas9 is directed against its target sequence, for example when Cas9 is directed against the target sequence by a guide RNA, the effector domain may modify or affect the target sequence. In some embodiments, the effector domain may be selected from a nucleic acid binding domain or a nuclease domain (e.g., a non-Cas nuclease domain). In some embodiments, the heterologous domain is a nuclease, such as a fokl nuclease. See, for example, U.S. patent No. 9,023,649.

In some embodiments, any of the compositions disclosed herein comprising any of the guides and/or endonucleases disclosed herein are sterile and/or substantially pyrogen free. In certain embodiments, any of the compositions disclosed herein comprise a pharmaceutically acceptable carrier. The phrase "pharmaceutically acceptable" or "pharmacologically acceptable" refers to molecular entities and compositions that do not produce deleterious, allergic or other untoward reactions when administered to an animal or human. As used herein, "pharmaceutically acceptable carrier" includes any and all solvents (e.g., water), dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible, including pharmaceutically acceptable cell culture media. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In some embodiments, the composition comprises a preservative that prevents the growth of microorganisms.

Determination of efficacy of guide RNA

In some embodiments, the efficacy of a guide RNA is determined when the guide RNA is delivered or expressed along with other components that form an RNP. In some embodiments, the guide RNA is expressed along with SaCas9 or slaucas 9. In some embodiments, the guide RNA is delivered to or expressed in a cell line that has stably expressed SaCas9 or slaucas 9. In some embodiments, the guide RNA is delivered to the cell as part of the RNP. In some embodiments, the guide RNA is delivered to the cell along with a nucleic acid (e.g., mRNA) encoding SaCas9 or slaucas 9.

In some embodiments, the efficacy of a particular guide RNA is determined based on an in vitro model. In some embodiments, the in vitro model is a cell line.

In some embodiments, the efficacy of a particular guide RNA is determined using a plurality of in vitro cell models for the guide RNA selection process. In some embodiments, the comparison is made with data of the selected guide RNA against the cell line. In some embodiments, multiple cell models are used for cross-screening.

In some embodiments, the efficacy of a particular guide RNA is determined based on an in vivo model. In some embodiments, the in vivo model is a rodent model. In some embodiments, the rodent model is a mouse, e.g., mdx mouse, that expresses a mutant dystrophin gene. In some embodiments, the in vivo model is a non-human primate, such as cynomolgus macaque.

Gene editing and DMD treatment methods

The present disclosure provides methods of gene editing and treating Duchenne Muscular Dystrophy (DMD). In some embodiments, any of the compositions described herein may be administered to a subject in need thereof for producing double-or single-strand breaks in any one or more of exons 43, 44, 45, 50, 51, or 53 of the dystrophin (DMD) gene. In some embodiments, the guide RNA pair described herein in any of the vector configurations described herein can be administered to a subject in need thereof to ablate a portion of DMD, thereby treating DMD. In some embodiments, any of the compositions described herein may be administered to a subject in need thereof for the treatment of DMD. In some embodiments, a nucleic acid molecule comprising a first nucleic acid encoding one or more guide RNAs of table 1A, table 1B, or table 5 and a second nucleic acid encoding SaCas9 or slaucas 9 (depending on the guide) is administered to a subject to treat DMD. In some embodiments, a single nucleic acid molecule (which may be a vector, including an AAV vector) comprising a first nucleic acid encoding one or more guide RNAs of table 1A, table 1B, or table 5 and a second nucleic acid encoding SaCas9 or slaucas 9 (depending on the guide) is administered to a subject to treat DMD.

In some embodiments, any of the compositions described herein are administered to a subject in need thereof to treat Duchenne Muscular Dystrophy (DMD).

In some embodiments, any of the compositions described herein are administered to a subject in need thereof to induce a double strand break in any one or more of exons 43, 44, 45, 50, 51 or 53 of the dystrophin gene.

In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, comprising delivering any of the compositions described herein to a cell, wherein the cell comprises a dystrophin gene mutation known to be associated with DMD.

In particular, in some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: 1) A nucleic acid molecule comprising: nucleic acids encoding one or more spacer sequences selected from the group consisting of SEQ ID NOS 1-35, 1000-1078 and 3000-3069; nucleic acids encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NOs 1 to 35, 1000 to 1078 and 3000 to 3069; or a nucleic acid encoding one or more spacer sequences at least 90% identical to any one of SEQ ID NOs 1-35, 1000-1078, 3000-3069; and 2) staphylococcus aureus Cas9 (SaCas 9) or a nucleic acid encoding (SaCas 9).

In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: 1) A nucleic acid molecule comprising: nucleic acids encoding one or more spacer sequences selected from the group consisting of SEQ ID NOS 1-35, 1000-1078 and 3000-3069; nucleic acids encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NOs 1 to 35, 1000 to 1078 and 3000 to 3069; or a nucleic acid encoding one or more spacer sequences at least 90% identical to any one of SEQ ID NOs 1-35, 1000-1078, 3000-3069; and 2) staphylococcus aureus Cas9 (SaCas 9) or a nucleic acid encoding (SaCas 9); wherein the cell comprises a dystrophin gene mutation known to be associated with DMD.

In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: a single nucleic acid molecule comprising: 1) Nucleic acids encoding one or more spacer sequences selected from the group consisting of SEQ ID NOS 1-35, 1000-1078 and 3000-3069; nucleic acids encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NOs 1 to 35, 1000 to 1078 and 3000 to 3069; or a nucleic acid encoding one or more spacer sequences which are at least 90% identical to any one of SEQ ID NOs 1 to 35, 1000 to 1078 and 3000 to 3069; and 2) a nucleic acid encoding SaCas 9.

In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell a single nucleic acid molecule comprising: 1) A nucleic acid encoding one or more spacer sequences selected from the group consisting of SEQ ID NOs 10, 12, 15, 16, 20, 27, 28, 32, 33, 35, 1001, 1003, 1005, 1010, 1012, 1013, 1016, 1017 and 1018; a nucleic acid encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from SEQ ID NOs 10, 12, 15, 16, 20, 27, 28, 32, 33, 35, 1001, 1003, 1005, 1010, 1012, 1013, 1016, 1017 and 1018; or a nucleic acid encoding one or more spacer sequences at least 90% identical to any one of SEQ ID NOs 10, 12, 15, 16, 20, 27, 28, 32, 33, 35, 1001, 1003, 1005, 1010, 1012, 1013, 1016, 1017 and 1018; and 2) a nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9). In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: a single nucleic acid molecule comprising: 1) A nucleic acid encoding one or more spacer sequences selected from the group consisting of SEQ ID NOs 10, 12, 15, 16, 20, 27, 28, 32, 33, 35, 1001, 1003, 1005, 1010, 1012, 1013, 1016, 1017 and 1018; a nucleic acid encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of one or more spacer sequences selected from SEQ ID NOs 10, 12, 15, 16, 20, 27, 28, 32, 33, 35, 1001, 1003, 1005, 1010, 1012, 1013, 1016, 1017 and 1018; or a nucleic acid encoding one or more spacer sequences at least 90% identical to any one of SEQ ID NOs 10, 12, 15, 16, 20, 27, 28, 32, 33, 35, 1001, 1003, 1005, 1010, 1012, 1013, 1016, 1017 and 1018; and 2) a nucleic acid encoding SaCas 9. In some embodiments, the spacer sequence is SEQ ID NO. 10. In some embodiments, the spacer sequence is SEQ ID NO. 12. In some embodiments, the spacer sequence is SEQ ID NO. 15. In some embodiments, the spacer sequence is SEQ ID NO. 16. In some embodiments, the spacer sequence is SEQ ID NO. 20. In some embodiments, the spacer sequence is SEQ ID NO 27. In some embodiments, the spacer sequence is SEQ ID NO. 28. In some embodiments, the spacer sequence is SEQ ID NO. 32. In some embodiments, the spacer sequence is SEQ ID NO. 33. In some embodiments, the spacer sequence is SEQ ID NO. 35. In some embodiments, the spacer sequence is SEQ ID NO. 1001. In some embodiments, the spacer sequence is SEQ ID NO. 1003. In some embodiments, the spacer sequence is SEQ ID NO 1005. In some embodiments, the spacer sequence is SEQ ID NO 1010. In some embodiments, the spacer sequence is SEQ ID NO 1012. In some embodiments, the spacer sequence is SEQ ID NO. 1013. In some embodiments, the spacer sequence is SEQ ID NO. 1016. In some embodiments, the spacer sequence is SEQ ID NO 1017. In some embodiments, the spacer sequence is SEQ ID NO. 1018.

In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell a single nucleic acid molecule comprising: 1) A nucleic acid encoding one or more spacer sequences selected from SEQ ID NOs 3022, 3023, 3028, 3029, 3030, 3031, 3038, 3039, 3052, 3053, 3054, 3055, 3062, 3063, 3064, 3065, 3068 and 3069; a nucleic acid encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from SEQ ID NOs 3022, 3023, 3028, 3029, 3030, 3031, 3038, 3039, 3052, 3053, 3054, 3055, 3062, 3063, 3064, 3065, 3068 and 3069; or a nucleic acid encoding one or more spacer sequences that are at least 90% identical to any one of SEQ ID NOs 3022, 3023, 3028, 3029, 3030, 3031, 3038, 3039, 3052, 3053, 3054, 3055, 3062, 3063, 3064, 3065, 3068 and 3069; and 2) a nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9). In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: a single nucleic acid molecule comprising: 1) A nucleic acid encoding one or more spacer sequences selected from SEQ ID NOs 3022, 3023, 3028, 3029, 3030, 3031, 3038, 3039, 3052, 3053, 3054, 3055, 3062, 3063, 3064, 3065, 3068 and 3069; a nucleic acid encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of one or more spacer sequences selected from SEQ ID NOs 3022, 3023, 3028, 3029, 3030, 3031, 3038, 3039, 3052, 3053, 3054, 3055, 3062, 3063, 3064, 3065, 3068 and 3069; or a nucleic acid encoding one or more spacer sequences that are at least 90% identical to any one of SEQ ID NOs 3022, 3023, 3028, 3029, 3030, 3031, 3038, 3039, 3052, 3053, 3054, 3055, 3062, 3063, 3064, 3065, 3068 and 3069; and 2) a nucleic acid encoding SaCas 9. In some embodiments, the spacer sequence is SEQ ID NO. 3022. In some embodiments, the spacer sequence is SEQ ID NO. 3023. In some embodiments, the spacer sequence is SEQ ID NO. 3028. In some embodiments, the spacer sequence is SEQ ID NO. 3029. In some embodiments, the spacer sequence is SEQ ID NO. 3030. In some embodiments, the spacer sequence is SEQ ID NO. 3031. In some embodiments, the spacer sequence is SEQ ID NO. 3038. In some embodiments, the spacer sequence is SEQ ID NO. 3039. In some embodiments, the spacer sequence is SEQ ID NO. 3052. In some embodiments, the spacer sequence is SEQ ID NO. 3053. In some embodiments, the spacer sequence is SEQ ID NO 3054. In some embodiments, the spacer sequence is SEQ ID NO. 3055. In some embodiments, the spacer sequence is SEQ ID NO 3062. In some embodiments, the spacer sequence is SEQ ID NO 3063. In some embodiments, the spacer sequence is SEQ ID NO 3064. In some embodiments, the spacer sequence is SEQ ID NO 3065. In some embodiments, the spacer sequence is SEQ ID NO 3068. In some embodiments, the spacer sequence is SEQ ID NO 3069.

In particular, in some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: 1) A nucleic acid molecule comprising: nucleic acids encoding one or more spacer sequences selected from the group consisting of SEQ ID NOS 100-225, 2000-2116 and 4000-4251; nucleic acids encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; or a nucleic acid encoding one or more spacer sequences which are at least 90% identical to any one of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; and 2) staphylococcus lucas9 or a nucleic acid molecule encoding SluCas 9.

In particular, in some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: 1) A nucleic acid molecule comprising: nucleic acids encoding one or more spacer sequences selected from the group consisting of SEQ ID NOS 100-225, 2000-2116 and 4000-4251; nucleic acids encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; or a nucleic acid encoding one or more spacer sequences which are at least 90% identical to any one of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; and 2) staphylococcus lucas9 or a nucleic acid molecule encoding SluCas 9; wherein the cell comprises a dystrophin gene mutation known to be associated with DMD.

In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: a single nucleic acid molecule comprising: 1) Nucleic acids encoding one or more spacer sequences selected from the group consisting of SEQ ID NOS 100-225, 2000-2116 and 4000-4251; nucleic acids encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; or a nucleic acid encoding one or more spacer sequences which are at least 90% identical to any one of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; and 2) a nucleic acid encoding staphylococcus lucas 9.

In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: 1) A nucleic acid molecule comprising: a nucleic acid encoding one or more spacer sequences selected from the group consisting of SEQ ID NOs 131, 134, 135, 136, 139, 140, 141, 144, 145, 146, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224, 225; a nucleic acid encoding a spacer sequence comprising at least 17, 18, 19 or 20 contiguous nucleotides of one or more spacer sequences selected from SEQ ID NOs 131, 134, 135, 136, 139, 140, 141, 144, 145, 146, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224, 225; or a nucleic acid encoding one or more spacer sequences at least 90% identical to any one of SEQ ID NOs 131, 134, 135, 136, 139, 140, 141, 144, 145, 146, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224, 225; and 2) staphylococcus lucas9 or a nucleic acid molecule encoding SluCas 9. In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: a single nucleic acid molecule comprising: 1) A nucleic acid encoding one or more spacer sequences selected from the group consisting of SEQ ID NOs 131, 134, 135, 136, 139, 140, 141, 144, 145, 146, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224, 225; a nucleic acid encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of one or more spacer sequences selected from SEQ ID NOs 131, 134, 135, 136, 139, 140, 141, 144, 145, 146, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224, 225; or a nucleic acid encoding one or more spacer sequences at least 90% identical to any one of SEQ ID NOs 131, 134, 135, 136, 139, 144, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224, 225; and 2) a nucleic acid encoding staphylococcus lucas 9. In some embodiments, the spacer sequence is SEQ ID NO. 131. In some embodiments, the spacer sequence is SEQ ID NO. 134. In some embodiments, the spacer sequence is SEQ ID NO. 135. In some embodiments, the spacer sequence is SEQ ID NO. 136. In some embodiments, the spacer sequence is SEQ ID NO 139. In some embodiments, the spacer sequence is SEQ ID NO. 140. In some embodiments, the spacer sequence is SEQ ID NO. 141. In some embodiments, the spacer sequence is SEQ ID NO. 144. In some embodiments, the spacer sequence is SEQ ID NO. 145. In some embodiments, the spacer sequence is SEQ ID NO. 146. In some embodiments, the spacer sequence is SEQ ID NO. 148. In some embodiments, the spacer sequence is SEQ ID NO:149. In some embodiments, the spacer sequence is SEQ ID NO. 150. In some embodiments, the spacer sequence is SEQ ID NO. 151. In some embodiments, the spacer sequence is SEQ ID NO. 179. In some embodiments, the spacer sequence is SEQ ID NO. 184. In some embodiments, the spacer sequence is SEQ ID NO. 201. In some embodiments, the spacer sequence is SEQ ID NO. 223. In some embodiments, the spacer sequence is SEQ ID NO 224. In some embodiments, the spacer sequence is SEQ ID NO 225.

In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: 1) A nucleic acid molecule comprising: a nucleic acid encoding one or more spacer sequences selected from the group consisting of SEQ ID NOs 4062, 4063, 4068, 4069, 4070, 4071, 4072, 4073, 4078, 4079, 4088, 4089, 4096, 4097, 4098, 4099, 4100, 4101, 4102, 4103, 4158, 4159, 4168, 4169, 4202, 4203, 4220, 4221, 4246, 4247, 4248, 4249, 4250, 4251; a nucleic acid encoding a spacer sequence comprising at least 17, 18, 19 or 20 contiguous nucleotides of one or more spacer sequences selected from SEQ ID NOs 4062, 4063, 4068, 4069, 4070, 4071, 4072, 4073, 4078, 4079, 4088, 4089, 4096, 4097, 4098, 4099, 4100, 4101, 4102, 4103, 4158, 4159, 4168, 4169, 4202, 4203, 4220, 4221, 4246, 4247, 4248, 4249, 4250, 4251; or encodes one or more nucleic acids that is at least 90% identical to any one of SEQ ID NOs 4062, 4063, 4068, 4069, 4070, 4071, 4072, 4073, 4078, 4079, 4088, 4089, 4096, 4097, 4098, 4099, 4100, 4101, 4102, 4103, 4158, 4159, 4168, 4169, 4202, 4203, 4220, 4221, 4246, 4247, 4248, 4249, 4250, 4251; and 2) staphylococcus lucas9 or a nucleic acid molecule encoding SluCas 9. In some embodiments, a method of treating Duchenne Muscular Dystrophy (DMD) is provided, the method comprising delivering to a cell: a single nucleic acid molecule comprising: 1) A nucleic acid encoding one or more spacer sequences selected from the group consisting of SEQ ID NOs 4062, 4063, 4068, 4069, 4070, 4071, 4072, 4073, 4078, 4079, 4088, 4089, 4096, 4097, 4098, 4099, 4100, 4101, 4102, 4103, 4158, 4159, 4168, 4169, 4202, 4203, 4220, 4221, 4246, 4247, 4248, 4249, 4250, 4251; a nucleic acid encoding one or more spacer sequences comprising at least 17, 18, 19 or 20 contiguous nucleotides of one or more spacer sequences selected from SEQ ID NOs 4062, 4063, 4068, 4069, 4070, 4071, 4072, 4073, 4078, 4079, 4088, 4089, 4096, 4097, 4098, 4099, 4100, 4101, 4102, 4103, 4158, 4159, 4168, 4169, 4202, 4203, 4220, 4221, 4246, 4247, 4248, 4249, 4250, 4251; or a nucleic acid encoding one or more spacer sequences at least 90% identical to any one of SEQ ID NOs 4062, 4063, 4068, 4069, 4070, 4071, 4072, 4073, 4078, 4079, 4088, 4089, 4096, 4097, 4098, 4099, 4100, 4101, 4102, 4103, 4158, 4159, 4168, 4169, 4202, 4203, 4220, 4221, 4246, 4247, 4248, 4249, 4250, 4251; and 2) a nucleic acid encoding staphylococcus lucas 9. In some embodiments, the spacer sequence is SEQ ID NO. 4062. In some embodiments, the spacer sequence is SEQ ID NO. 4063. In some embodiments, the spacer sequence is SEQ ID NO:4068. In some embodiments, the spacer sequence is SEQ ID NO:4069. In some embodiments, the spacer sequence is SEQ ID NO. 4070. In some embodiments, the spacer sequence is SEQ ID NO:4071. In some embodiments, the spacer sequence is SEQ ID NO:4072. In some embodiments, the spacer sequence is SEQ ID NO:4073. In some embodiments, the spacer sequence is SEQ ID NO:4078. In some embodiments, the spacer sequence is SEQ ID NO. 4079. In some embodiments, the spacer sequence is SEQ ID NO. 4088. In some embodiments, the spacer sequence is SEQ ID NO. 4089. In some embodiments, the spacer sequence is SEQ ID NO:4096. In some embodiments, the spacer sequence is SEQ ID NO. 4097. In some embodiments, the spacer sequence is SEQ ID NO. 4098. In some embodiments, the spacer sequence is SEQ ID NO. 4099. In some embodiments, the spacer sequence is SEQ ID NO:4100. In some embodiments, the spacer sequence is SEQ ID NO:4101. In some embodiments, the spacer sequence is SEQ ID NO:4102. In some embodiments, the spacer sequence is SEQ ID NO:4103. In some embodiments, the spacer sequence is SEQ ID NO:4158. In some embodiments, the spacer sequence is SEQ ID NO:4159. In some embodiments, the spacer sequence is SEQ ID NO:4168. In some embodiments, the spacer sequence is SEQ ID NO:4169. In some embodiments, the spacer sequence is SEQ ID NO 4202. In some embodiments, the spacer sequence is SEQ ID NO 4203. In some embodiments, the spacer sequence is SEQ ID NO:4220. In some embodiments, the spacer sequence is SEQ ID NO:4221. In some embodiments, the spacer sequence is SEQ ID NO:4246. In some embodiments, the spacer sequence is SEQ ID NO:4247. In some embodiments, the spacer sequence is SEQ ID NO:4248. In some embodiments, the spacer sequence is SEQ ID NO:4249. In some embodiments, the spacer sequence is SEQ ID NO:4250. In some embodiments, the spacer sequence is SEQ ID NO:4251.

In some embodiments, the method comprises delivering a nucleic acid molecule encoding SaCas9 to the cell, wherein the SaCas9 comprises the amino acid sequence SEQ ID NO 711. In some embodiments, the method comprises delivering a nucleic acid molecule encoding SaCas9 to the cell, wherein the SaCas9 is a variant of amino acid sequence SEQ ID NO:711. In some embodiments, the methods comprise delivering a nucleic acid molecule encoding SaCas9 to a cell, wherein the SaCas9 comprises an amino acid sequence selected from any of SEQ ID NOS 715-717. In some embodiments, the method comprises delivering a nucleic acid molecule encoding SaCas9 to a cell, wherein the SaCas9 comprises the amino acid of SEQ ID NO. 715.

In some embodiments, the method comprises delivering a nucleic acid molecule encoding a slaucas 9 to the cell, wherein the slaucas 9 comprises the amino acid sequence of SEQ ID No. 712. In some embodiments, the method comprises delivering a nucleic acid molecule encoding a slacas 9 to a cell, wherein the SaCas9 is a variant of amino acid sequence SEQ ID No. 712. In some embodiments, the method comprises delivering a nucleic acid molecule encoding a slaucas 9 to a cell, wherein the slaucas 9 comprises an amino acid sequence selected from any one of SEQ ID NOs 718-720.

In some embodiments, methods for treating Duchenne Muscular Dystrophy (DMD) are provided, the methods comprising delivering to a cell a single nucleic acid molecule comprising: a nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising: a first spacer sequence and a second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16; and 1018 and 16; and nucleic acids encoding staphylococcus aureus Cas9 (SaCas 9). In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOs 10 and 15. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOs 10 and 16. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 12 and 16. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1001 and 1005. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1001 and 15. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1001 and 16. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1003 and 1005. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 16 and 1003. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 12 and 1010. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 12 and 1012. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 12 and 1013. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOs 10 and 1016. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1017 and 16. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1018 and 16.

In some embodiments, methods for treating Duchenne Muscular Dystrophy (DMD) are provided, the methods comprising delivering to a cell a single nucleic acid molecule comprising: a nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising: a first spacer sequence and a second spacer sequence comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16; and 1018 and 16; and nucleic acids encoding staphylococcus aureus Cas9 (SaCas 9).

In some embodiments, methods for treating Duchenne Muscular Dystrophy (DMD) are provided, the methods comprising delivering to a cell a single nucleic acid molecule comprising: a nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising: a first spacer sequence and a second spacer sequence selected from spacer sequences that are at least 90% identical to any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16; and 1018 and 16; and nucleic acids encoding staphylococcus aureus Cas9 (SaCas 9).

In some embodiments, methods for treating Duchenne Muscular Dystrophy (DMD) are provided, the methods comprising delivering to a cell a single nucleic acid molecule comprising: a nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising: a first spacer sequence and a second spacer sequence selected from any one of: 1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16; and 1018 and 16; and a nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9), wherein the nucleic acid encoding SaCas9 comprises the amino acid sequence SEQ ID No. 715. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1001 and 1005. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1001 and 15. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1001 and 16. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1003 and 1005. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 16 and 1003. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 12 and 1010. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 12 and 1012. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 12 and 1013. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOs 10 and 1016. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1017 and 16. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 1018 and 16.

In some embodiments, methods for treating Duchenne Muscular Dystrophy (DMD) are provided, the methods comprising delivering to a cell a single nucleic acid molecule comprising: a nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising: a first spacer sequence and a second spacer sequence comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of any one of: 1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16; and 1018 and 16; and a nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9), wherein the nucleic acid encoding SaCas9 comprises the amino acid sequence SEQ ID No. 715.

In some embodiments, methods for treating Duchenne Muscular Dystrophy (DMD) are provided, the methods comprising delivering to a cell a single nucleic acid molecule comprising: a nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising: a first spacer sequence and a second spacer sequence that are at least 90% identical to any one of: 1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16; and 1018 and 16; and a nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9), wherein the nucleic acid encoding SaCas9 comprises the amino acid sequence SEQ ID No. 715.

In some embodiments, methods for treating Duchenne Muscular Dystrophy (DMD) are provided, the methods comprising delivering to a cell a single nucleic acid molecule comprising: a nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising: a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151; and 146 and 148; and nucleic acids encoding staphylococcus lucas 9. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 148 and 134. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 149 and 135. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 150 and 135. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS.131 and 136. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 151 and 136. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 139 and 131. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 139 and 151. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 140 and 131. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 140 and 151. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOs 141 and 148. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 144 and 149. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 144 and 150. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 145 and 131. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 145 and 151. In some embodiments, the first spacer sequence and the second spacer sequence are selected from SEQ ID NOS 146 and 148.

In some embodiments, methods for treating Duchenne Muscular Dystrophy (DMD) are provided, the methods comprising delivering to a cell a single nucleic acid molecule comprising: a nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising: a first spacer sequence and a second spacer sequence comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151; and 146 and 148; and nucleic acids encoding staphylococcus lucas 9.

In some embodiments, methods for treating Duchenne Muscular Dystrophy (DMD) are provided, the methods comprising delivering to a cell a single nucleic acid molecule comprising: a nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising: a first spacer sequence and a second spacer sequence selected from spacer sequences that are at least 90% identical to any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151; and 146 and 148; and nucleic acids encoding staphylococcus lucas 9.

In some embodiments, methods are provided for excision of a portion of an exon in a subject with Duchenne Muscular Dystrophy (DMD) using a premature stop codon, the method comprising delivering to a cell a single nucleic acid molecule comprising: (i) A nucleic acid encoding a pair of guide RNAs, wherein a first guide RNA binds to a target sequence within an exon upstream of a premature stop codon, and wherein a second guide RNA binds to a sequence downstream of the premature stop codon and downstream of the sequence to which the first guide RNA binds; and (ii) a nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9); wherein the guide RNA pair cleaves a portion of an exon from SaCas 9. In some embodiments, a single nucleic acid molecule is delivered to a cell on a single vector. In some embodiments, the exon portions remaining after excision are rejoined via one nucleotide insertion. In some embodiments, the exon portions remaining after excision are rejoined without nucleotide insertion. The exact segmental deletions mean that the double cleavage process produces specific deletions. This exact deletion may cause the exon framework to be reconstructed (see, e.g., fig. 6). In some embodiments, the size of the excised portion is between 5 and 250, 5 and 225, 5 and 200, 5 and 190, 5 and 180, 5 and 170, 5 and 160, 5 and 150, 5 and 125, 5 and 120, 5 and 115, 5 and 110, 5 and 100, 5 and 95, 5 and 90, 5 and 85, 5 and 80, 5 and 75, 5 and 70, 5 and 65, 5 and 60, 5 and 55, 5 and 50, 5 and 45, 5 and 40, 5 and 35, 5 and 30, 5 and 25, 5 and 20, 5 and 15, and 5-10 nucleotides. In some embodiments, the size of the excised portion is between 20 and 250, 20 and 225, 20 and 200, 20 and 190, 20 and 180, 20 and 170, 20 and 160, 20 and 150, 20 and 125, 20 and 120, 20 and 115, 20 and 110, 20 and 100, 20 and 95, 20 and 90, 20 and 85, 20 and 80, 20 and 75, 20 and 70, 20 and 65, 20 and 60, 20 and 55, 20 and 50, 20 and 45, 20 and 40, 20 and 35, 20 and 30, and 20 and 25 nucleotides. In some embodiments, the size of the excised portion is between 50 and 250, 50 and 225, 50 and 200, 50 and 190, 50 and 180, 50 and 170, 50 and 160, 50 and 150, 50 and 125, 50 and 120, 50 and 115, 50 and 110, and 50 and 100 nucleotides. In some embodiments, the size of the excised portion of the exon is between 8 and 167 nucleotides. In some embodiments, the exon is exon 45 of the actin gene. In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 10 and 15 (or SEQ ID NOS 15 and 10). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 10 and 16 (or SEQ ID NOS 16 and 10). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 12 and 16 (or SEQ ID NOS: 16 and 12). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 1001 and 1005 (or SEQ ID NOS 1005 and 1001). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 1001 and 15 (or SEQ ID NOS 15 and 1001). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 1001 and 16 (or SEQ ID NOS 16 and 1001). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 1003 and 1005 (or SEQ ID NOS 1005 and 1003). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 16 and 1003 (or SEQ ID NOS: 1003 and 16). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 12 and 1010 (or SEQ ID NOS: 1010 and 12). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 12 and 1012 (or SEQ ID NOS 1012 and 12). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 12 and 1013 (or SEQ ID NOS 1013 and 12). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 10 and 1016 (or SEQ ID NOS 1016 and 10). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 1017 and 16 (or SEQ ID NOS 16 and 1017). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 1018 and 16 (or SEQ ID NOS 16 and 1018). In some embodiments, saCas9 comprises the amino acid sequence of SEQ ID NO. 715.

In some embodiments, methods are provided for excision of a portion of an exon in a subject with Duchenne Muscular Dystrophy (DMD) using a premature stop codon, the method comprising delivering to a cell a single nucleic acid molecule comprising: (i) A nucleic acid encoding a pair of guide RNAs, wherein a first guide RNA binds to a target sequence within an exon upstream of a premature stop codon, and wherein a second guide RNA binds to a sequence downstream of the premature stop codon and downstream of the sequence to which the first guide RNA binds; and (ii) a nucleic acid encoding staphylococcus lucas9 (lucas 9); wherein the guide RNA pair cleaves a portion of the exon from the slecas 9. In some embodiments, a single nucleic acid molecule is delivered to a cell on a single vector. In some embodiments, the exon portions remaining after excision are rejoined via one nucleotide insertion. In some embodiments, the exon portions remaining after excision are rejoined without nucleotide insertion. In some embodiments, the size of the excised portion of the exon is between 8 and 167 nucleotides. In some embodiments, the exon is exon 45 of the actin gene. In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 148 and 134 (or SEQ ID NOS: 134 and 148). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 149 and 135 (or SEQ ID NOS: 135 and 149). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 150 and 135 (or SEQ ID NOS: 135 and 150). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS.131 and 136 (or SEQ ID NOS.136 and 131). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 151 and 136 (or SEQ ID NOS: 136 and 151). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 139 and 131 (or SEQ ID NOS 131 and 139). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 139 and 151 (or SEQ ID NOS 151 and 139). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 140 and 131 (or SEQ ID NOS: 131 and 140). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 140 and 151 (or SEQ ID NOS: 151 and 140). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 141 and 148 (or SEQ ID NOS: 148 and 141). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 144 and 149 (or SEQ ID NOS: 149 and 144). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 144 and 150 (or SEQ ID NOS 150 and 144). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 145 and 131 (or SEQ ID NOS: 131 and 145). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS: 145 and 151 (or SEQ ID NOS: 151 and 145). In some embodiments, the guide RNA pair comprises a first spacer sequence and a second spacer sequence of SEQ ID NOS 146 and 148 (or SEQ ID NOS 148 and 146).

In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

For treating a subject (e.g., a human), any of the compositions disclosed herein can be administered in a manner compatible with the dosage formulation and in a therapeutically effective amount. The composition can be readily administered in a variety of dosage forms (e.g., injectable solutions). For parenteral administration in the form of an aqueous solution, for example, the solution should generally be suitably buffered, and first rendered isotonic with, for example, sufficient physiological saline or glucose to render the liquid diluent isotonic. Such aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and/or intraperitoneal administration.

Combination therapy

In some embodiments, the invention encompasses combination therapies comprising any of the methods or uses described herein, as well as additional therapies suitable for ameliorating DMD.

Delivery of guide RNA compositions

The methods and uses disclosed herein may use any suitable method for delivering the guide RNAs and compositions described herein. Exemplary delivery methods include vectors, such as viral vectors; lipid nanoparticles; transfection; and electroporation. In some embodiments, the vector or LNP that binds to the single vector guide RNA/Cas9 disclosed herein is used to prepare a medicament for the treatment of DMD.

In the case of using a vector, it may be a viral vector, for example, a non-integrative viral vector. In some embodiments, the viral vector is an adeno-associated viral vector (AAV), a lentiviral vector, an integrase-deficient lentiviral vector, an adenoviral vector, a vaccinia viral vector, an alphaviral vector, or a herpes simplex viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh10 (see, e.g., SEQ ID No. 81 of US 9,790,472, which is incorporated herein by reference in its entirety), AAVrh74 (see, e.g., SEQ ID No. 1 of US 2015/011955, which is incorporated herein by reference in its entirety), or AAV9 vector, wherein numbers following AAV are indicative of AAV serotypes. In some embodiments, the AAV vector is a single stranded AAV (ssAAV). In some embodiments, the AAV vector is a double stranded AAV (dsAAV). The generic terms AAV vector, AAV1 vector, etc., encompass an AAV vector or any variant of its serotype, such as a self-complementary AAV (scAAV) vector. For a detailed discussion of various AAV vectors, see, e.g., mcCarty et al, gene ter.2001; 1248-54; naso et al, biodrugs 2017;31:317-334, and references cited therein. In some embodiments, the nucleotide length dimension of an AAV vector from ITR to ITR (including two ITRs) is measured. In some embodiments, the AAV vector is less than 5kb in size from ITR to ITR (including two ITRs). In particular embodiments, the AAV vector has a size from ITR to ITR (including two ITRs) of less than 4.9kb. In other embodiments, the AAV vector has a size from ITR to ITR (including two ITRs) of less than 4.85kb. In other embodiments, the AAV vector has a size from ITR to ITR (including two ITRs) of less than 4.8kb. In other embodiments, the AAV vector has a size from ITR to ITR (including two ITRs) of less than 4.75kb. In other embodiments, the AAV vector has a size from ITR to ITR (including two ITRs) of less than 4.7kb. In some embodiments, the size of the vector from ITR to ITR (including both ITRs) is between 3.9-5kb, 4-5kb, 4.2-5kb, 4.4-5kb, 4.6-5kb, 4.7-5kb, 3.9-4.9kb, 4.2-4.9kb, 4.4-4.9kb, 4.7-4.9kb, 3.9-4.85kb, 4.2-4.85kb, 4.4-4.85kb, 4.6-4.85kb, 4.7-4.9kb, 3.9-4.8kb, 4.2-4.8kb, 4.4-4.8kb, or 4.6-4.8 kb. In some embodiments, the size of the vector from ITR to ITR (including two ITRs) is between 4.4-4.85 kb. In some embodiments, the vector is an AAV9 vector.

In some embodiments, the vector (e.g., a viral vector, such as an adeno-associated viral vector) comprises a tissue-specific (e.g., muscle-specific) promoter, such as operably linked to a sequence encoding a guide RNA. In some embodiments, the muscle-specific promoter is a muscle creatine kinase promoter, a desmin promoter, a MHCK7 promoter, or a SPc5-12 promoter. In some embodiments, the muscle-specific promoter is a CK8 promoter. In some embodiments, the muscle-specific promoter is a CK8e promoter. Muscle-specific promoters are described in detail in, for example, US2004/0175727A1; wang et al, expert Opin Drug deliv. (2014) 11,345-364; wang et al, gene Therapy (2008) 15,1489-1499. In some embodiments, the tissue-specific promoter is a neuron-specific promoter, such as an enolase promoter. For a detailed discussion of tissue-specific promoters (including neuronal-specific promoters), see, e.g., naso et al, biopugs 2017;31:317-334; dashkoff et al Mol Ther Methods Clin Dev.2016;3:16081, and references cited therein.

In some embodiments, the vector further comprises a nucleic acid that does not encode a guide RNA in addition to the guide RNA and Cas9 sequences. Nucleic acids that do not encode guide RNAs and Cas9 include, but are not limited to, promoters, enhancers and regulatory sequences. In some embodiments, the vector comprises one or more nucleotide sequences encoding crrnas, trrnas, or both crrnas and trrnas.

Lipid Nanoparticles (LNPs) are a known means for delivering nucleotide and protein cargo and can be used to deliver guide RNAs, compositions or pharmaceutical formulations disclosed herein. In some embodiments, the LNP delivers a nucleic acid, a protein, or both.

Electroporation is a well known means of delivering cargo, and any electroporation method may be used to deliver the individual carriers disclosed herein.

In some embodiments, the invention includes a method for delivering any of the individual vectors disclosed herein to an ex vivo cell, wherein the guide RNA is encoded by the vector in combination with the LNP or in aqueous solution. In some embodiments, the guide RNA/LNP or guide RNA also binds to Cas9 or a sequence encoding Cas9 (e.g., in the same vector, LNP, or solution).

In some embodiments, the present disclosure provides methods of using any of the guides, endonucleases, cells, or compositions disclosed herein in a method of research. For example, any of the guide or endonucleases disclosed herein can be used alone or in combination under different parameters (e.g., temperature, pH, cell type) in an experiment, or in combination with other reagents to evaluate the activity of the guide and/or endonucleases.

Other embodiments encompassed by the present disclosure are as follows.

Embodiment B1 is a composition comprising a single nucleic acid molecule encoding one or more guide RNAs and Cas9, wherein the single nucleic acid molecule comprises:

g. a first nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising a first spacer sequence and a second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; and a second nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9).

k. A first nucleic acid encoding a pair of guide RNAs comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; and a second nucleic acid encoding staphylococcus lucas 9; or (b)

A first nucleic acid encoding a pair of guide RNAs that are at least 90% identical to a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; and a second nucleic acid encoding staphylococcus lucas 9.

Embodiment B2 is the composition of claim 1, wherein the guide RNA is sgRNA.

Embodiment B3 is the composition of claim 1, wherein the guide RNA is modified.

Embodiment B4 is the composition of claim 3, wherein the modification alters one or more 2' positions and/or phosphodiester linkages.

Embodiment B5 is the composition of any one of claims 3-4, wherein the modification alters one or more or all of the first three nucleotides of the guide RNA.

Embodiment B6 is the composition of any one of claims 3-5, wherein the modification alters one or more or all of the last three nucleotides of the guide RNA.

Embodiment B7 is the composition of any one of claims 3-6, wherein the modification comprises one or more of the following: phosphorothioate modifications, 2' -OMe modifications, 2' -O-MOE modifications, 2' -F modifications, 2' -O-methenyl-4 ' bridge modifications, 3' -thiophosphonoacetate modifications or 2' -deoxy modifications.

Embodiment B8 is the composition of any one of the preceding claims, wherein the composition further comprises a pharmaceutically acceptable excipient.

Embodiment B9 is the composition of any one of the preceding claims, wherein the single nucleic acid molecule is bound to a Lipid Nanoparticle (LNP).

Embodiment B10 is the composition of any one of claims 1-8, wherein the single nucleic acid molecule is a viral vector.

Embodiment B11 is the composition of claim 10, wherein the viral vector is an adeno-associated viral vector, a lentiviral vector, an integrase-deficient lentiviral vector, an adenoviral vector, a vaccinia viral vector, an alphaviral vector, or a herpes simplex viral vector.

Embodiment B12 is the composition of claim 10, wherein the viral vector is an adeno-associated virus (AAV) vector.

Embodiment B13 is the composition of claim 12, wherein the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh10, AAVrh74, or AAV9 vector, wherein the number following AAV is indicative of an AAV serotype.

Embodiment B14 is the composition of claim 13, wherein the AAV vector is an AAV serotype 9 vector.

Embodiment B15 is the composition of claim 13, wherein the AAV vector is an AAVrh10 vector.

Embodiment B16 is the composition of claim 13, wherein the AAV vector is an AAVrh74 vector.

Embodiment B17 is the composition of any one of claims 10-16, comprising a viral vector, wherein the viral vector comprises a tissue specific promoter.

Embodiment B18 is the composition of any one of claims 10-16, comprising a viral vector, wherein the viral vector comprises a muscle-specific promoter, optionally wherein the muscle-specific promoter is a muscle creatine kinase promoter, a desmin promoter, an MHCK7 promoter, an SPc5-12 promoter, or a CK8e promoter.

Embodiment B19 is the composition of any one of claims 10-16, comprising a viral vector, wherein the viral vector comprises a U6, H1 or 7SK promoter.

Embodiment B20 is the composition of any one of claims 1-19, comprising a nucleic acid encoding SaCas9, wherein the spacer sequence is selected from any one of SEQ ID NOs 12, 15, 16, 20, 27, 28, 32, 33 and 35.

Embodiment B21 is the composition of any one of claims 1-20, comprising a nucleic acid encoding SaCas9, wherein the SaCas9 comprises the amino acid sequence SEQ ID No. 711.

Embodiment B22 is the composition of any one of claims 1-20, comprising a nucleic acid encoding SaCas9, wherein the SaCas9 is a variant of amino acid sequence SEQ ID No. 711.

Embodiment B23 is the composition of any one of claims 1-20, comprising a nucleic acid encoding SaCas9, wherein the SaCas9 comprises an amino acid sequence selected from any one of SEQ ID NOs 715-717.

Embodiment B24 is the composition of any one of claims 1-19, comprising a nucleic acid encoding slaucas 9, wherein the spacer sequence is selected from any one of SEQ ID NOs 131, 134, 135, 136, 139, 144, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224, 225.

Embodiment B25 is the composition of any one of claims 1-19 or 24, comprising a nucleic acid encoding slaucas 9, wherein the slaucas 9 comprises the amino acid sequence SEQ ID NO 712.

Embodiment B26 is the composition of any one of claims 1-19 or 24 comprising a nucleic acid encoding slaucas 9, wherein said slaucas 9 is a variant of amino acid sequence SEQ ID No. 712.

Embodiment B27 is the composition of any one of claims 1-19 or 24, comprising a nucleic acid encoding slaucas 9, wherein the slaucas 9 comprises an amino acid sequence selected from any one of SEQ ID NOs 718-720.

Embodiment B28 is the composition of any one of claims 1-27 and a pharmaceutically acceptable excipient.

Embodiment B29 is a composition comprising a guide RNA comprising any one of SEQ ID NOs 1-35, 1000-1078 or 3000-3069.

Embodiment B30 is a composition comprising a guide RNA comprising any of SEQ ID NOs 100-225, 2000-2116 or 4000-4251.

Embodiment B31 is a composition of any one of claims 1-30 for use in treating Duchenne Muscular Dystrophy (DMD).

Embodiment B32 is the composition of any one of claims 1-30 for producing a double strand break in any one or more of exons 43, 44, 45, 50, 51 or 53 of a dystrophin gene.

Embodiment B33 is a method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering the composition of any one of claims 1-30 to a cell.

Embodiment B34 is a method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

i) A nucleic acid encoding one or more guide RNAs, wherein the one or more guide RNAs comprise:

a. a spacer sequence selected from SEQ ID NO 1-35, 1000-1078 or 3000-3069;

b. a spacer sequence comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NOs 1 to 35, 1000 to 1078 or 3000 to 3069; or (b)

c. A spacer sequence at least 90% identical to any one of SEQ ID NOs 1-35, 1000-1078, 3000-3069; and

ii) nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9).

Embodiment B35 is a method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

i) A nucleic acid molecule encoding one or more guide RNAs, wherein the one or more guide RNAs comprise:

a. a spacer sequence selected from the group consisting of SEQ ID NO. 100-225, 2000-2116 or 4000-4251;

b. a spacer sequence comprising at least 17, 18, 19 or 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NOs 100-225, 2000-2116 or 4000-4251; or (b)

c. A spacer sequence that is at least 90% identical to any one of SEQ ID NOs 100-225, 2000-2116 or 4000-4251; and

ii) a nucleic acid molecule encoding staphylococcus lucas 9.

Embodiment B36 is a method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

i) A nucleic acid encoding a pair of guide RNAs, the pair of guide RNAs comprising:

a first spacer sequence and a second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018;

a first spacer sequence and a second spacer sequence comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; or (b)

A first spacer sequence and a second spacer sequence that are at least 90% identical to any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; and

ii) nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9).

Embodiment B37 is a method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151; and 146 and 148;

A first spacer sequence and a second spacer sequence comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; or (b)

A first spacer sequence and a second spacer sequence that are at least 90% identical to any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; and

ii) a nucleic acid encoding staphylococcus lucas 9.

Embodiment B38 is the method of any one of claims 34-37, wherein the single nucleic acid molecule is delivered to the cell on a single vector.

Embodiment B39 is the method of any one of claims 34-38, comprising a nucleic acid molecule encoding SaCas9, wherein the spacer sequence is selected from any one of SEQ ID NOs 12, 15, 16, 20, 27, 28, 32, 33 and 35.

Embodiment B40 is the method of any one of claims 34-39, comprising a nucleic acid molecule encoding SaCas9, wherein the SaCas9 comprises the amino acid sequence SEQ ID No. 711.

Embodiment B41 is the method of any one of claims 34-39, comprising a nucleic acid molecule encoding SaCas9, wherein the SaCas9 is a variant of amino acid sequence SEQ ID No. 711.

Embodiment B42 is the method of any one of claims 34-39, comprising a nucleic acid molecule encoding SaCas9, wherein the SaCas9 comprises an amino acid sequence selected from any one of SEQ ID NOs 715-717.

Embodiment B43 is the method of any one of claims 34-38, comprising a nucleic acid molecule encoding slaucas 9, wherein the spacer sequence is selected from any one of SEQ ID NOs 131, 134, 135, 136, 139, 144, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224, 225.

Embodiment B44 is the method of any one of claims 34-38 or 43, comprising a nucleic acid molecule encoding slaucas 9, wherein said slaucas 9 comprises the amino acid sequence SEQ ID NO 712.

Embodiment B45 is the method of any one of claims 34-38 or 43, comprising a nucleic acid molecule encoding slaucas 9, wherein the slaucas 9 is a variant of amino acid sequence SEQ ID No. 712.

Embodiment B46 is the method of any one of claims 34-38 or 43, comprising a nucleic acid molecule encoding slaucas 9, wherein the slaucas 9 comprises an amino acid sequence selected from any one of SEQ ID NOs 718-720.

Embodiment B47 is a method of cleaving a portion of an exon in a subject with Duchenne Muscular Dystrophy (DMD) using a premature stop codon, the method comprising delivering to a cell a single nucleic acid molecule comprising:

i) A nucleic acid encoding a pair of guide RNAs, wherein a first guide RNA binds to a target sequence within the exon upstream of the premature stop codon and wherein a second guide RNA binds to a sequence downstream of the premature stop codon and downstream of the sequence to which the first guide RNA binds; and

ii) a nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9);

wherein the guide RNA pair and SaCas9 excise a portion of the exon.

Embodiment B48 is a method of cleaving a portion of an exon in a subject with Duchenne Muscular Dystrophy (DMD) using a premature stop codon, the method comprising delivering to a cell a single nucleic acid molecule comprising:

ii) a nucleic acid encoding staphylococcus lucas 9;

wherein the guide RNA pair and SaCas9 excise a portion of the exon.

Embodiment B49 is the method of any one of claims 47-48, wherein the single nucleic acid molecule is delivered to the cell on a single vector.

Embodiment B50 is the method of any one of claims 47-49, wherein the remaining exon portions after excision are rejoined via one nucleotide insertion.

Embodiment B51 is the method of any one of claims 47-49, wherein the remaining exon portions after excision are rejoined without nucleotide insertion.

Embodiment B52 is the method of claim 51, wherein the size of the excised portion of the exon is between 8 and 167 nucleotides.

Embodiment B53 is the method of any one of claims 47-52, wherein the exon is exon 45.

Embodiment B54 is the method of any one of claims 47 and 49-53, wherein the guide RNA pair comprises a first spacer sequence and a second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018;

embodiment B55 is the method of any one of claims 48-53, wherein the guide RNA pair comprises a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146.

Embodiment B56 is the method of any one of claims 34, 36, 38-39, 47, and 49-54, wherein the SaCas9 comprises the amino acid sequence SEQ ID No. 715.

Embodiment B57 is the composition or method of any of the preceding claims, wherein the single nucleic acid molecule is an AAV vector, wherein the vector comprises from 5 'to 3' in terms of the plus strand: a reverse complement of the first sgRNA backbone sequence, a reverse complement of a nucleic acid encoding the first sgRNA guide sequence, a reverse complement of a promoter for expressing the nucleic acid encoding the first sgRNA, a promoter (e.g., CK8 e) for expressing the nucleic acid encoding SaCas9, a polyadenylation sequence, a promoter for expressing the second sgRNA in the same direction as the promoter of SaCas9, a second sgRNA guide sequence, and a second sgRNA backbone sequence.

Embodiment B58 is the composition or method of claim 57, wherein the promoter used to express the nucleic acid encoding the first sgRNA guide sequence is the hU6 promoter.

Embodiment B59 is the composition or method of any one of claims 57-58, wherein the promoter used to express the nucleic acid encoding the second sgRNA guide sequence is the hU6 promoter.

Embodiment B60 is the composition or method of claim 57, wherein the promoter used to express the nucleic acid encoding the first sgRNA guide sequence is a 7SK promoter.

Embodiment B61 is the composition or method of any one of claims 57-58 or 60, wherein the promoter for expressing the nucleic acid encoding the second sgRNA guide sequence is a 7SK promoter.

Embodiment B62 is the composition or method of any one of claims 57-58 or 60, wherein the promoter used to express the nucleic acid encoding the second sgRNA guide sequence is an H1m promoter.

Embodiment B63 is the composition or method of any of the preceding claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to a nucleic acid sequence encoding one or more Nuclear Localization Sequences (NLS).

Embodiment B64 is the composition or method of any of the preceding claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS).

Embodiment B65 is the composition or method of any of the preceding claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS).

Embodiment B66 is the composition or method of any of the preceding claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS).

Embodiment B67 is the composition or method of any one of claims 64-66, wherein the one or more NLS comprises an SV40 NLS.

Embodiment B68 is the composition or method of any one of claims 64-66, wherein the one or more NLS comprises a c-Myc NLS.

Examples

The following examples are provided to illustrate certain embodiments disclosed and should not be construed to limit the scope of the disclosure in any way.

Example 1: exemplary DMD sgRNA

The guide RNAs comprising the guide sequences shown in tables 1A and 1B below were prepared as single guide (sgrnas) according to standard methods. A single AAV vector is prepared that expresses one or more of guide RNA and SaCas9 (for guide sequences with SEQ ID NOs: 1-35 or SEQ ID NOs: 3000-3069) or slaucas 9 (for guide sequences with SEQ ID NOs: 100-225 or SEQ ID NOs: 4000-4251). See tables 1A and 1B. AAV vectors are administered to cells in vitro and in mice (e.g., mdx mice) to assess the ability of AAV to express guide RNAs and Cas9, edit the targeting exons (see tables 1A and 1B), and thereby treat DMD.

In particular, the ability of individual AAV-mediated gene editing components delivered in vivo to successfully remove mutant genomic sequences from cardiomyocytes and skeletal muscle cells of mdx mice by exon skipping was tested.

Table 1A: exemplary DMD guide sequence (human-h38.p12)

/>

Table 1B: exemplary DMD guide sequence (20 nucleotides and 21 nucleotides)

/>

Example 2: evaluation of DMD sgRNA

A. Materials and methods

sgRNA selection

A subset of sgrnas targeting the DMD gene was selected for insertion/deletion frequency and distribution evaluation. The sgrnas selected are shown in table 2 and were prepared according to standard methods. In addition to the presence of mouse, dog and non-human primate (NHP) homologous counterparts, criteria for selection of these sgrnas also include their potential to induce exon framework reconstitution and or skipping. This selection includes 13 sgrnas within exon 45, three sgrnas within exon 51, and ten sgrnas within exon 53. The number of predicted off-target sites was determined for each sgRNA.

Transfection of HECK293FT and Neuro-2a cells

To evaluate the frequency and distribution of insertions/deletions, human HEK293FT and mouse Neuro-2a cell lines were used. HEK293FT and Neuro-2a cells were transfected with 750ng plasmid+2.25. Mu.L lipofectamine 2000 in 12 well plates. The third day after transfection, cells were trypsinized and sorted according to Green Fluorescent Protein (GFP). GFP positive cells were sorted directly into lysis buffer and DNA extraction was performed using the GeneJet genomic DNA purification kit. PCR is then performed on the DNA using exon-specific primers targeting the relevant cleavage sites.

3. Deep sequencing of amplicon, library preparation and data analysis

The relevant sites for each exon were amplified by PCR and a sequencing library was prepared using the product using the MiSeq kit V3. Insertion/deletion analysis was performed using a CRISPResso 2.+ -.10-nt quantification window. (see, e.g., clement et al, nat Biotechnol.2019, month 3; 37 (3): 224-226). The insertion/deletion distribution consists of 5 mutually exclusive insertion/deletion categories depicted in fig. 2, and is provided below:

a) And NE: non-editing;

b) Rf. +1:1 nucleotide (nt) insertion, causing framework reconstruction;

c) RF. others: insertions/deletions other than 1-nt insertions that cause frame reconstruction:

● Deletion: not extending to the outside of the frame reconstruction window

● Insertion: <17-nt (i.e., <6 amino acids);

d) Exon skipping: insertion/deletion disrupting exon/intron boundaries ± 6-nt window, which causes potential exon skipping (results need to be verified):

● Overlap of insertion/deletion with splicing window > = 9-nt (disruption of GT/AG splice site); or (b)

3) OE: other insertions/deletions.

The following sequences of the selected primers were used to amplify specific human loci containing sgRNA targets (tables 3A-3B) and specific mouse loci containing sgRNA targets (tables 4A-4B).

TABLE 3A primers for amplification (human)

TABLE 3B primer+Miseq adapter sequence (human)

TABLE 4A primers for amplification (mouse)

TABLE 4B primer+Miseq adapter sequence (mouse)

B. Results

An exemplary set of DMD sgrnas was evaluated for insertion/deletion frequencies and editing profiles with SaCas9 or slaucas 9 (as indicated in table 2). In this selection, 13 sgrnas are located within exon 45, 3 sgrnas are located within exon 51 and 10 sgrnas are located within exon 53. To evaluate the insertion/deletion frequency and distribution, plasmid transfection was performed on HEK293FT and Neuro-2a cell lines.

The average insertion/deletion frequency of exon 45-targeted sgrnas was determined in HEK293FT cells (fig. 3A) and Neuro-2a cells (fig. 3B) with high performance SpCas9 sgrnas (E45 Sp 52) as reference inclusion. Of the evaluated sgrnas targeting exon 45, 11 showed an average total insertion/deletion frequency in HEK293FT cells of greater than 50% and the 10 sgrnas tested were found to have similar results in the Neuro-2a cell line. Regarding the insertion/deletion distribution, E45Sa4 and E45SL24 were found to have the highest percentage of combined insertions/deletions that could cause potential exon re-establishment/skipping in HEK293FT cells. In Neuro-2a cells, mE45Sa4 and mE45SL23 showed the highest ranking for these potential results. sgrnas E45SL17 and E45SL12 are not suitable for Δ44 mutation.

The average insertion/deletion frequency of exon 51-targeted sgrnas was determined in HEK293FT cells (fig. 4A) and Neuro-2a cells (fig. 4B) with high performance SpCas9 sgrnas (E51 Sp 32) as reference inclusion. Fig. 4A shows that E51Sa2 and E51SL10 have a frequency of insertions/deletions in HEK293FT cells of greater than 50% and a combined insertion/deletion profile that can cause potential framework remodeling/skipping of greater than 25%. Because of the reduced level of sequence homology of these sgrnas in the mouse loci, these sgrnas may not be evaluated in the Neuro-2a cell line (e.g., sgrnas E51Sa2 and E51SL10 do not have mouse homologs and see fig. 4B).

The average insertion/deletion frequency of exon 53-targeted sgrnas was determined in HEK293FT cells (fig. 5A) and Neuro-2a cells (fig. 5B) with high performance SpCas9 sgrnas (E55 Sp 63) as reference inclusion. FIG. 5A shows that the frequency of insertion/deletion of 4 sgRNAs within exon 53 of HEK293FT cells is higher than 50%, and FIG. 5B shows similar results for 2 sgRNAs in Neuro-2a cells. Among the evaluated sgrnas targeting exon 53, E53Sa3 and mE53SL23 showed the highest percentage of combined insertions/deletions and had the potential for frame reconstruction/skipping in both cell lines.

Example 3: exemplary DMD guide RNAs for SaCas9 and slaucas 9 variants

Other exemplary DMD guide RNAs were designed that can be used with SaCas9 and SaCas9 variants (e.g., guide sequences with SEQ ID NOs: 1000-1078) and slecas 9 variants (e.g., guide sequences with SEQ ID NOs: 2000-2116) as described in table 5 below. In particular, guide RNAs were designed based on SaCas9-KKH (for guide sequences with SEQ ID NOs: 1000-1078) and PAM sequences NNNRRT (N is any nucleotide, R is a purine) and slecas 9-KH (for guide sequences with SEQ ID NOs: 2000-2116) and PAM sequences NNRG.

The guide RNA was designed focusing on the genomic coordinate region within exons 45, 51 and 53. For exon 45, the design region is the genomic coordinates chrX:31968307-31968546. For exon 51, the design region is the genomic coordinates chrX:31773928-31774224. For exon 53, the design region is the genomic coordinates chrX:31679343-31679618.

Off-target site prediction was performed computationally for both sets of mismatches: (1) 3 mismatches+0 bulges; and (2) 2 mismatches+1 bulges. The results are shown in Table 5.

The guide RNAs comprising the guide sequences shown in table 5 below were prepared as single guide (sgrnas) according to standard methods. Single AAV vectors were prepared that expressed either guide RNA and variant SaCas9 (for guide sequences with SEQ ID NOS: 1000-1078) or guide RNA and variant SlucAS9 (for guide sequences with SEQ ID NOS: 2000-2116). See table 5. AAV vectors are administered to cells in vitro and in mice (e.g., mdx mice) to assess the ability of AAV to express guide RNAs and Cas9, edit targeted exons (see table 5), and thereby treat DMD.

Table 5: additional DMD guide sequence (human-hg38.p12)

/>

Example 4: evaluation of sgRNA pairs a. Materials and methods

sgRNA selection

A subset of SaCas9-KKH or slaucas 9 sgrnas found within the DMD gene were selected for insertion/deletion frequency and distribution evaluation. In addition to the presence of mouse, dog and NHP homologous counterparts, the criteria for selecting these sgrnas also include their potential as a pair to induce exon framework reconstitution and or skipping. This selection included 27 sgrnas located in exon 45, 39 sgrnas located in exon 51, and 29 sgrnas located in exon 53. The number of predicted off-target sites was determined for each sgRNA.

HEK293FT cell transfection

293FT cells were transfected with 750ng plasmid+2.25. Mu.L lipofectamine 2000 in 12 well plates. The third day after transfection, cells were trypsinized and sorted according to GFP. GFP positive cells were sorted directly into lysis buffer and DNA extraction was performed using Promega Maxwell RSC blood DNA kit. PCR is then performed on the DNA using exon-specific primers targeting the relevant cleavage sites.

3. Amplicon deep sequencing library preparation and data analysis

The relevant loci for each exon were amplified by PCR and the products were used to prepare a sequencing library for 600 cycles using the MiSeq kit V3. Insertion/deletion analysis was performed using a CRISPResso 2.+ -.10-nt quantification window. The insertion/deletion distribution consisted of 8 insertion/deletion categories listed in table 6.

Table 6.

4. AAV configuration of double-cut single vector candidates

The combination of promoter orientation, promoter configuration, NLS and backbone was selected for AAV plasmid production and evaluation of sgRNA transgene expression, AAV manufacturability, and in vitro and in vivo editing efficiency. AAV plasmid configurations are listed in Table 7. The promoters, NLS and backbone sequences are listed in Table 8.

Table 7:

/>

table 8:

/>

the selected primer sequences for amplifying a specific human locus containing sgRNA sites are shown in table 9.

Table 9:

* TIDE_hE45_F was used for Sanger sequencing.

5. Results

A set of sgrnas found within the DMD gene was selected for evaluation of insertion/deletion frequencies and distribution. In this selection, 27 sgrnas are located within exon 45, 39 sgrnas are located within exon 51 and 29 sgrnas are located within exon 53. To evaluate the insertion/deletion frequency and editing distribution, plasmid transfection was performed on HEK293FT (fig. 6B) and Neuro-2a cell lines (fig. 6D). The average insertion/deletion frequency of exon 45-targeted sgrnas was determined in HEK293FT cells (fig. 6B) and Neuro-2a cells (fig. 6D) with high performance SpCas9 sgrnas (E45 Sp 52) as reference inclusion. Wherein 20 pairs of sgrnas showed an average total insertion/deletion frequency of higher than 60% and 9 pairs of sgrnas showed an average exact segmental deletion frequency of higher than 50% in 293FT cells. Five sgrnas tested in the Neuro-2a cell line showed an average exact segment deletion frequency of greater than 40% (fig. 6D). Regarding the insertion/deletion distribution, the sgRNA was found to have the highest percentage of exact segment deletions that could cause potential exon framework reconstitution in 293FT cells (FIG. 6B) for E45SaKKH10/20, E45Slu21/7 and E45Slu18/4, and the sgRNA was found to have the highest percentage of exact segment deletions that could cause potential exon framework reconstitution in Neuro-2a cells (FIG. 6D) for E45SaKKH10/23, E45Slu17/22, E45Slu17/23 and E45Slu 19/21. Table 10 shows the SEQ ID NOs corresponding to the sgRNA identifiers in FIGS. 6B and 6C.

Table 10:

/>

example 5: testing of sgRNA backbone sequences

1. Materials and methods

Primary human skeletal myoblasts (HsMM; lonza CC-2580: lot 20TL070666, P0) were recovered and incubated at 37℃with 5% CO2 in an incubatorSkeletal myoblast basal medium +.>Passage in SingleQuots (CC-3246, CC-3244; lonza). When HsMM cultures reached about 80% to 90% confluence and proliferated actively, cells were harvested for slaucas 9 Ribonucleoprotein (RNP) delivery. After thawing, cells were passaged once prior to the slaucas 9 RNP delivery.

To form a Slucas9 RNP, an appropriate amount of synthetic sgRNA (Synthesis: SO # 7292552) was mixed with recombinant Slucas9 protein (Albevron: lot M22536-01) in a complementary P5 primary nuclear transfection solution (Lonza V4 XP-5032). In summary, three sgrnas were tested, the slecas 9 dose, including a low dose of 37.5pmol, 6.25pmol, a medium dose of 75pmol, 12.5pmol, and a high dose of 150:25. The sgrnas and the slecas 9 proteins are incubated at room temperature for at least 10 minutes to form Cas9-sgRNA RNPs.

While the slecas 9 RNP was formed, hsMM was rinsed with HEPES buffered saline solution, dissociated from the tissue culture flask by trypsin, and centrifuged at 90xg for 10 min. The cell pellet was resuspended in fresh complete growth medium pre-warmed. The cell number was counted. The appropriate number of cells were transferred to a new centrifuge tube, pelleted by centrifugation at 90Xg for 10 min, and resuspended in supplemental nuclear transfection solution. Mu.l of the nuclear transfection solution containing about 200,000 cells was mixed with about 7. Mu.l of the preformed Slucas9: sgRNA RNP complex.

About 20. Mu.l of the cell and RNP mixture was transferred to a 16-well nuclear transfection serial tube and then subjected to nuclear transfection using the DS-158 procedure in a 4D-nuclear transfectometer (Lonza). Immediately after nuclear transfection, about 80 μl of pre-warmed medium was added to each nuclear cuvette and incubated for 10 min at 37 ℃. The contents of each nuclear cuvette (100 μl) were transferred to one well of a 12-well plate filled with 2ml of medium and incubated for 48 hours at 37 ℃.

To determine cell viability 48 hours after nuclear transfection, cells were stained with Hoechst and propidium iodide (Life Technologies). Cell viability was then assessed using ImageXpress Micro (Molecular Devices). In general, samples with overall cell viability above 70% were collected and analyzed for insertion/deletion analysis.

To isolate genomic DNA from HsMM, cells were washed with physiological saline buffer, trypsinized and centrifuged. The cell pellet was treated with lysis buffer in Maxwell RSC blood DNA kit (Promega #AS 1400) and usedThe RSC48 instrument (promega#as 8500) extracts genomic DNA according to the manufacturer's instructions. Using Qubit ^TM 1x dsDNA HS assay kit (Thermo Fisher Scientific Q33231), genomic DNA concentration was determined according to manufacturer's instructions.

To determine gene editing efficiency, genomic DNA was amplified using primers flanking the DMD exon 45 genomic region. The following primer sequences were used: miseq_hE45_F TCGT CGGCAGCGTCAGATGTGTATAAGAGACAGgtctttctgtcttgtatcctttgg (SEQ ID NO: 724) and Miseq_hE45_R GTCTCGTGGGCTCGGAGAT GTGTATAAGAGACAGaatgttagtgcctttcaccc (SEQ ID NO: 725). The amplicon size was verified by analysis of a small amount of PCR product on a 2% e-gel (Thermo Fisher Scientific). A portion of the PCR product and forward primer were then submitted to Genewiz for sanger sequencing.

The edit efficiency and insertion/deletion distribution were determined using the sequencing result through a mass filter, using the TIDE (composition tracking insertion/deletion) algorithm. Using the appropriate sgRNA sequences, default analysis parameters and mock nuclear transfection samples as controls, the analysis was performed using the following versions of the algorithm: https:// shiny. Vrtx. Com/app/orrj/tide/. The percentage of other insertions and deletions that have the potential to repair the mutated reading frame of a particular DMD patient of interest is referred to as "RF others". This indicates that there are total numbers of 2, 5, 8, 11bp deletions within the-20 bp to +20bp alignment window around the Cas9 cleavage site. The editing efficiency (% mutation) output of +1bp insertions, RF. other and other insertions/deletions from the TIDEs was then plotted using Prism 9.

2. Results

To optimize and improve the gene editing efficiency of the top ranked slecas 9 single guide RNA (sgRNA) candidates, different sgRNA backbone sequences were tested in primary human skeletal myoblasts (hsmms) using synthetic sgrnas as shown in table 11 below. Two spacer sequences were tested: e45SL23 (SEQ ID NO:150 (DNA); SEQ ID NO:930 (RNA)) and E45SL24 (SEQ ID NO:151 (DNA); SEQ ID NO:931 (RNA)). Three framework sequences were tested: slu-VCGT-4.5 (SEQ ID NO:601 (DNA); SEQ ID NO:918 (RNA)), slu-VCGT-4 (SEQ ID NO:917 (DNA); SEQ ID NO:919 (RNA)), slu-VCGT-5 (SEQ ID NO:901 (DNA); SEQ ID NO:920 (RNA)).

Table 11: exemplary sgrnas for testing

/>

The three backbone sequences differ in nucleotide identity and, therefore, stem loop I in the RNA secondary structure (fig. 7A). In addition to the difference in stem loop I, slu-VCGT-4.5 lacks the last nucleotide U at the 3' end of stem 3 (not shown). The results show that under most of the conditions tested, the SLU-VCGT-5 skeleton resulted in editing efficiency higher than the wizard using the V4 or V4.5 skeleton (shown in FIG. 7B).

Example 6

1. Materials and methods

HEK293FT cell transfection

293FT cells were transfected with 750ng plasmid+2.25. Mu.L lipofectamine 2000 in 12 well plates. The third day after transfection, cells were trypsinized and sorted according to GFP. GFP positive cells were directly sorted out in lysis buffer and DNA extraction was performed using Promega Maxwell RSC blood DNA kit. PCR is then performed on the DNA using exon-specific primers targeting the relevant cleavage sites.

N2a cell transfection

After 24 hours of growth, N2a (Neuro 2 a) cells were transfected with 1000ng plasmid+3. Mu.L lipofectamine 2000 in 12 well plates. On the third day after transfection, cells were trypsinized and sorted according to GFP (green fluorescent protein). GFP positive cells were directly sorted out via FACS (fluorescence activated cell sorting) in lysis buffer and DNA extraction was performed using Promega Maxwell RSC blood DNA kit. PCR is then performed on the DNA using exon-specific primers targeting the relevant cleavage sites.

Amplicon deep sequencing library preparation of HEK293FT cells

After separating 100k GFP positive cells, genomic DNA was extracted and amplified by site-specific amplicons. Amplified products were purified by AMPure beads (0.8×), followed by QC using 1%E-gel and concentration measured using QuBiT for normalization of samples. Barcoded PCR was performed using the i5 and i7 indices and it was purified by 0.7 XAMPure beads followed by QC using either a tape or 1%E-gel. Barcoded samples were then measured by QuBiT and based on concentration samples were pooled and library prepared for loading in MiSeq. The 8pM library was loaded with an external addition of 20% phix and the output was handed over to a computational genomics team for evaluation of the insertion/deletion efficiency of the guide.

Culture of human primary skeletal myoblasts (HsMM)

On day 0, two frozen vials of HsMM (lot 20TL 070666) were thawed and grown in complete growth medium in two T75 flasks in a humidified incubator at 37 ℃ with 5% co 2. The next day (day 1) the medium was changed. On day 3, cells were passaged so that 9x10 cells were seeded into 7T 175 flasks. On day 4, the medium in each flask was changed. On day 6, RNP nuclear transfection was performed.

Hspm nuclear transfection

HsMM cells were nuclear transfected with RNP using a Lonza 4D nuclear transfectometer. For each sample, 7 μl RNP was combined with 0.3e6 cells in 15 μ L P5 solution. Different concentrations of RNP were prepared at a ratio of 6:1gRNA to cas9. For double-cut samples containing 2 grnas, RNPs were first preformed using a single gRNA. RNP was formed by incubating gRNA and protein for 20 minutes at room temperature. After electroporation, 80. Mu.L of complete growth medium was added to each sample and the samples were incubated in a humidified incubator at 37℃with 5% CO 2. After 10 minutes, the samples were transferred to a 12-well plate containing 2mL of complete growth medium that had been previously equilibrated in a humidified incubator at 37 ℃ with 5% co 2.

Cell collection and gDNA extraction

To determine cell viability 48 hours after nuclear transfection, cells were stained with Hoechst and propidium iodide (Life Technologies). Cell viability was then assessed using ImageXpress Micro (Molecular Devices). In general, samples with overall cell viability above 70% were collected and analyzed for insertion/deletion analysis. To isolate genomic DNA from HsMM, cells were washed with physiological saline buffer, trypsinized and centrifuged. The cell pellet was treated with lysis buffer in Maxwell RSC blood DNA kit (Promega #AS 1400) and usedThe RSC48 instrument (promega#as 8500) extracts genomic DNA according to the manufacturer's instructions. Using Qubit ^TM The concentration of genomic DNA was determined according to the manufacturer's instructions using the 1x dsDNA HS assay kit (Thermo Fisher Scientific Q33231).

Preparation of HsMM amplicon deep sequencing library

To determine gene editing efficiency, genomic DNA was amplified using primers flanking the DMD exon 45 genomic region. The following primer sequences were used: miseq_hE45_F TCGT CGGCAGCGTCAGATGTGTATAAGAGACAGgtctttctgtcttgtatcctttgg (SEQ ID NO: 724) and Miseq_hE45_R GTCTCGTGGGCTCGGAGAT GTGTATAAGAGACAGaatgttagtgcctttcaccc (SEQ ID NO: 725). The amplicon size was verified by analysis of a small amount of PCR product on a 2% e-gel (Thermo Fisher Scientific). The PCR product was purified by AMPure XP beads (A63881). The purified PCR product was reamplified using primers containing a barcode and Illumina adaptors. Multiple barcoded samples were pooled, combined with PhiX library and loaded on Illumina Mi-Seq platform. 600 cycles were run using Miseq kit v3 (MS-102-3003).

Maintenance and differentiation of C2C12 myotubes

C2C12 was maintained in DMEM supplemented with 10% fbs (fetal bovine serum) and 1% penicillin/streptomycin. For culture purposes, the cells should not be allowed to reach>75% confluence. C2C12 myoblasts were differentiated in DMEM supplemented with 2% hs and 1% penicillin/streptomycin. Briefly, cells were grown at 42-45k/cm ² Inoculation and differentiation started 24 hours after inoculation (when the cells reached about 90-95% confluence). The differentiation medium was changed on day 1 and then refreshed every other day.

C2C12 myotube transduction

C2C12 myoblasts were differentiated into myotubes in differentiation medium (DMEM containing 2% horse serum and 1% penicillin/streptomycin) for 6 days. Two hours prior to viral transduction, myotubes were treated with neuraminidase type III (Sigma-Aldrich, 50 mU/ml) followed by two washes with differentiation medium. Myotubes were incubated with AAV (MOI 1.0E7) and centrifuged at 1000Xg for 1.5 hours at 4 ℃. After transduction by rotation, the virus was extracted and the myotubes were washed once with cold PBS followed by two washes with differentiation medium. Myotubes were cultured in differentiation medium for an additional week (7 days) and subsequently harvested for insertion/deletion analysis (ICE/NGS) or fixed for immunohistochemical analysis (IHC). DNA/RNA extraction was performed using a Qiagen AllPrep DNA/RNA mini kit.

Cas9 nuclear localization of C2C12 myotubes by immunofluorescent staining

On day 7 after AAV transduction (day 12 of myotube differentiation), C2C12 myotubes were fixed with 4% Paraformaldehyde (PFA) for 20 min at Room Temperature (RT). After fixation, the cells were washed twice with PBS and then permeabilized with PBS-0.5% Triton for 15 min at room temperature. Cells were incubated with blocking buffer (pbs+10% fbs+0.1% triton) for 30 min at room temperature before incubation with primary antibodies. The cells were then incubated with primary antibody in the block for 2 hours at room temperature (or overnight at 4 ℃) followed by 3 washes with PBS-Tween 0.1%. The secondary antibody was added at room temperature for 1.5-2 hours. The antibodies used in these studies are listed here in table 12:

table 12:

vector genome quantification

Quantitative polymerase chain reaction (qPCR) was used to quantify AAV9 DNA levels in C2C12 differentiated cells. gDNA was extracted using the Qiagen AllPrep kit and quantified using a Qubit 4 fluorometer and diluted to a final concentration of 2.5 ng/. Mu.L.

Absolute quantification of AAV9 vectors was performed by constructing a standard curve prepared from known masses of linearized plasmids encoding the region of interest. To verify the quantitative method, a set of Quality Controls (QC) was included. To confirm reaction specificity, a set of non-template control (NTC) samples was included.

qPCR reactions were performed in triplicate using the Quantum studio 6Flex real-time PCR system (Thermo Fisher). Linear regression analysis was performed using the cycle threshold (Ct) of the standard curve. According to this linear regression, the Ct value of the sample was used to quantify the copy number of AAV9 per μg gDNA present in each sample.

Cas9 and sgRNA transgene expression

Cas9 mRNA levels and gRNA expression in C2C12 differentiated cells were quantified using reverse transcription polymerase chain reaction (RT-qPCR). RNA was extracted using the Qiagen AllPrep kit and the extracted RNA was quantified using a Qubit 4 fluorometer and diluted to a final concentration of 20 ng/. Mu.L. Absolute quantification of gRNA and Cas9 mRNA is performed by constructing a standard curve prepared from known masses of T7 transcripts encoding the respective regions of interest. To verify the quantitative method, a set of Quality Controls (QC) was included. To confirm reaction specificity, a set of non-template control (NTC) samples was included.

RT-qPCR reactions were performed in triplicate using the Quantum studio 6Flex real-time PCR system (Thermo Fisher). Linear regression analysis was performed using the cycle threshold (Ct) of the standard curve. According to this linear regression, the Ct value of the sample is used to quantify the copy number of Cas9 mRNA or gRNA present in the sample per μg RNA.

Preparation of C2C12 amplicon deep sequencing library

gDNA was extracted using Qiagen AllPrep kit. The relevant locus of exon 45 of mouse Dmd was amplified by PCR and the amplified product was purified by AMPure beads (0.8 x) followed by QC using 1%E-gel. DNA concentrations were measured using QuBiT to achieve normalization of samples and Illumina sequencing libraries were formed from these PCR products using MiSeq kit v3 (600 cycles).

Next generation sequencing data analysis

Illumina sequencing data was processed using custom bioinformatics workflow. Poor quality reads are first removed. Reads through mass filters were trimmed using trimmatic to remove adaptors and low mass bases. Reads mapped to PhiX genomes were then removed and paired end reads were pooled using PEAR. Based on the expected cleavage sites corresponding to the two guides, three reference amplicon sequences were generated: wild-type amplicon, deletion amplicon with a deletion between the two guide cleavage sites, and reverse amplicon with sequence reversal between the two guide cleavage sites. Pooled reads were assigned to one of the three amplicons (wild-type, deleted, inverted) based on the alignment score provided by the Needleman Wunsch algorithm performed by paramailneedle. To identify the sequence of insertion/deletion events, the CIGAR string provided by the alignment algorithm is parsed. The summary of insertion/deletion events and their frequencies are nested with information about the length of the exons, the exonic framework, and the premature stop codon positions introduced as a result of DMD pathogenic mutations to characterize Cas 9-related insertion/deletion events as productive (e.g., exact deletion, rf+1, RF other, exon skipping) or non-productive (e.g., OE) (table 13). Throughout this workflow, a strict set of QQC criteria is applied to filter poor quality samples. (Table 13).

Table 13:

animal and study design

This study was designed to evaluate integrated gene editing vector candidates, including sgrnas and Cas9 endonucleases that mediate gene editing of the DMD locus, produced. In this study, the efficacy of single vector gene editing candidates in vivo was assessed by measuring dystrophin repair, target gene editing, tissue vector genome, and Cas9 and sgRNA transgene expression following intraperitoneal administration to dEx44 mice on days 4 or 5 post-natal.

Table 14A describes the in vivo study design:

wt=wild type

PND4 to pnd5=postnatal day 4 to postnatal day 5

N/a = inapplicable

Amplicon deep sequencing library preparation for in vivo studies

gDNA was extracted from mouse heart, quadriceps and triceps tissues using Maxwell RSC tissue DNA kit and quantified via Qubit. The relevant locus for exon 45 of the mouse DMD gene was amplified using PCR. PCR products were visualized using E-gel with confirmation of appropriate size of the TapeStation and purified using AMPure XP beads. The PCR products were then subjected to a second PCR reaction to add unique 5 'and 3' barcodes corresponding to each sample. These PCR products were quantified via Qubit and each normalized to 4 nM. The normalized products were then pooled, combined with PhiX library to increase diversity, and loaded onto a MiSeq instrument. Library was sequenced (600 cycles) using MiSeq kit v3 and raw data transferred to DCS team.

Next generation sequencing data analysis for in vivo studies

Illumina sequencing data was processed using custom bioinformatics workflow. Poor quality reads (below Q30) are first removed. The surviving reads were trimmed using trimmatic to remove adaptors and low quality bases. Reads mapped to PhiX genomes were then removed and paired end reads were pooled using PEAR. Based on the expected cleavage sites corresponding to the two guides, three reference amplicon sequences were generated: wild-type amplicon, deletion amplicon with a deletion between the two guide cleavage sites, and reverse amplicon with sequence reversal between the two guide cleavage sites. Pooled reads were assigned to one of the three amplicons (wild-type, deleted, inverted) based on the alignment score provided by the Needleman Wunsch algorithm performed by paramailneedle. To identify the sequence of insertion/deletion events, the CIGAR string provided by the alignment algorithm is parsed. The summary of insertion/deletion events and their frequencies are nested with information about the length of the exons, the exonic framework, and the premature stop codon positions introduced as a result of DMD pathogenic mutations to characterize Cas 9-related insertion/deletion events as productive (e.g., exact deletion, rf+1, RF other, exon skipping) or non-productive (e.g., OE) (table 1). Throughout this workflow, a set of stringent QC criteria was applied to filter bad quality samples and all samples were checked in the same study for potential contamination by other treatment groups.

2. Results

Double-cut sgRNA in vitro screening

The average insertion/deletion frequency of exon 45-targeted sgrnas in primary human skeletal myoblasts (hsmms) was tested (fig. 8), with high performance SpCas9 sgrnas (E45 Sp 52) included as references. Five pairs of slaucas 9 sgrnas evaluated each showed an average exact segment deletion frequency of greater than 60% (fig. 8). The sequences of the spacers of the guide RNA used in FIG. 8 (i.e., 18, 4 and 18+4;21, 7 and 21+7;17, 22 and 17+22;17, 23 and 17+23; and 19, 21 and 19+21) are shown in Table 10.

Determining the average insertion/deletion frequency of the sgrnas targeting exon 51 in HEK293FT cells (fig. 9), E51SaKKH20/9, E51SaKKH20/27, E51SL10/3, E51SL31/5, E51SL31/7, E51SL31/8, E51SL10/16, E51SL23/31 and E51SL10/24 showed an insertion/deletion frequency of more than 50% and an average exact segment deletion frequency of more than 50% in HEK293FT cells. Table 14B shows the sgRNA ID and spacer sequence for each of the sgRNA pairs shown in FIG. 9, where the pair shown on the X-axis of FIG. 9 (e.g., 2+6) is within the sgRNA ID as the last character of each entry (e.g., E51Sa2_E51Sa6).

Table 14B:

/>

AAV configuration of double-cut single vector candidates

The combination of promoter orientation and configuration, NLS sequence and sgRNA backbone was selected for AAV plasmid production and evaluated for sgRNA transgene expression, AAV manufacturability, and in vitro and in vivo editing efficiency. AAV plasmid configurations are listed in table 15 and table 16. The promoters, NLS and backbone sequences are listed in Table 17.

Guide RNAs were prepared as single guide (sgrnas) according to standard methods. A single AAV vector was prepared that expressed either a guide RNA pair and a variant SaCas9 or a guide RNA pair and a variant slaucas 9. AAV vectors were administered to C2C12 cells in vitro and in vivo in mice (e.g., dEx mice) to assess the ability of AAV to express guide RNAs and Cas9, edit targeted exons, and reconstruct dystrophin gene frameworks (in vivo study only).

Table 15:

/>

table 16:

table 17:

/>

in particular, the ability of in vitro single AAV-mediated gene editing component delivery to introduce both productive editing and precise segment deletions in the C2C12 mouse myotubes was tested (table 18B, fig. 10). In FIGS. 10-12 and 14-17, vector ID vVT 046, 047, 048, 054 and 052 and their associated sgRNA pairs are shown in Table 18B. vVT009 has a 7SK2-Slucas9-H1m configuration with a SluV2 backbone and an SV40NLS at the N-terminus and a nucleoplasmin NLS at the C-terminus. vVT053B has the same configuration and sequence as vVT 053. B represents the A deletion on the pVT053B backbone (outside the ITR) introduced during cloning. The spacer sequences used in these sgRNA pairs are as follows (table 18A):

Table 18A:

the AAV configuration selected was evaluated based on vector genome quantification (fig. 11) and transgene expression (fig. 12) and immunofluorescence in the myotubes of C2C12 mice (fig. 13). Three AAV vectors vVT046, vVT047 and vVT048 showed an average exact segmental deletion frequency in the C2C12 mouse myotubes of greater than 15% (fig. 10). Equivalent vector genome copy number (fig. 11) and Cas9 transgene expression (fig. 12A) were observed between all AAV vectors in the C2C12 mouse myotubes. Higher sgRNA expression was observed for the hU6-H1m-7SK, hU6c-hU6c and hU6c-7SK2 PolIII promoter combinations (FIG. 12B). Slightly lower sgRNA expression was observed for the 7SK2-H1m promoter combination (fig. 12B). For the 7SK2-H1m promoter combination, the sgrnas located upstream of Cas9 exhibited overall higher expression (fig. 12B). Cas9 with 2xnls+ and 3xNLS allows Cas9 to localize well to the muscle cell nucleus (fig. 13).

Table 18B:

the ability of single AAV-mediated gene editing component delivery in vivo to successfully reconstruct the exon 45 framework of cardiac and skeletal muscle of dEx44 mice was tested. In the heart, all selected AAV configurations showed an average total insertion/deletion frequency of higher than 12.5% and the E45 sle 18/4sgRNA pairs showed an average exact segmental deletion frequency of higher than 15% (fig. 14A). vVT047 with E45Slu18/4sgRNA pair showed an average exact segmental deletion frequency in quadriceps of greater than 5% (FIG. 14B). All selected AAV configurations showed an average total dystrophin repair in the heart of dEx44 DMD mice that was higher than 30% wt (fig. 15A). vVT054, vVT046, vVT047 and vVT048 showed an average total dystrophin repair in the quadriceps of the dEx44 DMD mice that was higher than 10% wt (figure 15B). AAV vectors with 2xnls+ and 3xNLS enhance editing efficiency and dystrophin repair in skeletal muscle (fig. 15B). Equivalent amounts of AAV vector genome were observed in heart and skeletal muscle of all groups. The overall AAV vector copy number observed in the heart was higher than that of skeletal muscle (fig. 16A and 16B). In vVT046, vVT047, vVT048 AAV vectors, the expression efficiency of upstream sgrnas was higher than downstream cassettes (fig. 17A and 17B). With respect to Cas9 levels, upstream and downstream sgRNA expression levels in muscle were reduced compared to heart tissue (fig. 17A and 17B).

Similar experiments were performed on exon 45 in HEK293FT cells using sgrnas (see table 19; spacer sequences in fig. 18A-18C) and Cas12i2 endonuclease.

Table 19:

/>

the specification and exemplary embodiments are not to be regarded as limiting. For the purposes of this specification and the appended claims, all numbers expressing quantities, percentages or proportions, as well as other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term "about" (in the sense that it has not been so modified). Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. In any event, and without intending to limit the application of the equality (doctrine of equivalents) to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

It should be noted that, as used in this specification and the claims, the singular form of "a," "an," and "the" and any singular forms of words include plural referents unless expressly and unequivocally limited to one referent. As used herein, the terms "comprises," "comprising," and grammatical variations thereof are intended to be non-limiting, and therefore the recitation of items in a list is not to the exclusion of other like items that may be substituted or added to the listed items.

Claims

1. A composition, the composition comprising:

a. a single nucleic acid molecule comprising:

b. Two nucleic acid molecules comprising:

3. One to six guide RNAs; or (b)

1. At least one, at least two, or at least three guide RNAs; or (b)

3.1, 2 or 3 guide RNAs; and

3. One to six guide RNAs; or (b)

A first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) and at least two guide RNAs, wherein at least one guide RNA binds to a target sequence upstream and at least one guide RNA binds to the target sequence downstream; and

a second nucleic acid encoding at least one additional copy of each of the guide RNAs encoded in the first nucleic acid that does not encode SaCas9 or Slucas9,

Wherein the one or more guide RNAs targets a region in the dystrophin gene.

2. A composition comprising two nucleic acid molecules, the two nucleic acid molecules comprising: i) A first nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slecas 9) for excision of a portion of the DMD gene, a first guide RNA and a second guide RNA; and ii) a second nucleic acid encoding at least 2 or at least 3 copies of the first guide RNA and at least 2 or at least 3 copies of the second guide RNA.

3. A composition comprising one or more nucleic acid molecules encoding an endonuclease and a pair of guide RNAs, wherein each guide RNA targets a different sequence in a DMD gene, wherein the endonuclease and guide RNA pair are capable of excision of a DNA fragment from the DMD gene; wherein the DNA fragment is between 5 and 250 nucleotides in length.

4. The composition of claim 3, wherein the endonuclease is a type 2 II Cas endonuclease.

5. The composition of claim 3, wherein the class 2 type II Cas endonuclease is SpCas9, saCas9, or slaucas 9.

6. The composition of claim 3, wherein the endonuclease is not a class 2V Cas endonuclease.

7. The composition of claim 3, wherein the excised DNA fragment comprises a splice acceptor site or a splice donor site.

8. The composition of claim 3, wherein the excised DNA segment comprises a premature stop codon in the DMD gene.

9. The composition of claim 3, wherein the excised DNA segment does not comprise the complete exon of the DMD gene.

10. The composition of any one of claims 1-9, wherein the guide RNA comprises any one of:

c. When SaCas9 is used, one or more spacer sequences comprising at least 20 contiguous nucleotides selected from any one of SEQ ID NOs 1-35, 1000-1078 and 3000-3069; or (b)

d. When using SluCas9a, one or more spacer sequences comprising at least 20 contiguous nucleotides selected from any one of SEQ ID NOs 100-225, 2000-2116 and 4000-4251; or (b)

i. When SaCas9 is used with at least two guide RNAs, it is at least 90% identical to the first spacer sequence and the second spacer sequence selected from any one of the following spacer sequence pairs: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; or (b)

SEQ ID NOS 148 and 134,

SEQ ID Nos. 145 and 131,

SEQ ID Nos 144 and 149;

SEQ ID Nos. 144 and 150; and

SEQ ID Nos 146 and 148; or (b)

SEQ ID NOS 12 and 1013; and

SEQ ID NOS 12 and 1016.

11. A composition comprising a single nucleic acid molecule encoding one or more guide RNAs and Cas9, wherein the single nucleic acid molecule comprises:

SEQ ID NOS 148 and 134,

SEQ ID Nos. 145 and 131,

SEQ ID Nos 144 and 149;

SEQ ID Nos. 144 and 150;

SEQ ID Nos 146 and 148;

and a second nucleic acid encoding staphylococcus lucas 9; or (b)

SEQ ID NOS 12 and 1013; and

SEQ ID Nos. 12 and 1016;

and a second nucleic acid encoding SaCas 9-KKH.

12. A composition comprising one or more nucleic acid molecules encoding staphylococcus lucas9 and at least two guide RNAs, wherein a first guide RNA and a second guide RNA target different sequences in the DMD gene, wherein the first guide RNA and the second guide RNA comprise sequences that are at least 90% identical to a first spacer sequence and a second spacer sequence selected from any one of the following spacer sequence pairs:

SEQ ID NOS 148 and 134,

SEQ ID Nos. 145 and 131,

SEQ ID Nos 144 and 149;

SEQ ID Nos. 144 and 150;

SEQ ID Nos 146 and 148.

13. A composition comprising one or more nucleic acid molecules encoding an endonuclease and at least two guide RNAs, wherein the guide RNAs each target a different sequence in a DMD gene, wherein the guide RNAs each comprise a sequence that is at least 90% identical to a first and second spacer sequence selected from any one of the following spacer sequence pairs:

SEQ ID NOS 12 and 1013; and

SEQ ID Nos. 12 and 1016; and

a second nucleic acid encoding SaCas 9-KKH.

14. The composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least two guide RNAs.

15. The composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least three guide RNAs.

16. The composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least four guide RNAs.

17. The composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least five guide RNAs.

18. The composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least six guide RNAs.

19. The composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least seven guide RNAs.

20. The composition of any one of the preceding claims, wherein the first nucleic acid and/or the second nucleic acid, when present, encodes at least eight guide RNAs.

21. The composition of any one of the preceding claims, wherein the first nucleic acid comprises a nucleotide sequence encoding an endonuclease and at least one, at least two, or at least three guide RNAs.

22. The composition of any one of the preceding claims, wherein the first nucleic acid comprises a nucleotide sequence encoding an endonuclease and 1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid.

23. The composition of any one of the preceding claims, wherein the first nucleic acid comprises a nucleotide sequence encoding an endonuclease and one to three guide RNAs.

24. The composition of any one of the preceding claims, wherein the second nucleic acid, when present, encodes at least one, at least two, at least three, at least four, at least five, or at least six guide RNAs.

25. The composition of any one of the preceding claims, wherein the second nucleic acid, when present, encodes from 1 to n guide RNAs, wherein n does not exceed the maximum number of guide RNAs that can be expressed from the nucleic acid.

26. The composition of any one of the preceding claims, wherein the second nucleic acid, when present, encodes one to six guide RNAs.

27. The composition of any one of the preceding claims, wherein the second nucleic acid, when present, encodes 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, or 2-3 guide RNAs.

28. The composition of any one of the preceding claims, wherein the second nucleic acid, when present, encodes 2, 3, 4, 5, or 6 guide RNAs.

29. The composition of any one of the preceding claims, comprising at least two nucleic acid molecules, wherein the guide RNA encoded by the first nucleic acid and the second nucleic acid is identical.

30. The composition of any one of the preceding claims, comprising at least two nucleic acid molecules, wherein the guide RNAs encoded by the first nucleic acid and the second nucleic acid are different.

31. The composition of any one of the preceding claims, comprising at least two nucleic acid molecules encoding at least two guide RNAs, wherein at least one guide RNA binds to a target sequence within an exon of the DMD gene upstream of a premature stop codon, and wherein at least one guide RNA binds to a target sequence within an exon of the DMD gene downstream of a premature stop codon.

32. The composition of any one of the preceding claims, comprising at least two nucleic acid molecules, wherein the first nucleic acid molecule and the second nucleic acid molecule each encode the same guide RNA.

33. The composition of any one of the preceding claims, comprising at least two nucleic acid molecules each encoding at least one guide RNA, wherein the guide RNA encoded by the second nucleic acid molecule binds to the same target sequence as the guide RNA in the first nucleic acid molecule.

34. The composition of any one of the preceding claims, comprising at least two nucleic acid molecules, wherein the second nucleic acid molecule encodes at least 2, at least 3, at least 4, at least 5, or at least 6 guide RNAs, wherein the guide RNAs in the second nucleic acid molecule bind to the same target sequence as the guide RNAs in the first nucleic acid molecule.

35. The composition of any one of the preceding claims, wherein the composition comprises at least two nucleic acid molecules, wherein the first nucleic acid molecule comprises a sequence encoding an endonuclease, wherein the second nucleic acid molecule encodes a first guide RNA and a second guide RNA, wherein the first guide RNA is not the same sequence as the second guide RNA, and wherein the second nucleic acid molecule does not encode an endonuclease.

36. The composition of claim 35, wherein the first nucleic acid molecule also encodes a copy of the first guide RNA and a copy of the second guide RNA.

37. The composition of claim 35 or 36, wherein the second nucleic acid molecule encodes two copies of the first guide RNA and two copies of the second guide RNA.

38. The composition of any one of claims 35-37, wherein the second nucleic acid molecule encodes three copies of the first guide RNA and three copies of the second guide RNA.

39. The composition of any one of claims 35-37, wherein the first nucleic acid molecule comprises, in terms of the positive strand, from 5 'to 3': a reverse complement of a first guide RNA backbone sequence, a reverse complement of a nucleotide sequence encoding the first guide RNA sequence, a reverse complement of a promoter for expressing the nucleotide sequence encoding the first guide RNA sequence, a promoter for expressing a nucleotide sequence encoding an endonuclease, a polyadenylation sequence, a promoter for expressing the second guide RNA in the same direction as the promoter of the endonuclease, a second guide RNA sequence, and a second guide RNA backbone sequence.

40. The composition of claim 39, wherein the promoter for expressing the nucleotide sequence encoding the first guide RNA sequence in the first nucleic acid molecule is a U6 promoter and the promoter for expressing the nucleotide sequence encoding the second guide RNA in the first nucleic acid molecule is a U6 promoter.

41. The composition of any one of claims 35-40, wherein the first nucleic acid molecule is in a first vector, and wherein the second nucleic acid is in a separate second vector.

42. The composition of any one of claims 35-41, wherein the first nucleic acid molecule encodes a staphylococcus aureus Cas9 (SaCas 9) endonuclease, and wherein the first guide RNA comprises a first sequence and the second guide RNA comprises a second sequence, the first sequence and the second sequence selected from any one of the following sequence pairs: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018.

43. The composition of claim 42, wherein the first guide RNA comprises the sequence of SEQ ID NO. 12 and the second guide RNA comprises the sequence of SEQ ID NO. 1013.

44. The composition of any one of claims 35-43, wherein the first nucleic acid molecule encodes a staphylococcus lucas9 endonuclease, and wherein the first guide RNA comprises a first sequence and the second guide RNA comprises a second sequence, the first sequence and the second sequence selected from any one of the following sequence pairs: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146.

45. The composition of claim 44, wherein:

a) The first guide RNA comprises the sequence of SEQ ID No. 148 and the second guide RNA comprises the sequence of SEQ ID No. 134; or (b)

b) The second guide RNA comprises the sequence of SEQ ID NO:145 and the second guide RNA comprises the sequence of SEQ ID NO: 131.

46. The composition of any one of claims 35-45, wherein the first nucleic acid is in a first vector, and wherein the second nucleic acid is in a separate second vector.

47. The composition of claim 46, wherein the first and second vectors are viral vectors.

48. The composition of claim 47, wherein the viral vector is an AAV9 vector.

49. The composition of claim 48, wherein the AAV9 vector is less than 5kb, less than 4.9kb, less than 4.85kb, less than 4.8kb, or less than 4.75kb in size from ITR to ITR (including both ITRs), respectively.

50. The composition of claim 48 or 49, wherein the AAV9 vector has a size ranging from ITR to ITR (including two ITRs) of 3.9-5kb, 4-5kb, 4.2-5kb, 4.4-5kb, 4.6-5kb, 4.7-5kb, 3.9-4.9kb, 4.2-4.9kb, 4.4-4.9kb, 4.7-4.9kb, 3.9-4.85kb, 4.2-4.85kb, 4.4-4.85kb, 4.6-4.85kb, 4.7-4.9kb, 3.9-4.8kb, 4.2-4.8kb, 4.4-4.8kb or 4.6-4.8kb, respectively.

51. The composition of any one of claims 47-50, wherein the first vector has a size from ITR to ITR (including two ITRs) of between 4.4-4.85 kb.

52. The composition of any one of the preceding claims, wherein the guide RNA binds to one or more target sequences within the DMD gene.

53. The composition of any one of the preceding claims, wherein the guide RNA binds to one or more target sequences within an exon of the DMD gene.

54. The composition of any one of the preceding claims, comprising two guide RNAs, wherein i) each guide RNA targets a sequence within an exon; ii) a guide RNA targets sequences within exons and a targeting sequence within introns; or iii) sequences within each guide RNA targeting intron.

55. The composition of any one of the preceding claims, comprising at least two guide RNAs, wherein i) each guide RNA targets the same genomic target sequence; ii) each guide RNA targets a different target sequence; or iii) at least one guide RNA targets one sequence and at least one guide RNA targets a different sequence.

56. The composition of any one of the preceding claims, comprising a guide RNA that binds to an exon of the DMD gene, wherein the exon is selected from the group consisting of exons 43, 44, 45, 50, 51, and 53.

57. The composition of any one of the preceding claims, comprising at least two guide RNAs that bind to exons of the DMD gene, wherein at least one guide RNA binds to a sequence of interest within an exon of the DMD gene and at least one guide RNA binds to a different sequence of interest within the same exon of the DMD gene.

58. The composition of any one of the preceding claims, comprising at least two guide RNAs, wherein at least one guide RNA binds to a target sequence within an exon upstream of a premature stop codon and at least one guide RNA binds to a target sequence within an exon downstream of a premature stop codon.

59. The composition of any one of the preceding claims, comprising at least two guide RNAs, wherein at least one guide RNA binds to a target sequence within an exon of the DMD gene and at least one guide RNA binds to a different target sequence within the same exon of the DMD gene, wherein a portion of the exon is excised upon expression in vivo or in vivo.

60. The composition of any one of the preceding claims, comprising at least two guide RNAs, wherein the guide RNAs, after expression in vitro or in vivo, in combination with an RNA-guided endonuclease excises a portion of the exon.

61. The composition of any one of the preceding claims, comprising at least two guide RNAs, wherein after expression of the guide RNAs in vitro or in vivo, a portion of the exons is excised in combination with an RNA-guided endonuclease, and wherein the portion of the exons remaining after excision are rejoined via one nucleotide insertion.

62. The composition of any one of the preceding claims, comprising at least two guide RNAs, wherein after expression of the guide RNAs in vitro or in vivo, in combination with an RNA-guided endonuclease cleaves a portion of the exon, wherein the portion of the exon remaining after cleavage is rejoined without nucleotide insertion.

63. The composition of any one of the preceding claims, comprising at least two guide RNAs, wherein the guide RNAs, after expression in vitro or in vivo, in combination with an RNA-guided endonuclease excise a portion of the exon, wherein the excised portion of the exon is between 5 and 250 nucleotides in length dimension.

64. The composition of any one of the preceding claims, comprising at least two guide RNAs, wherein after expression of the guide RNAs in vitro or in vivo, in combination with an RNA-guided endonuclease, a portion of the exons is excised and the excised portion of the exons is between 5 and 250, 5 and 200, 5 and 150, 5 and 100, 5 and 75, 5 and 50, 5 and 25, 5 and 10, 20 and 250, 20 and 200, 20 and 150, 20 and 100, 20 and 75, 20 and 50, 20 and 25, 50 and 250, 50 and 200, 50 and 150, 50 and 100 and 50 and 75 nucleotides in size.

65. The composition of any one of the preceding claims, comprising at least two guide RNAs, wherein the guide RNAs, after expression in vitro or in vivo, in combination with an RNA-guided endonuclease excise a portion of the exon, wherein the excised portion of the exon is between 8 and 167 nucleotides in size.

66. The composition of any one of the preceding claims, wherein the guide RNA is sgRNA.

67. The composition of any one of the preceding claims, wherein the guide RNA is modified.

68. The composition of any one of the preceding claims, wherein the guide RNA is modified, and wherein the modification alters one or more 2' positions and/or phosphodiester linkages.

69. The composition of any one of the preceding claims, wherein the guide RNA is modified, and wherein the modification alters one or more or all of the first three nucleotides of the guide RNA and/or the last three nucleotides of the sgRNA.

70. The composition of any one of claims 66-69, wherein the modification alters one or more or all of the last three nucleotides of the guide RNA.

71. The composition of any one of the preceding claims, wherein the guide RNA is modified, and wherein the modification comprises one or more of a phosphorothioate modification, a 2' -OMe modification, a 2' -O-MOE modification, a 2' -F modification, a 2' -O-methine-4 ' bridge modification, a 3' -thiophosphonoacetate modification, or a 2' -deoxy modification.

72. The composition of any one of the preceding claims, wherein the composition further comprises a pharmaceutically acceptable excipient.

73. The composition of any one of the preceding claims, wherein the composition is conjugated to Lipid Nanoparticles (LNPs).

74. The composition of any one of the preceding claims, wherein the composition is conjugated to a viral vector.

75. The composition of any one of the preceding claims, wherein the composition is associated with a viral vector, and wherein the viral vector is an adeno-associated viral vector, a lentiviral vector, an integrase-deficient lentiviral vector, an adenoviral vector, a vaccinia viral vector, an alphaviral vector, or a herpes simplex viral vector.

76. The composition of any one of the preceding claims, wherein the composition is associated with a viral vector, and wherein the viral vector is an adeno-associated virus (AAV) vector.

77. The composition of any one of the preceding claims, wherein the composition binds to a viral vector, wherein the viral vector is an adeno-associated virus (AAV) vector, and wherein the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh10, AAVrh74, or AAV9 vector, wherein a number following AAV is indicative of an AAV serotype.

78. The composition of any one of the preceding claims, wherein the composition is associated with a viral vector, wherein the viral vector is an adeno-associated virus (AAV) vector, and wherein the AAV vector is an AAV serotype 9 (AAV 9) vector.

79. The composition of claim 78, wherein the AAV serotype 9 vector has a size from ITR to ITR (comprising two ITRs) of less than 5kb, less than 4.9kb, less than 4.85kb, less than 4.8kb, or less than 4.75kb.

80. The composition of claim 78 or 79, wherein the AAV serotype 9 vector has a size ranging from ITR to ITR (including two ITRs) from 3.9-5kb, 4-5kb, 4.2-5kb, 4.4-5kb, 4.6-5kb, 4.7-5kb, 3.9-4.9kb, 4.2-4.9kb, 4.4-4.9kb, 4.7-4.9kb, 3.9-4.85kb, 4.2-4.85kb, 4.4-4.85kb, 4.6-4.85kb, 4.7-4.9kb, 3.9-4.8kb, 4.2-4.8kb, 4.4-4.8kb, or 4.6-4.8 kb.

81. The composition of any one of claims 78-80, wherein the AAV serotype 9 vector has a size ranging from ITR to ITR (comprising two ITRs) between 4.4 and 4.85 kb.

82. The composition of any one of the preceding claims, wherein the composition is associated with a viral vector, wherein the viral vector is an adeno-associated virus (AAV) vector, and wherein the AAV vector is an AAVrh10 vector.

83. The composition of any one of the preceding claims, wherein the composition is associated with a viral vector, wherein the viral vector is an adeno-associated virus (AAV) vector, and wherein the AAV vector is an AAVrh74 vector.

84. The composition of any one of the preceding claims, wherein the composition is associated with a viral vector, wherein the viral vector comprises a tissue specific promoter.

85. The composition of any one of the preceding claims, wherein the composition is associated with a viral vector, wherein the viral vector comprises a muscle-specific promoter, optionally wherein the muscle-specific promoter is a muscle creatine kinase promoter, a desmin promoter, an MHCK7 promoter, an SPc5-12 promoter, or a CK8e promoter.

86. The composition of any one of the preceding claims, wherein the composition is associated with a viral vector, wherein the viral vector comprises any one or more of the following promoters: u6, H1 and 7SK promoters.

87. The composition of any one of the preceding claims, comprising a nucleic acid encoding SaCas9, wherein at least one guide RNA comprises a spacer sequence selected from any one of SEQ ID NOs 12, 15, 16, 20, 27, 28, 32, 33 and 35.

88. The composition of any one of the preceding claims, comprising a nucleic acid encoding SaCas9, wherein the SaCas9 comprises the amino acid sequence SEQ ID No. 711.

89. The composition of any one of the preceding claims, comprising a nucleic acid encoding SaCas9, wherein the SaCas9 is a variant of amino acid sequence SEQ ID No. 711.

90. The composition of any one of the preceding claims, comprising a nucleic acid encoding SaCas9, wherein the SaCas9 comprises an amino acid sequence selected from any one of SEQ ID NOs 715-717.

91. The composition of any one of the preceding claims, comprising a nucleic acid encoding slaucas 9, wherein at least one guide RNA comprises a spacer sequence selected from any one of: 131, 134, 135, 136, 139, 144, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224 and 225.

92. The composition of any one of the preceding claims, comprising a nucleic acid encoding a slaucas 9, wherein the slaucas 9 comprises the amino acid sequence SEQ ID NO 712.

93. The composition of any one of the preceding claims, comprising a nucleic acid encoding a slaucas 9, wherein the slaucas 9 is a variant of amino acid sequence SEQ ID No. 712.

94. The composition of any one of the preceding claims, comprising a nucleic acid encoding a slaucas 9, wherein the slaucas 9 comprises an amino acid sequence selected from any one of SEQ ID NOs 718-720.

95. The composition of claim 1, wherein the single nucleic acid molecule or the first nucleic acid comprises, in terms of the positive strand, from 5 'to 3': a reverse complement of a nucleotide sequence encoding a first guide RNA backbone sequence, a reverse complement of a nucleotide sequence encoding the first guide RNA sequence, a reverse complement of a promoter for expressing the nucleotide sequence encoding the first guide RNA sequence, a promoter for expressing a nucleotide sequence encoding staphylococcus aureus Cas9 (SaCas 9) or staphylococcus lucas9 (slacas 9), a nucleotide sequence encoding the SaCas9 or slacas 9, a polyadenylation sequence, a promoter for expressing the second guide RNA in the same direction as the promoter of the SaCas9 or slacas 9, a nucleotide sequence encoding the second guide RNA sequence, and a nucleotide sequence encoding the second guide RNA backbone sequence.

96. The composition of claim 95, wherein the promoter for expressing the nucleic acid encoding the first guide RNA sequence is a U6 promoter and the promoter for expressing the nucleic acid encoding the second guide RNA is a U6 promoter.

97. The composition of claim 95 or 96, wherein the SaCas9 or slaucas 9 comprises at least two Nuclear Localization Signals (NLS).

98. The composition of claim 97, wherein the SaCas9 or slaucas 9 comprises a c-Myc NLS fused to the N-terminus of the SaCas9 or slaucas 9, optionally through a linker.

99. The composition of claim 97 or 98, wherein the SaCas9 or slaucas 9 comprises an SV40 NLS fused to the C-terminus of the SaCas9 or slaucas 9, optionally through a linker.

100. The composition of any one of claims 95-99, wherein the SaCas9 or slaucas 9 comprises a nucleoplasmin NLS fused to the C-terminus of the SaCas9 or slaucas 9, optionally through a linker.

101. The composition of any one of claims 95-100, wherein the SaCas9 or slaucas 9 comprises:

a) A c-Myc NLS optionally fused to the N-terminus of the SaCas9 or slaucas 9 by a linker,

b) An SV40 NLS fused to the C-terminus of the SaCas9 or slaucas 9, optionally through a linker, and

c) A nucleoplasmin NLS fused to the C-terminus of the SV40 NLS, optionally via a linker.

102. The composition of any one of claims 95-101, wherein the backbone sequence of the first guide RNA comprises the sequence SEQ ID No. 901.

103. The composition of any one of claims 95-102, wherein the backbone sequence of the second guide RNA comprises the sequence SEQ ID No. 901.

104. The composition of any one of claims 95-103, wherein said single nucleic acid molecule or said first nucleic acid is less than 5kb, less than 4.9kb, 4.85kb, 4.8kb, or 4.75kb.

105. The composition of any one of claims 95-104, wherein the single nucleic acid molecule or the first nucleic acid is between 3.9-5kb, 4-5kb, 4.2-5kb, 4.4-5kb, 4.6-5kb, 4.7-5kb, 3.9-4.9kb, 4.2-4.9kb, 4.4-4.9kb, 4.7-4.9kb, 3.9-4.85kb, 4.2-4.85kb, 4.4-4.85kb, 4.6-4.85kb, 4.7-4.9kb, 3.9-4.8kb, 4.2-4.8kb, 4.4-4.8kb, or 4.6-4.8 kb.

106. The composition of claim 105, wherein said single nucleic acid molecule or said first nucleic acid is between 4.4-4.85 kb.

107. A composition comprising a guide RNA encoded by a sequence comprising any one of: SEQ ID NO. 1-35, 1000-1078 or 3000-3069 or the complement thereof.

108. A composition comprising a guide RNA encoded by a sequence comprising any one of: SEQ ID NO. 100-225, 2000-2116 or 4000-4251 or the complement thereof.

109. The composition of any one of claims 1-108, for use in treating Duchenne Muscular Dystrophy (DMD).

110. The composition of any one of claims 1-108, for producing one or more double strand breaks in any one or more of exons 43, 44, 45, 50, 51 or 53 of an dystrophin gene.

111. A method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering the composition of any one of claims 1-108 to a cell.

112. A method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

a. a spacer sequence selected from SEQ ID NO 1-35, 1000-1078 or 3000-3069;

b. a spacer sequence comprising at least 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NOs 1-35, 1000-1078 or 3000-3069; or (b)

ii) nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9).

113. A method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

b. a spacer sequence comprising at least 20 contiguous nucleotides of a spacer sequence selected from the group consisting of SEQ ID NO. 100-225, 2000-2116 or 4000-4251;

ii) a nucleic acid molecule encoding staphylococcus lucas 9.

114. A method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

a. a first spacer sequence and a second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018;

b. A first spacer sequence and a second spacer sequence comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; or (b)

c. A first spacer sequence and a second spacer sequence that are at least 90% identical to any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018; and

ii) nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9).

115. A method of treating Duchenne Muscular Dystrophy (DMD), comprising delivering to a cell a single nucleic acid molecule comprising:

a. a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151; and 146 and 148;

b. a first spacer sequence and a second spacer sequence comprising at least 17, 18, 19, 20 or 21 contiguous nucleotides of any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; or (b)

c. A first spacer sequence and a second spacer sequence that are at least 90% identical to any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146; and

ii) a nucleic acid encoding staphylococcus lucas 9.

116. The method of any one of the preceding methods or use claims, wherein the single nucleic acid molecule is delivered to the cell on a single vector.

117. The method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding SaCas9, wherein the spacer sequence is selected from any one of SEQ ID NOs 12, 15, 16, 20, 27, 28, 32, 33 and 35.

118. The method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding SaCas9, wherein the SaCas9 comprises the amino acid sequence SEQ ID No. 711.

119. The method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding SaCas9, wherein the SaCas9 is a variant of amino acid sequence SEQ ID No. 711.

120. The method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding SaCas9, wherein the SaCas9 comprises an amino acid sequence selected from any one of SEQ ID NOs 715-717.

121. The method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding slaucas 9, wherein the spacer sequence is selected from any one of SEQ ID NOs 131, 134, 135, 136, 139, 144, 148, 149, 150, 151, 179, 184, 201, 210, 223, 224, and 225.

122. The method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding a slaucas 9, wherein the slaucas 9 comprises the amino acid sequence SEQ ID NO 712.

123. The method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding a slaucas 9, wherein the slaucas 9 is a variant of amino acid sequence SEQ ID No. 712.

124. The method of any one of the preceding methods or use claims, comprising a nucleic acid molecule encoding a slaucas 9, wherein the slaucas 9 comprises an amino acid sequence selected from any one of SEQ ID NOs 718-720.

125. A method of cleaving a portion of an exon in a subject with Duchenne Muscular Dystrophy (DMD) using a premature stop codon, the method comprising delivering to a cell a single nucleic acid molecule comprising:

ii) a nucleic acid encoding staphylococcus aureus Cas9 (SaCas 9);

wherein the guide RNA pair and SaCas9 excise a portion of the exon.

126. A method of cleaving a portion of an exon in a subject with Duchenne Muscular Dystrophy (DMD) using a premature stop codon, the method comprising delivering to a cell a single nucleic acid molecule comprising:

ii) a nucleic acid encoding staphylococcus lucas 9;

wherein the guide RNA pair and SaCas9 excise a portion of the exon.

127. The method of any one of the preceding method claims, comprising a single nucleic acid molecule, wherein the single nucleic acid molecule is delivered to the cell on a single vector.

128. The method of any one of the preceding method claims, wherein a portion of the DMD gene is excised, and wherein the portion of the gene remaining after excision is rejoined via one nucleotide insertion.

129. The method of any one of the preceding method claims, wherein a portion of the DMD gene is excised, and wherein the portion of the exon remaining after excision is rejoined without nucleotide insertion.

130. The method of any one of the preceding method claims, wherein a portion of the DMD gene is excised, wherein the excised portion of the gene is between 5 and 250, 5 and 200, 5 and 150, 5 and 100, 5 and 75, 5 and 50, 5 and 25, 5 and 10, 20 and 250, 20 and 200, 20 and 150, 20 and 100, 20 and 75, 20 and 50, 20 and 25, 50 and 250, 50 and 200, 50 and 150, 50 and 100, and 50 and 75 nucleotides in size.

131. The method of any one of the preceding method claims, wherein a portion of the DMD gene is excised, wherein the excised portion of the exon is between 8 and 167 nucleotides in size.

132. The method of any of the preceding method claims, wherein a portion of the DMD gene is excised, wherein the portion is located within exons 43, 44, 45, 50, 51 or 53.

133. The method of any one of the preceding method claims, comprising a pair of guide RNAs, wherein the pair of guide RNAs comprises a first spacer sequence and a second spacer sequence selected from any one of: SEQ ID NOS 10 and 15;10 and 16;12 and 16;1001 and 1005;1001 and 15;1001 and 16;1003 and 1005;16 and 1003;12 and 1010;12 and 1012;12 and 1013;10 and 1016;1017 and 1005;1017 and 16;1018 and 16;15 and 10;16 and 10;16 and 12;1005 and 1001;15 and 1001;16 and 1001;1005 and 1003;1003 and 16;1010 and 12;1012 and 12;1013 and 12;1016 and 10;1005 and 1017;16 and 1017; and 16 and 1018.

134. The method of any one of the preceding method claims, comprising a pair of guide RNAs, wherein the pair of guide RNAs comprises a first spacer sequence and a second spacer sequence selected from any one of: 148 and 134;149 and 135;150 and 135;131 and 136;151 and 136;139 and 131;139 and 151;140 and 131;140 and 151;141 and 148;144 and 149;144 and 150;145 and 131;145 and 151;146 and 148;134 and 148;135 and 149;135 and 150;136 and 131;136 and 151;131 and 139;151 and 139;131 and 140;151 and 140;148 and 141;149 and 144;150 and 144;131 and 145;151 and 145; and 148 and 146.

135. The method of any one of the preceding method claims, comprising SaCas9, wherein the SaCas9 comprises the amino acid sequence SEQ ID NO 715.

136. The composition or method of any of the above claims, wherein the single nucleic acid molecule is an AAV vector, wherein the vector comprises, in terms of the plus strand, from 5 'to 3': the reverse complement of the first sgRNA backbone sequence, the reverse complement of the nucleic acid encoding the first sgRNA guide sequence, the reverse complement of the promoter for expressing the nucleic acid encoding the first sgRNA, the promoter (e.g., CK8 e) for expressing the nucleic acid encoding SaCas9, the polyadenylation sequence, the promoter for expressing the second sgRNA in the same direction as the promoter of SaCas9, the second sgRNA guide sequence, and the second sgRNA backbone sequence.

137. The composition or method of claim 136, wherein the promoter for expressing the first sgRNA guide sequence is an hU6 promoter.

138. The composition or method of any of claims 136-137, wherein the promoter for expressing the second sgRNA guide sequence is an hU6 promoter.

139. The composition or method of any of claims 136-137, wherein the promoter for expressing the first sgRNA guide sequence is a hU6 promoter and the promoter for expressing the second sgRNA guide sequence is a hU6 promoter.

140. The composition or method of any of claims 136-137, wherein the promoter for expressing the nucleic acid encoding the first sgRNA guide sequence is a 7SK promoter.

141. The composition or method of any of claims 136-137, wherein the promoter for expressing the nucleic acid encoding the second sgRNA guide sequence is a 7SK promoter.

142. The composition or method of any of claims 136-137, wherein the promoter for expressing the nucleic acid encoding the second sgRNA guide sequence is an H1m promoter.

143. The composition or method of any of the above claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to a nucleic acid sequence encoding one or more Nuclear Localization Sequences (NLS).

144. The composition or method of any of the above claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to a nucleic acid sequence encoding a Nuclear Localization Sequence (NLS).

145. The composition or method of any of the above claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to two nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS).

146. The composition or method of any of the above claims, wherein the nucleic acid sequence encoding SaCas9 or slaucas 9 is fused to three nucleic acid sequences each encoding a Nuclear Localization Sequence (NLS).

147. The composition or method of any of claims 143-146, wherein the one or more NLSs comprise SV40 NLS.

148. The composition or method of any of claims 143-147, wherein the one or more NLSs comprise a c-Myc NLS.

149. The composition or method of any of claims 143-148, wherein the one or more NLS comprise a nucleoplasmin NLS.

150. The composition or method of any of the above claims, wherein the nucleic acid encoding the guide RNA or the nucleic acid encoding the pair of guide RNAs comprises a sequence selected from any of SEQ ID NOs 600, 601 or 900-917, and wherein the composition or method comprises a nucleic acid encoding slaucas 9.

151. The composition or method of any of the above claims, wherein the nucleic acid encoding the guide RNA or the nucleic acid encoding the pair of guide RNAs comprises a sequence selected from any of SEQ ID NOs 901-917, and wherein the composition or method comprises a nucleic acid encoding slaucas 9.

152. The composition of any one of the preceding claims, wherein the nucleic acid molecule encodes at least a first and a second guide RNA.

153. The composition of claim 152, wherein said nucleic acid molecule encodes a spacer sequence of said first guide RNA, a backbone sequence of said first guide RNA, a spacer sequence of said second guide RNA, and a backbone sequence of said second guide RNA.

154. The composition of claim 152, wherein the spacer sequence of the first guide RNA is identical to the spacer sequence of the second guide RNA.

155. The composition of claim 152, wherein the spacer sequence of the first guide RNA is different from the spacer sequence of the second guide RNA.

156. The composition of any one of claims 153-155, wherein the backbone sequence of the first guide RNA is identical to the backbone sequence of the second guide RNA.

157. The composition of any one of claims 153-156, wherein the backbone sequence of the first guide RNA is different from the backbone sequence of the second guide RNA.

158. The composition of claim 156, wherein the backbone sequence of the first guide RNA comprises a sequence selected from the group consisting of SEQ ID NOs 901-916, and wherein the backbone sequence of the second guide RNA comprises a different sequence selected from the group consisting of SEQ ID NOs 901-916.