CN116497034A

CN116497034A - Insect-resistant protein and application thereof

Info

Publication number: CN116497034A
Application number: CN202310039354.6A
Authority: CN
Inventors: 董珊珊; 靳明辉
Original assignee: Shenzhen Xianhu Botanical Garden Shenzhen Garden Research Center
Current assignee: Shenzhen Xianhu Botanical Garden Shenzhen Garden Research Center
Priority date: 2023-01-12
Filing date: 2023-01-12
Publication date: 2023-07-28
Anticipated expiration: 2043-01-12
Also published as: CN116497034B

Abstract

The invention discloses an insect-resistant protein and application thereof. The insect-resistant protein is synthesized by prokaryotic expression of a plant insect-resistant gene FBT, the nucleotide sequence of the insect-resistant protein is shown as SEQ ID NO.1, and the plant insect-resistant gene FBT is from moss plants. The invention also provides a recombinant expression vector and an engineering strain, and also provides an application of the insect-resistant protein, the recombinant expression vector or the engineering strain in improving the plant in resisting pest damage, and also provides a reagent of cotton bollworms, which comprises the insect-resistant protein. According to the invention, through an insect toxicology experiment, the insecticidal effect of the insecticidal protein is verified, so that the novel insecticidal plant can be developed, and the insecticidal protein has strong feasibility and application prospect.

Description

Insect-resistant protein and application thereof

Technical Field

The invention relates to the field of plant extracts, in particular to an insect-resistant protein and application thereof.

Background

Cotton bollworms are common pests seriously harming crops, have wide feeding habits, can reach more than 200 host plants, not only harm cotton, but also harm other common crops such as corn, wheat, sorghum, peas, broad beans, rape, peanuts, tomatoes, peppers, sunflowers and the like. Cotton bollworms are the most common and serious pests of cotton crops, and the mode of damage is usually that larvae drill the buds, flowers, bolls and eat tender leaves of cotton. After the buds are eaten by being eaten, the buds and leaves are opened to be yellow brown, and the buds and leaves fall off after 2-3 days, so that pollination and boll bearing are not possible. The cotton bollworms eat holes from the green bollworms, finally influence the growth of the cotton bollworms and induce diseases to cause stiff valve rot, and the leaves are bitten out of the holes or are carved. Each pest generally feeds on about 10 buds, flowers and bolls in the larval stage, and can reach 18 in serious cases, which seriously affects the growth and the yield of cotton. Currently, chemical control methods and biological control methods are available for cotton bollworms, wherein the chemical control method is to grasp the optimal control period, and preferably to apply the chemical in the full-season of eggs or hatched larvae. The medicine can be chlorantraniliprole, emamectin benzoate, indoxacarb, beta-cypermethrin, lambda-cyhalothrin, chlorfluazuron, cotton bollworm nuclear polyhedrosis virus, etc. Some agents may be resistant and toxic to humans.

The biological control method does not need to use chemical agents and does not generate toxicity to human bodies, wherein Bt toxin is a toxic protein commonly used in the biological control method, bt is an abbreviation of bacteria Bacillus thuringiensis, the toxic protein is a companion cell crystal generated by the toxic protein, and 'toxin' means that the toxic protein is toxic to specific species and not toxic to all organisms. Bt toxin is an insecticidal protein with remarkable activity on cotton bollworms, and is very safe to other insects and the environment. The insect-resistant cotton using the transgenic BT gene can effectively control the harm of cotton bollworms, thereby achieving the purpose of preventing and controlling cotton bollworms. After the Bt cotton grows green leaves, the cotton bollworm larvae start to attack. When they eat young leaves, buds, flowers and bells, the transgenic Bt toxin is ingested along with them, the Bt toxin recognizes receptors on microvilli of the intestinal epithelial cells of the larvae, and after interaction with a series of receptor proteins, permeable channels are formed on the intestinal cell membranes, so that the intestinal cells are damaged and shed, and the intestines of the larvae are thoroughly rotten until feeding is stopped and death occurs. An important mechanism of cotton bollworms against Bt proteins is the loss of receptor function, which reduces or fails to perforate the Bt toxins, resulting in loss of insecticidal activity of the Bt toxins. Bt cotton is planted in large areas in China, bt toxin is expressed in the whole growth and development period, and the planting in China is over 10 years. The population of cotton bollworms is under Bt toxin screening pressure for a long time and on a large scale, the risk of developing resistance to Bt toxins is increasing. In recent years, the resistance of field bollworms to Bt insecticidal proteins has gradually increased.

Moss plants are pioneer plants in the nature, adapt to extreme living environments, have extremely strong disease resistance, stress resistance and insect resistance, and are important gene treasury to be developed. The Lejeuneaceae family is the largest family of moss phylum, and has about 90 genera, more than 1000 species worldwide, and is the main moss plant constituting tropical rain forest and subtropical original forest. The Lawsonia inermis (Trocholejeunea sandvicensis) is a plant of the family Lawsoniaceae of the order Phillidae, which grows on the trunk, on the wall of the soil, on the surface of the rock, the Chinese herbal medicines can be collected all the year round, washed, used fresh or dried in the sun, and other provinces in China are distributed except Qinghai, xinjiang and Gansu. At present, the study on the pest-resistant genes in moss plants and the effect of the expressed proteins thereof on resisting pest damage is less common. In view of the gradual increase of the resistance capability of field cotton bollworms to Bt insecticidal proteins in recent years, research on novel insect-resistant genes in moss plants and insect-resistant proteins expressed by the novel insect-resistant genes has important practical significance and economic value for developing novel insect-resistant plants.

Disclosure of Invention

The invention provides an insect-resistant protein and application thereof, which are beneficial to developing new insect-resistant plants.

In a first aspect, the invention provides an insect-resistant protein, which is synthesized by prokaryotic expression of a plant insect-resistant gene FBT, and the nucleotide sequence of the plant insect-resistant gene FBT is shown as SEQ ID NO. 1.

In a second aspect, the invention also provides a recombinant expression vector obtained by connecting the plant insect-resistant gene FBT and the prokaryotic expression vector pET30a.

In a third aspect, the invention also provides an engineering strain, wherein the engineering strain is a strain which is obtained by transforming the recombinant expression vector into an escherichia coli cell to obtain a plasmid and is cloned positively after transforming the plasmid into the escherichia coli.

In a fourth aspect, the invention also provides a preparation method of the insect-resistant protein, which comprises the steps of inducing the expression of the engineering strain protein, purifying and recovering the engineering strain protein, and obtaining the solution of the insect-resistant protein.

In a fifth aspect, the invention provides the use of an insect-resistant protein, recombinant expression vector or engineered strain to enhance plant resistance to pest damage.

In a sixth aspect, the invention also provides an anti-bollworm agent comprising an anti-bollworm protein as described above.

The insect-resistant protein provided by the invention is synthesized by encoding a plant insect-resistant gene FBT, wherein the plant insect-resistant gene FBT is selected from the North Asia scale moss in moss plants, and a team discovers a gene FBT which is transferred from a fungus level and contains a fungus fruiting body lectin (FB_lectin) domain through sequencing a large amount of whole genome data of the moss plants in the early work, and the protein encoded by the gene containing the domain generally has an insecticidal effect. According to the invention, the insect-killing effect of the insect-resistant protein is verified by constructing a recombinant expression vector and an engineering strain of the plant insect-resistant gene FBT, inducing the expression of the engineering strain protein, purifying and recovering the solution of the insect-resistant protein, and carrying out insect toxicological experiments.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the description of the embodiments of the present invention will be briefly described below, it being obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram of a multiple cloning site for a pET30a expression vector;

FIG. 2 is a diagram showing SDS-PAGE detection result of bacterial liquids of the induced group and the non-induced group in example 3;

FIG. 3 is a diagram showing SDS-PAGE detection of eluate collected in example 3 and unloaded;

FIG. 4 is a graph of Western Blot identification of eluents collected in example 3;

FIG. 5 is a standard curve of quantitative determination of protein concentration in example 4;

FIG. 6 is a graph showing the results of the insect toxicology experiment of example 5.

Detailed Description

In order to make the technical problems, technical schemes and beneficial effects to be solved more clear, the invention is further described in detail below with reference to the embodiments and the accompanying drawings. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention. The present invention will be specifically described with reference to the following specific examples.

The experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available and, unless otherwise indicated, the techniques not described in detail are carried out according to standard methods well known to those skilled in the art. The cell lines, reagents and vectors mentioned in this application are commercially available or otherwise publicly available, by way of example only, and are not exclusive of the present invention, and may be replaced with other suitable tools or biological materials, respectively.

The embodiment of the invention provides an insect-resistant protein, which is synthesized by encoding a plant insect-resistant gene FBT, wherein the nucleotide sequence of an exon region of the plant insect-resistant gene FBT is shown as SEQ ID NO. 1:

FBT|Trocholejeunea_sandvicensis

ATGTCTTACACATTCAGGGTCCGCGTCTACCAGTCCGATACTTCCGTCTTCTTCTCCAATGTCGAGAGGGTCGTTTGGAACTACGCCAATGGCGGCACATGGATTGAGGACGCCGATCAGTACGTCCTGACGATAGGCGGTAGTGGTACCTCTGGAGCCCTCCGCTTCAAATCGGACACAGGCGAAGAAGCAATCTTTGTCTTCGGTATAGACGACTCCCAGCCCTGGATTGATCTCGTTCCTGATGCCCCCACCGGAGAGAGTACTGCTACGATCGTCATTTCTCAATACTATAATGATGGCTGGAGGCCGTTATCATCATTGGGTGAGGTGCTGCTGAAAGTCGCTCGCTGTCTGTTGGCTGGAGCAACATTGAACCAAAGATGCTGGCAGTTTCAAATGGAGCCCCCTTTAATGTTCTGTCTCGCTGCATCCTGA。

during the research work, a large amount of whole genome data of bryophytes was sequenced, and a gene FBT containing a fungus fruiting body lectin (FB_lectin) domain, which is transferred from the fungus level, was found in bryophytes, and the protein encoded by the gene containing the domain has a general insecticidal effect.

Specifically, the plant insect-resistant gene FBT can be obtained by obtaining the gene structure from a genome annotation file (not published) thereof, extracting a transcriptome reads comparison file corresponding to the gene fragment from the genome comparison file, checking the expression level of the gene, and confirming the correct exon region.

Wherein reads refer to read length, which refers to the base sequence obtained by single sequencing by a sequencer, i.e., a series of ATCGGGTAs, which is not a component in the genome, different sequencing instruments, and different reads length, sequencing the entire genome will produce hundreds of thousands of reads.

Alternatively, the plant insect-resistant gene FBT is derived from moss plants, in particular from the Latifolia nana of Latifoliaceae, and has wide distribution and easily obtained raw materials.

The embodiment of the invention also provides a recombinant expression vector which is obtained by connecting the plant insect-resistant gene FBT and the prokaryotic expression vector pET30a, and can express the plant insect-resistant gene FBT and synthesize insect-resistant protein.

Understandably, prokaryotic expression vector pET30a is a commonly used fusion protein type prokaryotic high-efficiency expression vector containing an anti-kanamycin gene, and expression is induced by T7RNA polymerase provided by host cells. Kanamycin is a protein biosynthesis inhibitor that causes misreading of the mRNA code by binding to the 30S ribosome. If an enzyme that disrupts kanamycin is produced in bacteria, it becomes a resistant strain. Kanamycin-resistant plasmids are often used as selection genes or marker genes in molecular cloning.

It is understood that constructing a recombinant gene expression vector is a process of combining a target gene with a carrier, and is also the core of genetic engineering. The construction of the recombinant expression vector enables the target gene to exist stably in the receptor cell and can be inherited to the next generation, and simultaneously enables the target gene to be expressed and to play a role. The process of combining the target gene with the carrier is actually a recombination process of DNA from different sources, and if the plasmid is used as the carrier, a certain restriction enzyme is firstly used for cutting the plasmid, so that a notch appears on the plasmid and the sticky end is exposed. Then, the target gene is cut with the same restriction enzyme to produce the same cohesive end (a part of restriction enzyme can cut a blunt end and has the same effect). Inserting the cut segment of the target gene into the notch of plasmid, first base complementary pairing and combining, the two cohesive ends being anastomosed together to form hydrogen bond, adding proper amount of DNA ligase to catalyze the formation of phosphodiester bond between two DNA chains, and thus connecting adjacent DNA to form one recombinant expression vector. According to the embodiment of the invention, the recombinant expression vector for expressing the plant insect-resistant gene FBT is obtained by connecting the plant insect-resistant gene FBT with the prokaryotic expression vector pET30a.

Alternatively, the recombinant expression vector connects the plant insect-resistant gene FBT and the prokaryotic expression vector pET30a through cleavage sites NdeI and XhoI.

It is understood that the cleavage site (Restriction Enzyme cutting site) is a specific sequence of one base on the DNA, and that the restriction enzyme recognizes this sequence and cleaves the DNA sequence into two parts. Restriction endonucleases are a class of enzymes that recognize and attach a specific nucleotide sequence and cleave the phosphodiester bond between two deoxyribonucleotides at a specific position in each strand. Restriction enzymes recognize palindromic sequences in DNA sequences, with some enzyme cleavage sites on one side of the palindromic (e.g., ecoRI, bamHI, hindI, etc.) and thus form cohesive ends, and other class II enzymes such as AluI, bsu R I, bal I, halIII, HPa I, sma I, etc., cleavage sites in the middle of the palindromic sequence and form blunt ends. In the embodiment of the invention, the digestion sites NdeI and XhoI are selected to connect the plant insect-resistant gene FBT and the prokaryotic expression vector pET30a.

Optionally, the C-terminal of the recombinant expression vector is linked to a His tag.

Understandably, his-tags, also known as 6 xhis-tag monoclonal antibodies, or 6 xhis monoclonal antibodies, are prepared with mice, his can be adsorbed by nickel columns for purification of recombinant proteins. His-tag (histidine tag) is a protein with 6-10 histidine residues at the amino terminus, which can be used to bind Ni under general or denaturing conditions (e.g. 8M urea) ²⁺ 、Co ²⁺ The transition metal ions form coordination bonds to selectively bind to metal ions, which can be immobilized on the chromatographic medium with chelating ligands, so that His-tagged proteins can selectively bind to the medium when passing through the chromatographic medium equipped with metal ions, while other impurity proteins cannot bind or can only weakly bind. His-tagged proteins bound to the medium can be competitively eluted by increasing the imidazole concentration in the buffer, thereby obtaining higher purity His-tagged proteins. His tag protein purification by metal chelate affinity chromatography (IMAC) is currently the most commonly used method in purification of prokaryotic protein expression.

The embodiment of the invention also provides an engineering strain for synthesizing the insect-resistant protein, wherein the engineering strain is a strain which is obtained by transforming the recombinant expression vector into an escherichia coli cell to obtain a plasmid and then transforming the plasmid into escherichia coli to perform positive cloning.

The embodiment of the invention also provides a preparation method of the insect-resistant protein, which comprises the steps of inducing the engineering strain protein to express, purifying and recovering the engineering strain protein, and obtaining the solution of the insect-resistant protein.

Specifically, the reagent used in the induction process is IPTG, wherein the IPTG generally refers to isopropyl-beta-D-thiogalactoside, and is an organic matter with a chemical formula of C ₉ H ₁₈ O ₅ S, an isolactose mimetic, can cause the transcription process of lactose operon, thus being capable of inducing the expression of the corresponding protein of the downstream gene of lactose operon; the purification process involves lysis of bacteria, magnetic bead binding of the target protein (anti-insect protein) and elution of the target protein.

The embodiment of the invention also provides application of the insect-resistant protein, the recombinant expression vector or the engineering strain in improving the plant in resisting pest damage.

Optionally, the pests are cotton bollworms, which are common pests seriously harming crops, and have wide feeding habits, and the host plants can reach more than 200 species; optionally, the plant is cotton.

The embodiment of the invention also provides an anti-cotton bollworm reagent, which comprises the anti-cotton bollworm protein.

Preferably, the death dose of the insect-resistant protein to cotton bollworms is 0.47 mug/mg body weight + -10%.

The invention is further illustrated by the following examples.

EXAMPLE 1 construction of recombinant expression vectors

1.1 obtaining the Gene of interest

1.1.1 obtaining the DNA sequence of the FBT target gene of the Alternaria alternata of Alternariaceae from the genome annotation file and 1000bp upstream and downstream;

1.1.2 extracting transcriptome reads corresponding to the fragment, checking the expression level of the gene, and confirming the correct exon region.

1.2 vector construction

1.2.1 according to the exon sequence of the FBT gene, entrusting Guangzhou Ai Ji biotechnology limited company to adopt a chemical synthesis method to connect a target fragment to a pET30a expression vector, connecting a His tag at the C end, and inserting the target fragment between NdeI and XhoI sites by a polyclonal site map of the pET30a expression vector as shown in figure 1;

1.2.2 after vector synthesis, the Guangzhou Ai Ji biotechnology company is entrusted to carry out the first generation sequencing identification on the synthesized expression vector, and the connection of the target sequence is ensured to be accurate.

EXAMPLE 2 construction of engineering strains for the Synthesis of insect-resistant proteins

2.1 the recombinant expression vector synthesized in example 1 was transformed into E.coli BL21 (DE 3) strain, spread on LB+Kan+CHL plates (antibiotic LB solid plates with Kan and CHL resistance), and cultured overnight at 37 ℃;

2.2 picking up His-tagged protein expressing monoclonal from overnight plates, inoculating into 3ml or 10-20ml LB medium containing kanamycin (50 mg/L), and culturing overnight at 37 ℃;

2.3 taking the bacterial liquid cultured overnight according to the proportion of 1:20, inoculating the bacterial liquid into LB culture liquid which is preheated to 37 ℃ and contains proper kanamycin resistance (50 mg/L);

2.3 Conventional culture is carried out at 37 ℃ for about 30-60min or longer until the OD600 of the bacterial liquid reaches 0.6-1.0 for standby.

Example 3 inducible expression, purification and recovery of an insect-resistant protein

3.1 protein-induced expression

3.1.1 to the bacterial liquid obtained in example 2, IPTG was added to a final concentration of 1mM, and induction was carried out at 37℃for 2 to 4 hours, and the uninduced group was set, and the IPTG concentration was 0mM, and the same induction temperature and time were used for shaking.

3.1.2 collecting bacterial liquid into a centrifuge tube, centrifuging at 4000g at 4 ℃ for 20 minutes or at 15000g at 4 ℃ for 1 minute, discarding the supernatant, and collecting the precipitate; then the bacteria can enter a bacterial lysis step, or can be frozen at the temperature of-20 ℃ or-80 ℃ for standby; the frozen cells were thawed on ice for 15 minutes before use.

3.2 protein purification

The purification process of the protein includes lysing bacteria, magnetic beads binding to the target protein and elution of the target protein.

3.2.1 lysis of bacteria

a, centrifuging to collect bacterial sediment of 1ml of bacterial liquid in 3.1.2, discarding supernatant, adding 100 μl of lysate, fully suspending bacterial sediment in the lysate, and performing slight vortex (avoiding bubbles as much as possible);

b, adding lysozyme to 1mg/ml, gently mixing, avoiding generating bubbles as much as possible, and placing on ice water bath or ice for 30min;

c, under the condition of slight vortex number, fully lysing bacteria and avoiding generating bubbles as much as possible;

d 4 ℃ centrifugation (15000 g multiplied by 10 min), taking 10 μl of supernatant for subsequent detection, and collecting the rest supernatant into a new clean centrifuge tube;

e, denaturing the supernatant and the precipitate, taking 50 mug denatured protein, using SDS-PAGE (polyacrylamide gel electrophoresis, polyacrylamide gel electrophoresis, called PAGE for short, which is a common electrophoresis technology using polyacrylamide gel as a supporting medium for separating protein and oligonucleotide) to identify the protein expression form (protein Marker: thermo, 26616), observing the experimental result, if the protein is expressed, continuing the subsequent step, if the protein is precipitated, using 8M urea to denature the protein, and continuing the subsequent step.

3.2.2 magnetic bead binding target proteins

a, preparing magnetic beads: ni NTA Magarose Beads, taking 2ml of magnetic bead suspension by using a liquid-transfering device, placing the magnetic bead suspension in a centrifuge tube, placing the centrifuge tube on a magnetic separator, and sucking clear liquid by using the liquid-transfering device after the solution becomes clear;

b magnetic bead balance: taking the centrifuge tube off the magnetic separator, adding a Lysis Buffer with the same volume as the suspension, repeatedly blowing for 5-10 times by using a gun head, placing the centrifuge tube on the magnetic separator, sucking clear liquid by using a liquid transfer device after the solution becomes clear, and repeatedly washing for 2 times;

c magnetic beads bind to the target protein: adding the supernatant obtained in the step e in the step 3.2.1 or the solution obtained by adding 8M urea for dissolving and precipitating into the treated magnetic beads, and mixing the mixture upside down; the centrifuge tube was placed on a mixer and incubated at 4℃for 30min.

3.2.3 elution of target protein

a, washing: placing the centrifuge tube in the step c in 3.2.2 in a magnetic separator, removing the supernatant by a pipette after the solution becomes clear, and reserving the supernatant for sampling detection; adding a Wash Buffer with the volume of 2 times of the suspension into a centrifuge tube, repeatedly blowing the centrifuge tube for 5-10 times by using a gun head, placing the centrifuge tube on a magnetic separator, sucking the supernatant by using a pipette after the solution becomes clear, reserving the supernatant, preparing for sampling and detecting, and repeating the steps for 2 times;

b eluting the target protein: the Elution volume can be changed according to the requirement so as to achieve the aim of adjusting the concentration of the target protein, an absorption Buffer (Elution Buffer) with the volume of 3-5 times of the magnetic bead volume is recommended to be added into a centrifuge tube, the centrifuge tube is gently blown for 3-5 times by using a liquid-transferer, the centrifuge tube is evenly mixed, the centrifuge tube is placed on a magnetic separator, and after the solution becomes clear, the supernatant is sucked by using the liquid-transferer, thus obtaining the target protein component. If necessary, the above steps may be repeated 1 time to increase the recovery amount of the target protein.

c, post-treatment of magnetic beads: adding 1-ml Elution Buffer into a centrifuge tube filled with magnetic beads, repeatedly blowing with a pipettor for 3-5 times to fully suspend the magnetic beads, then placing the magnetic beads into a magnetic separator, sucking and discarding the supernatant, and repeating the operation for 2 times; adding 1ml of deionized water into the centrifuge tube, repeatedly blowing for 3-5 times by using a pipettor to enable magnetic beads to fully suspend, then placing the magnetic beads into a magnetic separator, sucking and discarding supernatant, and repeating the operation for 2 times; finally, 1 XPBS containing 20% ethanol was added to make the total volume equal to the volume of the initial bead suspension, and stored at 2-8deg.C.

Example 4 identification of target proteins

4.1 bacterial solutions of the induced group and the uninduced group in example 3 were simultaneously subjected to SDS-PAGE detection, coomassie brilliant blue staining, and the loading amounts were 10. Mu.L, and the protein expression and the protein size were confirmed, and as a result, the band size was consistent with the expected size of the target protein, as shown in FIG. 2.

4.2 the eluate collected in step b of 3.2.3 of example 3 was subjected to SDS-PAGE simultaneously with empty detection, coomassie brilliant blue staining, and the amount of the loaded sample was 10. Mu.L, and the protein expression and the protein size were confirmed, and as a result, the band size was consistent with the expected size of the target protein as shown in FIG. 3.

4.3 the eluate collected in step b of 3.2.3 in example 3 was identified using Western Blot, and a loading of 10uL was used to confirm whether the purified protein was correct or not, and the size was expected by binding to the His tag antibody, as shown in FIG. 4, and the result showed that the target protein was expressed and the size was expected.

4.4 protein concentration determination: the BCA protein concentration was measured by expressing the correct protein, and the BCA protein assay was performed by referring to the BCA protein assay kit (sey tin, STP 214) protocol, the standard curve was established as shown in fig. 5, the results of the protein assay are shown in table 1, and the target protein concentration was 0.9054mg/mL.

TABLE 1 measurement results of target protein

Example 5 insect toxicology experiment

The 3-instar larvae of cotton bollworms with consistent growth state are selected, 1 control group and 5 treatment groups (42 head worms in each group) are fed by adopting a feed poisoning method, and the growth state and the death rate are counted after 24 hours, and the result is shown in figure 6. Wherein the feed of the control group was added with an equal volume of PBS buffer, the feed of the treatment group was added with an insect-repellent protein solution having a concentration of 1. Mu.g/ml, 2. Mu.g/ml, 4. Mu.g/ml, 8. Mu.g/ml, 16. Mu.g/ml, respectively, and the insect-repellent protein solution at each concentration was obtained by adjusting the concentration of the target protein solution obtained in example 3 according to the concentration measured in example 4, and the average weight of the insects was 6.35mg.

As can be seen from fig. 6, the control group (upper row) and the treatment group (lower row) were grown after 24 hours in the present experiment, and the FBT-treated group had all the bollworms died; after 24 hours, the control group dies 2 insects, the death rate is 4.76%, when the concentration of the FBT in the treatment group reaches 2 mug/ml, the insects die 22, after the concentration of the FBT in the treatment group reaches 4 mug/ml, the insects die 41 insects, and half of the death concentration of the FBT toxic protein on the cotton bollworms is 2ug/ml, and the half death dose is 0.23ug/mg body weight; the absolute mortality concentration was 4ug/ml and the absolute mortality dose was 0.47 μg/mg body weight. The Bt-transformed insect-resistant cotton is widely used for prevention and control of cotton bollworms in China, and field resistance monitoring results show that the cotton bollworms have resistance in field population, in addition, the resistance multiple of the indoor screened resistant strain to BT protein is up to 6000 times, and the half death concentration of the Bt protein to the resistant cotton bollworms needs to be more than 10 ug/ml. Insect toxicology experiments show that the insect-resistant protein obtained in the embodiment 3 has remarkable poisoning effect on cotton bollworms, and the toxic protein gene is derived from moss plants, belongs to eukaryotic expression systems, is transferred into cotton or other plants in the future and is used as supplement or replacement of Bt protein to develop new insect-resistant plants, so that the insect-resistant protein has stronger feasibility and application prospect.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the invention, but any modifications, equivalents, improvements, etc. within the principles of the present invention should be included in the scope of the present invention.

Claims

1. The insect-resistant protein is characterized in that the insect-resistant protein is synthesized by prokaryotic expression of plant insect-resistant gene FBT, and the nucleotide sequence of the plant insect-resistant gene FBT is shown as SEQ ID NO. 1.

2. The insect-resistant protein of claim 1, wherein said plant insect-resistant gene FBT is derived from bryophyte.

3. The recombinant expression vector is characterized by being obtained by connecting a plant insect-resistant gene FBT and a prokaryotic expression vector pET30a, wherein the nucleotide sequence of the plant insect-resistant gene FBT is shown as SEQ ID NO. 1.

4. The recombinant expression vector according to claim 3, wherein said recombinant expression vector is obtained by ligating said plant insect-resistant gene FBT and said prokaryotic expression vector pET30a by means of cleavage sites NdeI and XhoI.

5. An engineered strain for synthesizing the insect-resistant protein according to any one of claims 1 to 2, wherein the engineered strain is a strain which is transformed into an escherichia coli cell by using the recombinant expression vector according to claim 3 to obtain a plasmid, and is transformed into an escherichia coli by using the plasmid to obtain a positive clone.

6. A method for preparing an insect-resistant protein, comprising: inducing the engineering strain protein according to claim 5 to express and purifying and recovering to obtain the solution of the insect-resistant protein.

7. Use of the insect-resistant protein of claim 1, the recombinant expression vector of claim 3 or the engineered strain of claim 5 for plant resistance to the damage of cotton bollworms.

8. The use according to claim 7, wherein the plant is cotton.

9. An anti-bollworm agent comprising the anti-bollworm protein of claim 1 or 2.

10. The agent of claim 9, wherein the lethal dose of said insect-resistant protein to cotton bollworms is 0.47 μg/mg body weight ± 10%.