CN116497125A - SNP (Single nucleotide polymorphism) marker of original seed of blue crab in Bohai sea and application of SNP marker - Google Patents
SNP (Single nucleotide polymorphism) marker of original seed of blue crab in Bohai sea and application of SNP marker Download PDFInfo
- Publication number
- CN116497125A CN116497125A CN202310117064.9A CN202310117064A CN116497125A CN 116497125 A CN116497125 A CN 116497125A CN 202310117064 A CN202310117064 A CN 202310117064A CN 116497125 A CN116497125 A CN 116497125A
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- primer pair
- snp
- site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000238097 Callinectes sapidus Species 0.000 title claims abstract description 48
- 239000003550 marker Substances 0.000 title claims abstract description 25
- 239000002773 nucleotide Substances 0.000 title claims description 30
- 125000003729 nucleotide group Chemical group 0.000 title claims description 30
- 241001533364 Portunus trituberculatus Species 0.000 claims description 34
- 238000011144 upstream manufacturing Methods 0.000 claims description 24
- 230000037396 body weight Effects 0.000 claims description 9
- 241000283956 Manis Species 0.000 claims description 3
- 238000009395 breeding Methods 0.000 claims description 3
- 230000001488 breeding effect Effects 0.000 claims description 3
- 238000011160 research Methods 0.000 abstract description 4
- 238000011835 investigation Methods 0.000 abstract description 2
- 108020004414 DNA Proteins 0.000 description 15
- 239000003795 chemical substances by application Substances 0.000 description 11
- 238000000034 method Methods 0.000 description 8
- 230000002068 genetic effect Effects 0.000 description 5
- 238000003205 genotyping method Methods 0.000 description 5
- 238000005259 measurement Methods 0.000 description 5
- 238000012163 sequencing technique Methods 0.000 description 5
- 108700028369 Alleles Proteins 0.000 description 4
- 241001465754 Metazoa Species 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 4
- 210000000988 bone and bone Anatomy 0.000 description 4
- 238000000605 extraction Methods 0.000 description 4
- 238000012408 PCR amplification Methods 0.000 description 3
- 238000012098 association analyses Methods 0.000 description 3
- 238000001514 detection method Methods 0.000 description 3
- 238000012165 high-throughput sequencing Methods 0.000 description 3
- 210000003205 muscle Anatomy 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 241001672730 Scylla paramamosain Species 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 238000010219 correlation analysis Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000007865 diluting Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 108020004707 nucleic acids Proteins 0.000 description 2
- 102000039446 nucleic acids Human genes 0.000 description 2
- 150000007523 nucleic acids Chemical class 0.000 description 2
- 102000054765 polymorphisms of proteins Human genes 0.000 description 2
- 230000001737 promoting effect Effects 0.000 description 2
- 238000003908 quality control method Methods 0.000 description 2
- 229920000936 Agarose Polymers 0.000 description 1
- 108091093088 Amplicon Proteins 0.000 description 1
- 108091026890 Coding region Proteins 0.000 description 1
- 241000238553 Litopenaeus vannamei Species 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 241000201912 Suaeda Species 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 238000009360 aquaculture Methods 0.000 description 1
- 244000144974 aquaculture Species 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 238000012364 cultivation method Methods 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000003912 environmental pollution Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000001914 filtration Methods 0.000 description 1
- 238000012214 genetic breeding Methods 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 238000007403 mPCR Methods 0.000 description 1
- 238000009364 mariculture Methods 0.000 description 1
- 239000011159 matrix material Substances 0.000 description 1
- 230000036438 mutation frequency Effects 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 239000007858 starting material Substances 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 230000007704 transition Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a group of SNP markers of a blue crab stock in Bohai sea and application thereof. The SNP markers include SNP3047G > A, SNP T > G, SNP189G > A, SNP1889G > A, SNP1646C > A, SNP G > T, SNP2167C > T, SNP606G > C, SNP T > C, SNP1078C > T, SNP1337C > T, SNP1765G > A. The SNP marker provided by the invention has the characteristics of accuracy and high efficiency, and can be combined for investigation and research on the current situation of the blue crab germplasm resources in Bohai sea and stock marking and conservation.
Description
Technical Field
The invention relates to SNP markers and application thereof, in particular to SNP markers of a blue crab stock in Bohai sea and application thereof.
Background
Portunus trituberculatus (Portuguese) is an important economic crab in the marine fishery and mariculture industry of China, widely distributed in coastal areas of southeast Asia, including China, korea, japan and other sea areas, and has high commercial value. Bohai sea is used as one of the semi-closed sea areas, and the germplasm resources are rich. The blue crab cultivation method has the original field of blue crabs of a national level at present in China, and plays an important role in maintaining the germplasm resources of blue crabs in Bohai sea, promoting the ecological healthy cultivation of blue crabs and promoting the income increase and the enrichment of fishermen. However, in recent years, the wild resources of the blue crabs in the Bohai sea are drastically reduced due to excessive fishing and environmental pollution, and meanwhile, the genetic diversity of certain geographical populations is reduced, so that the original germplasm resources of the blue crabs are gradually degraded, and the difficulty of stock conservation is increased.
Single nucleotide polymorphism (single nucleotide polymorphisms, SNP) refers mainly to DNA sequence polymorphism at the genome level due to variation of single nucleotide, and forms include deletion, insertion, transition, transversion, and the like of single base. SNP variation in coding regions and adjacent regulatory sequences thereof may change the expression products or expression levels of genes, and thus becomes a new tool for studying genomic polymorphisms and for identifying and locating genes related to diseases, growth, reproductive performance, and the like. Compared with other molecular marking technologies, SSR markers have the following characteristics: SNP is mutation based on mononucleotide, mutation frequency is low, and genetic stability is relatively high; 2. the loci are abundant and widely distributed, and SNP loci can be found in and near any known or unknown gene; 3. the polymorphism is high; 4. having bimorphism and allelotedness, the allele frequency of which can be estimated in any population; 5. the detection is quick, and the automatic analysis is easy to realize.
At present, SNP molecular markers are widely applied to aquatic animal genetics and breeding, such as litopenaeus vannamei (Yu et al, 2014), scylla paramamosain (Scylla paramamosain, ma Hongyu, etc., 2011) and portunus trituberculatus (P.trituberculotus, zhang Dening, etc., 2015). However, since the economic traits of the aquaculture animals are basically quantitative traits, it is still difficult to identify SNPs related to important traits, association analysis of SNP molecular markers and traits is still in a preliminary stage, and related research results are still to be further verified or confirmed before being truly applied to the design of genetic breeding. The early research mainly focuses on genetic diversity analysis, genetic linkage map construction and other aspects, the application of SNP molecular markers in portunus trituberculatus is realized in other sea areas instead of the Bohai sea, and the genetic markers are only related to the phenotype and genotype of the portunus trituberculatus, but no germplasm resource is researched. No report on SNP molecular markers of portunus trituberculatus stock has been made so far.
Disclosure of Invention
The invention aims to provide a group of SNP markers of a blue crab stock in Bohai sea and application thereof.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a group of SNP markers of a blue crab stock in Bohai sea, which comprises SNP3047G > A, SNP T > G, SNP189G > A, SNP1889G > A, SNP1646C > A, SNP309G > T, SNP2167C > T, SNP G > C, SNP755T > C, SNP1078C > T, SNP1337C > T, SNP1765G > A, wherein:
the SNP3047G > A is positioned at the 131 th site of a nucleotide sequence shown as SEQ ID NO.1, and the site is G/A;
the SNP115T > G is positioned at the 59 th position of a nucleotide sequence shown as SEQ ID NO.2, and the site is T/G;
the SNP189G > A is positioned at the 149 th position of a nucleotide sequence shown as SEQ ID NO.3, and the locus is G/A;
the SNP1889G > A is positioned at the 134 th site of a nucleotide sequence shown as SEQ ID NO.4, and the site is G/A;
the SNP1646C > A is positioned at the 92 th position of a nucleotide sequence shown as SEQ ID NO.5, and the site is C/A;
the SNP309G > T is positioned at the 123 rd position of the nucleotide sequence shown as SEQ ID NO.6, and the site is G/T;
the SNP2167C > T is positioned at the 150 th site of the nucleotide sequence shown as SEQ ID NO.7, and the site is C/T;
the SNP606G > C is positioned at the 37 th position of a nucleotide sequence shown as SEQ ID NO.8, and the site is G/C;
the SNP755T > C is positioned at 153 th site of a nucleotide sequence shown as SEQ ID NO.9, and the site is T/C;
the SNP1078C > T is positioned at the 127 th position of a nucleotide sequence shown as SEQ ID NO.10, and the site is C/T;
the SNP1337C > T is positioned at the 85 th position of a nucleotide sequence shown as SEQ ID NO.11, and the site is C/T;
the SNP1765G > A is positioned at 79 th site of a nucleotide sequence shown as SEQ ID NO.12, and the site is G/A.
Further, preferably, both SNP3047G > A, SNP1889G > A, SNP G > T, SNP606G > C, SNP755T > C, SNP1078C > T and SNP1337C > T are significantly associated with the dorsal long, high, body weight traits of portunus trituberculatus; SNP115T > G is significantly associated with the high trait of Portunus trituberculatus; SNP189G > A is obviously related to the length and high character of the manis of the portunus trituberculatus; SNP1646C > A, SNP1765G > A is significantly related to the nail length trait of Portunus trituberculatus; SNP2167C > T is obviously related to the characteristics of the width, length, height and weight of the dorsal horn of the blue crab.
The invention also provides a set of primer pairs for detecting the SNP markers of the invention, comprising 12 pairs of primers, respectively:
the upstream primer F of the first primer pair is shown as SEQ ID NO.13, and the downstream primer R is shown as SEQ ID NO.14 and is used for detecting SNP3047G > A;
the second primer pair, the upstream primer F of the second primer pair is shown as SEQ ID NO.15, and the downstream primer R is shown as SEQ ID NO.16, for detecting SNP115T > G;
the third primer pair, the upstream primer F of the third primer pair is shown as SEQ ID NO.17, and the downstream primer R is shown as SEQ ID NO.18, for detecting SNP189G > A;
the fourth primer pair, the upstream primer F of the fourth primer pair is shown as SEQ ID NO.19, the downstream primer R is shown as SEQ ID NO.20, is used for detecting SNP1889G > A;
a fifth primer pair, wherein the upstream primer F of the fifth primer pair is shown as SEQ ID NO.21, and the downstream primer R is shown as SEQ ID NO.22, and is used for detecting SNP1646C > A;
a sixth primer pair, wherein the upstream primer F of the sixth primer pair is shown as SEQ ID NO.23, and the downstream primer R is shown as SEQ ID NO.24, and is used for detecting SNP309G > T;
a seventh primer pair, wherein the upstream primer F of the seventh primer pair is shown as SEQ ID NO.25, and the downstream primer R is shown as SEQ ID NO.26, and is used for detecting SNP2167C > T;
an eighth primer pair, wherein an upstream primer F of the eighth primer pair is shown as SEQ ID NO.27, and a downstream primer R of the eighth primer pair is shown as SEQ ID NO.28, and is used for detecting SNP606G > C;
a ninth primer pair, wherein an upstream primer F of the ninth primer pair is shown as SEQ ID NO.29, and a downstream primer R of the ninth primer pair is shown as SEQ ID NO.30, and is used for detecting SNP755T > C;
a tenth primer pair, wherein an upstream primer F of the tenth primer pair is shown as SEQ ID NO.31, and a downstream primer R of the tenth primer pair is shown as SEQ ID NO.32, and is used for detecting SNP1078C > T;
an eleventh primer pair, wherein an upstream primer F of the eleventh primer pair is shown as SEQ ID No.33, and a downstream primer R of the eleventh primer pair is shown as SEQ ID No.34, and is used for detecting SNP1337C > T;
and a twelfth primer pair, wherein an upstream primer F of the twelfth primer pair is shown as SEQ ID NO.35, and a downstream primer R of the twelfth primer pair is shown as SEQ ID NO.36, and is used for detecting SNP1765G > A.
Specifically, the sequences of each primer pair are shown in the following table:
the invention also provides an application of the SNP marker or the primer pair of the SNP marker in breeding of the stock growth trait of the blue crab in Bohai sea.
The invention also provides application of the SNP marker or the primer pair of the SNP marker in stock marker identification and conservation of the blue crab in Bohai sea.
The analysis method adopted by the invention specifically comprises the following steps: (a) extracting genomic DNA of the portunus trituberculatus to be tested; (b) Taking genomic DNA of the portunus trituberculatus to be detected as a template, and adopting the primer pair of the SNP marker to carry out genotyping; (c) And carrying out growth trait association analysis according to the genotyping result.
When a sample to be detected is amplified, if the primer pair of SNP3047G > A is adopted, the genotypes of AA, AG and GG can be amplified, which indicates that the sample to be detected is a blue crab stock in the Bohai sea, wherein the blue crab stock has the advantages of long length of the back bone, high body weight and obvious correlation between the body weight and the genotypes of AA, AG and GG;
if the primer pair marked by SNP115T > G can amplify GG, TG and TT genotypes, the sample to be detected is a blue crab stock in Bohai sea, which is obviously related to the genotypes GG, TG and TT;
if the primer pair marked by SNP189G > A can amplify the genotypes of AA, AG and GG, the sample to be detected is the stock of blue crab in Bohai sea with the length of the back bone and the high correlation with the genotypes of AA, AG and GG;
if the primer pair marked by SNP1889G > A is adopted, the genotypes of AA, AG and GG can be amplified, which indicates that the sample to be detected is a blue nail long, high, and the weight character is obviously related to the genotypes of AA, AG and GG;
if the primer pair marked by SNP1646C > A can amplify AA, AC and CC genotypes, the sample to be detected is a blue crab stock in Bohai sea with the significant correlation of the length character of the back bone and the genotypes AA, AC and CC;
if the primer pair marked by SNP309G > T can amplify the genotypes GG, TG and TT, the sample to be detected is a blue crab stock in the Bohai sea with the characteristics of the body weight obviously related to the genotypes GG, TG and TT;
if the primer pair marked by SNP2167C > T is adopted, the genotypes of CC, TC and TT can be amplified, which indicates that the sample to be detected is a blue crab stock in Bohai sea with long and high body weight characters obviously related to the genotypes of CC, TC and TT;
if the primer pair marked by SNP606G > C can amplify the genotypes of CC, CG and GG, the sample to be detected is the stock of the blue crab in the Bohai sea with the long length of the back bone, high body weight and obviously related with the genotypes of CC, CG and GG;
if the primer pair marked by SNP755T > C is adopted, the genotypes of CC, TC and TT can be amplified, which indicates that the sample to be detected is a blue crab stock in Bohai sea with long and high waistcoat and the weight character obviously related to the genotypes of CC, TC and TT;
if the primer pair marked by SNP1078C > T is adopted, the genotypes of CC, TC and TT can be amplified, which indicates that the sample to be detected is a blue crab stock in Bohai sea with long and high waistcoat and the weight character obviously related to the genotypes of CC, TC and TT;
if the primer pair marked by SNP1337C > T is adopted, the genotypes of CC, TC and TT can be amplified, which indicates that the sample to be detected is a blue crab stock in Bohai sea with long and high body weight characters obviously related to the genotypes of CC, TC and TT;
if the primer pair marked by SNP1765G > A is adopted, the genotypes of AA, AG and GG can be amplified, which indicates that the sample to be detected is the original strain of the blue crab in the Bohai sea with the characteristics of the length of the back nail obviously related to the genotypes of AA, AG and GG.
The SNP marker provided by the invention is obviously related to the growth character of the original seed of the blue crab in the Bohai sea, has the characteristics of good specificity and high sensitivity, is not influenced by environmental conditions, and has accurate detection result and good repeatability and stability. The 12 SNP markers can be used in combination, and whether the sample to be detected is the original seed of the blue crab in the Bohai sea can be identified by carrying out genotyping on the SNP locus of the sample to be detected and selecting the corresponding genotype, so that the method has potential application value for investigation and research on the current situation of the germplasm resources of the blue crab in the Bohai sea and the marking and conservation of the original seed.
Detailed Description
The invention is further illustrated by the following examples, in which the processes and methods not described in detail are conventional and well known in the art, and in which the starting materials or reagents used are commercially available unless otherwise indicated.
Example 1 acquisition of SNP molecular markers
(1) Measurement of Portunus trituberculatus sample sources and growth traits
1 wild group of the blue crab in the Bohai sea (yellow-yellow river, hebei province, national level blue crab stock farm) is collected, 1 wild group of the blue crab in Huang Haisan (New eastern International container terminal of Liyun harbor, jiangsu province), 1 wild group of the blue crab in the east sea (Zhejiang province, ningbo city, china Zhoushan International aquatic product city), and 70 blue crabs are taken from each group. All collected portunus trituberculatus are subjected to growth trait measurement, and measurement indexes comprise 4 quantitative traits of full width, length of the back of the body, height and weight.
(2) Extraction of total DNA of portunus trituberculatus sample muscle tissue
Extracting muscle tissue DNA of 210 blue crab individuals by using a marine animal genome extraction kit (Tiangen, beijing), specifically referring to a kit instruction, measuring the concentration of the DNA of each individual by using a nucleic acid concentration measuring instrument Nano Drop2000, detecting the quality and the integrity of the DNA by 1% agarose gel electrophoresis, and diluting the DNA of all individuals to 50ng/μl for later use.
(3) SNP marker development and genotyping
The DNA samples of 210 individuals are sent to Hangzhou Liangchuan Biotechnology Co., ltd, all individuals are subjected to whole genome simplified sequencing by using a GBS method, and are subjected to SNP discovery by analysis and comparison with a portunus trituberculatus reference genome (ASM 1759143v1 version), and data filtration is carried out according to a Minimum Allele Frequency (MAF) of >0.05 and a detection rate (call rate) of >70%, so that 76 candidate SNP markers are screened out in total.
The DNA samples of 210 blue crabs and the related information of 76 candidate SNP markers are sent to Shanghai wing and applied biotechnology limited company for specific primer design, high throughput sequencing and genotyping. The method comprises the following specific steps: and taking the DNA of the sample to be detected as a template, adding a corresponding PCR amplification primer pair and a single-base extension primer to perform PCR amplification reaction, and performing high-throughput sequencing on the amplicon after three rounds of PCR amplification. And distinguishing different samples from the sequencing result through multiplex PCR agarose electrophoresis, fluorescent quantitative PCR quality control and sequencing quality control, and finally obtaining mutation information of each site in each sample.
(4) Correlation analysis of SNP (Single nucleotide polymorphism) markers and growth traits of portunus trituberculatus
And (3) adopting a General Linear Model (GLM) in Tassel 2.1 software, taking a group structure matrix (Q) value as a covariate, carrying out correlation analysis on the 76 candidate SNP markers and the Bohai sea, yellow sea and east sea portunus trituberculatus samples respectively, and carrying out significance test on the markers at the P <0.05 level.
In the growth trait association analysis, it was found that 12 SNP markers were significantly associated with only the growth trait of blue crabs in Bohai sea, but not with the growth traits of blue crabs in yellow sea and east sea (Table 1). Therefore, the 12 SNP markers can be used as stock markers of the blue crabs in the Bohai sea.
As shown in table 1, SNP3047G > A, SNP1889G > A, SNP G > T, SNP606G > C, SNP755T > C, SNP1078C > T and SNP1337C > T are both significantly associated with the dorsal long, high, weight traits of portunus trituberculatus; SNP115T > G is significantly associated with the high trait of Portunus trituberculatus; SNP189G > A is obviously related to the length and high character of the manis of the portunus trituberculatus; SNP1646C > A, SNP1765G > A is significantly related to the nail length trait of Portunus trituberculatus; the SNP2167C > T is obviously related to the characteristics of the width, length, height and weight of the back of the portunus trituberculatus.
TABLE 1 correlation between 12 SNP markers and growth traits of Portunus trituberculatus Bohai
(5) SNP marker alleles and distribution thereof
The genotypes and allele frequencies of the 12 SNP markers significantly associated with the growth traits of the blue crab stock in Bohai sea are shown in Table 2.
TABLE 2 genotype information of 12 SNP markers significantly related to the growth traits of Portunus trituberculatus primordium in Bohai sea
Example 2 application of SNP marker SNP3047G > A of stock of Portunus trituberculatus in Bohai sea in stock identification (1) Source of sample to be tested
The method comprises the steps of collecting 6 wild populations (Dalian, cucurbit island, qin Royal island, yellow Ye, dongying and Suaeda) of blue crab in Bohai sea, 1 wild population (Lianyuang harbor) of yellow sea, and 1 wild population (Ningbo) of Donghai sea, wherein 60 populations are taken. All collected portunus trituberculatus are subjected to growth trait measurement, and measurement indexes comprise 4 quantitative traits of full width, length of the back shell, height and weight.
(2) Extraction of genomic DNA
Extracting muscle tissue DNA of the 480 blue crab individuals by using a marine animal genome extraction kit (Tiangen, beijing), specifically referring to a kit instruction, measuring the concentration of the DNA of each individual by using a nucleic acid concentration measuring instrument Nano Drop2000, detecting the quality and the integrity of the DNA by 1% agarose gel electrophoresis, and diluting the DNA of all individuals to 50ng/μl for standby.
(3) Marker typing of SNP3047G > A
Amplification primer SNP3047G > a-F: GCAAAACTCAACCCTCTGTATATG and SNP3047G > A-R: CACATTGCTTTCTGACCTCATAG amplifying a target sequence, and performing high-throughput sequencing on the amplified product by taking SNP3047G > A-F as a sequencing primer to obtain an SNP typing result of SNP3047G > A, and judging the genotype of a target SNP locus according to a sequencing peak diagram. If the position has only 1A base peak, the typing result is AA type, if the position has only one G base peak, the typing result is GG type, if the position has both A base peak and G base peak, the typing result is AG type.
(4) Seed selection result of blue crab in Bohai sea
According to the genotypes of 480 individuals, selecting and reserving the individuals, selecting and reserving primer pairs which adopt SNP marker SNP3047G > A to amplify the AA, AG and GG genotypes, and marking the portunus trituberculatus, namely the portunus trituberculatus stock of the Bohai sea with the long length of the terma, the high height and the body weight characters obviously related to the genotypes AA, AG and GG.
In the embodiment, SNP locus SNP3047G > A is used as an example to explain the use of the related marker of the blue crab stock in Bohai sea, and the use method of other loci is similar to the use method of the marker.
While the invention has been described in detail in terms of specific embodiments and experiments, it will be apparent to those skilled in the art that modifications or improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Claims (5)
1. A set of SNP markers of a blue crab stock in Bohai sea, characterized in that the SNP markers comprise: SNP3047G > A, SNP T > G, SNP189G > A, SNP1889G > A, SNP1646C > A, SNP G > T, SNP2167C > T, SNP G > C, SNP T > C, SNP1078C > T, SNP1337C > T, SNP1765G > a, wherein:
the SNP3047G > A is positioned at the 131 th site of a nucleotide sequence shown as SEQ ID NO.1, and the site is G/A;
the SNP115T > G is positioned at the 59 th position of a nucleotide sequence shown as SEQ ID NO.2, and the site is T/G;
the SNP189G > A is positioned at the 149 th position of a nucleotide sequence shown as SEQ ID NO.3, and the locus is G/A;
the SNP1889G > A is positioned at the 134 th site of a nucleotide sequence shown as SEQ ID NO.4, and the site is G/A;
the SNP1646C > A is positioned at the 92 th position of a nucleotide sequence shown as SEQ ID NO.5, and the site is C/A;
the SNP309G > T is positioned at the 123 rd position of the nucleotide sequence shown as SEQ ID NO.6, and the site is G/T;
the SNP2167C > T is positioned at the 150 th site of the nucleotide sequence shown as SEQ ID NO.7, and the site is C/T;
the SNP606G > C is positioned at the 37 th position of a nucleotide sequence shown as SEQ ID NO.8, and the site is G/C;
the SNP755T > C is positioned at 153 th site of a nucleotide sequence shown as SEQ ID NO.9, and the site is T/C;
the SNP1078C > T is positioned at the 127 th position of a nucleotide sequence shown as SEQ ID NO.10, and the site is C/T;
the SNP1337C > T is positioned at the 85 th position of a nucleotide sequence shown as SEQ ID NO.11, and the site is C/T;
the SNP1765G > A is positioned at 79 th site of a nucleotide sequence shown as SEQ ID NO.12, and the site is G/A.
2. The SNP marker of claim 1 wherein SNP3047G > A, SNP1889G > A, SNP G > T, SNP606G > C, SNP755T > C, SNP1078C > T and SNP1337C > T are both significantly associated with the dorsal long, high, body weight traits of portunus trituberculatus; SNP115T > G is significantly associated with the high trait of Portunus trituberculatus; SNP189G > A is obviously related to the length and high character of the manis of the portunus trituberculatus; SNP1646C > A and SNP1765G > A are both significantly related to the nail length trait of Portunus trituberculatus; SNP2167C > T is obviously related to the characteristics of the width, length, height and weight of the dorsal horn of the blue crab.
3. A set of primer pairs for detecting the set of SNP markers as set forth in claim 1, comprising:
the upstream primer F of the first primer pair is shown as SEQ ID NO.13, and the downstream primer R is shown as SEQ ID NO.14 and is used for detecting SNP3047G > A;
the second primer pair, the upstream primer F of the second primer pair is shown as SEQ ID NO.15, the downstream primer R is shown as SEQ ID NO.16, is used for detecting SNP115T > G;
the third primer pair, the upstream primer F of the third primer pair is shown as SEQ ID NO.17, and the downstream primer R is shown as SEQ ID NO.18, for detecting SNP189G > A;
the fourth primer pair, the upstream primer F of the fourth primer pair is shown as SEQ ID NO.19, the downstream primer R is shown as SEQ ID NO.20, is used for detecting SNP1889G > A;
a fifth primer pair, wherein the upstream primer F of the fifth primer pair is shown as SEQ ID NO.21, and the downstream primer R is shown as SEQ ID NO.22, and is used for detecting SNP1646C > A;
a sixth primer pair, wherein the upstream primer F of the sixth primer pair is shown as SEQ ID NO.23, and the downstream primer R is shown as SEQ ID NO.24, and is used for detecting SNP309G > T;
a seventh primer pair, wherein the upstream primer F of the seventh primer pair is shown as SEQ ID NO.25, and the downstream primer R is shown as SEQ ID NO.26, and is used for detecting SNP2167C > T;
an eighth primer pair, wherein an upstream primer F of the eighth primer pair is shown as SEQ ID NO.27, and a downstream primer R of the eighth primer pair is shown as SEQ ID NO.28, and is used for detecting SNP606G > C;
a ninth primer pair, wherein an upstream primer F of the ninth primer pair is shown as SEQ ID NO.29, and a downstream primer R of the ninth primer pair is shown as SEQ ID NO.30, and is used for detecting SNP755T > C;
a tenth primer pair, wherein an upstream primer F of the tenth primer pair is shown as SEQ ID No.31, and a downstream primer R of the tenth primer pair is shown as SEQ ID No.32, and is used for detecting SNP1078C > T;
an eleventh primer pair, wherein an upstream primer F of the eleventh primer pair is shown as SEQ ID No.33, and a downstream primer R of the eleventh primer pair is shown as SEQ ID No.34, and is used for detecting SNP1337C > T;
and a twelfth primer pair, wherein an upstream primer F of the twelfth primer pair is shown as SEQ ID NO.35, and a downstream primer R of the twelfth primer pair is shown as SEQ ID NO.36, and is used for detecting SNP1765G > A.
4. Use of the SNP marker of claim 1 or the primer pair of the SNP marker of claim 3 in breeding of the stock growth trait of portunus trituberculatus in the Bohai sea.
5. Use of the SNP marker of claim 1 or the primer pair of the SNP marker of claim 3 in stock marker identification and conservation of portunus trituberculatus in the Bohai sea.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310117064.9A CN116497125A (en) | 2023-02-15 | 2023-02-15 | SNP (Single nucleotide polymorphism) marker of original seed of blue crab in Bohai sea and application of SNP marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310117064.9A CN116497125A (en) | 2023-02-15 | 2023-02-15 | SNP (Single nucleotide polymorphism) marker of original seed of blue crab in Bohai sea and application of SNP marker |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116497125A true CN116497125A (en) | 2023-07-28 |
Family
ID=87327288
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310117064.9A Pending CN116497125A (en) | 2023-02-15 | 2023-02-15 | SNP (Single nucleotide polymorphism) marker of original seed of blue crab in Bohai sea and application of SNP marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116497125A (en) |
-
2023
- 2023-02-15 CN CN202310117064.9A patent/CN116497125A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110218798B (en) | SNP molecular marker located on pig chromosome 7 and related to eye muscle area and eye muscle thickness and application | |
| AU2021104302A4 (en) | Marker primer combination for molecular identification of quantitative traits of spines of apostichopus japonicus and use thereof | |
| CN110551828A (en) | SNP molecular marker related to chicken back pore density and application thereof | |
| CN110129456A (en) | A kind of anti-vibrios molecular labeling combination of prawn and its application in breeding | |
| CN114908176A (en) | Molecular marker related to chicken carcass and growth traits and application thereof | |
| CN110438242B (en) | Portunus trituberculatus microsatellite marked primer and application thereof | |
| CN113699246B (en) | SNP molecular marker affecting pig feed conversion efficiency character and application thereof | |
| CN107475414B (en) | Method for screening parent oysters with high glycogen content | |
| CN114875157B (en) | SNP (Single nucleotide polymorphism) marker related to individual growth traits of pelteobagrus fulvidraco and application | |
| CN108004332B (en) | It is a kind of to influence the molecular labeling and its application that the main hoof of pig is grown | |
| CN116426653A (en) | DNA (deoxyribonucleic acid) marker for identifying genetic sex of palaemon carinicauda and application thereof | |
| CN114350818B (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| CN112280874B (en) | Copy number variation molecular marker influencing pig backfat thickness on pig chromosome 11 and application | |
| CN116497125A (en) | SNP (Single nucleotide polymorphism) marker of original seed of blue crab in Bohai sea and application of SNP marker | |
| CN108588242B (en) | SNP locus of crassostrea gigas AHR gene | |
| CN108531621B (en) | SNP locus related to rapid growth of crassostrea gigas | |
| CN108913784B (en) | Detection method of EC12 SNP marker of exopalaemon carinicauda | |
| CN113699247A (en) | SNP molecular marker on pig No. 1 chromosome and related to pig remaining feed intake and application thereof | |
| CN114150071A (en) | Application of SNP molecular marker of chicken TRIM13 gene in chicken growth and slaughter trait improvement breeding and breeding method | |
| CN112458183B (en) | Copy number variation molecular marker on pig No. 3 chromosome and related to daily gain and weight and age on market of pig and application thereof | |
| CN113789392B (en) | SNP (Single nucleotide polymorphism) marker related to growth of channel catfish and application thereof | |
| CN111850139B (en) | Molecular marker located on pig chromosome 12 and related to formation of pig monocrchidism and application | |
| CN112080567B (en) | Microsatellite markers of different weight groups of blue crabs and application of microsatellite markers in genetic diversity analysis | |
| CN113151492B (en) | SNP molecular marker related to trachinotus ovatus hypoxia-resistant character and application thereof | |
| CN116334238A (en) | SNP molecular marker related to growth traits of portunus trituberculatus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |