CN116496965A - Ethanol-producing zymomonas mobilis and application thereof - Google Patents

Ethanol-producing zymomonas mobilis and application thereof Download PDF

Info

Publication number
CN116496965A
CN116496965A CN202310298017.9A CN202310298017A CN116496965A CN 116496965 A CN116496965 A CN 116496965A CN 202310298017 A CN202310298017 A CN 202310298017A CN 116496965 A CN116496965 A CN 116496965A
Authority
CN
China
Prior art keywords
strain
optionally
zymomonas mobilis
fructose
ethanol
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310298017.9A
Other languages
Chinese (zh)
Inventor
杨世辉
黄钜
陈香宇
王霞
李勉
杜军
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hubei University
Original Assignee
Hubei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hubei University filed Critical Hubei University
Priority to CN202310298017.9A priority Critical patent/CN116496965A/en
Publication of CN116496965A publication Critical patent/CN116496965A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The application discloses a zymomonas mobilis for producing ethanol and application thereof. The ethanol-producing zymomonas mobilis is zymomonas mobilis F74 which knocks out sacB genes and realizes overexpression of sacC genes; wherein the zymomonas mobilis F74 strain is a strain obtained by performing fructose gradient domestication on zymomonas mobilis8 b. The strain can not only efficiently utilize fructose, but also efficiently utilize molasses, adapt to high-sugar environment, and can also utilize fructose or molasses for fermentation to produce ethanol, and the fermentation byproduct has low levan content.

Description

Ethanol-producing zymomonas mobilis and application thereof
Technical Field
The application relates to the technical field of zymomonas mobilis, in particular to zymomonas mobilis for producing ethanol and application thereof.
Background
Bioethanol is one of the most important new bioenergy sources at present and has wider application. A variety of substrates are available for sustainable bioethanol production, including lignocellulosic biomass or molasses, and other industrial waste materials. Molasses is a byproduct of sugar industry, contains rich fermentable sugars such as glucose, fructose, sucrose and the like, and also contains various nutrients such as amino acids, vitamins, inorganic salts and the like, and is used as a raw material for biochemical production in recent years and is suitable for microbial ethanol fermentation.
Zymomonas mobilis (Zymomonas mobilis) is a well-established safe (GRAS) ethanologenic bacterium that can metabolize glucose, fructose and sucrose via its unique Enter-Doudoroff (ED) pathway; meanwhile, the zymomonas mobilis has the characteristics of high sugar resistance, high ethanol conversion rate, low biomass and the like, so that the zymomonas mobilis has great potential in the aspect of producing industrial ethanol by molasses fermentation. However, due to high osmotic pressure and other reasons caused by high sugar content of molasses, the growth of zymomonas mobilis in molasses is often inhibited, and some researches are carried out to improve the growth of strains in molasses through nutrient supplementation (such as inorganic salt or yeast extract and the like), but the supplementation of expensive nutrients is not the preferred strategy for economic industrial application, and meanwhile, the existence of a large amount of sucrose can lead zymomonas mobilis to produce levan (levan) and other byproducts in the molasses fermentation process, so that the ethanol conversion rate is greatly reduced. Starting from the aspect of metabolic pathway modification of zymomonas mobilis, the problems that the strain is inhibited in molasses fermentation and the ethanol conversion rate is reduced by sucrose fermentation byproducts can be more economically and efficiently solved.
Disclosure of Invention
The zymomonas mobilis metabolizes sucrose rich in molasses while producing a large amount of fructose. The inventor discovers that the weak fructose utilization capability of the zymomonas mobilis8b is a bottleneck for restricting the efficient utilization of molasses, and creatively improves the utilization capability of molasses indirectly by improving the fructose utilization capability and metabolic engineering transformation of the zymomonas mobilis strain. Therefore, the embodiment of the application at least discloses the following technical scheme:
(1) A strain of zymomonas mobilis, which is zymomonas mobilis F74 with the sacB gene knocked out and the sacC gene overexpressed; wherein the zymomonas mobilis F74 strain is a strain obtained by performing fructose gradient domestication on zymomonas mobilis8 b.
(2) A method of constructing a zymomonas mobilis strain, said zymomonas mobilis strain (1), said method comprising:
inoculating the zymomonas mobilis strain 8b into a culture medium containing fructose with gradient concentration for subculturing and domestication;
transferring the domesticated strain into a gene editing plasmid for knocking out sacB genes, subculturing, and selecting a first positive clone;
transferring the expression plasmid for over-expressing sacC gene into the first positive clone and subculturing, and selecting a second positive clone.
(3) A method of fermenting molasses, the method comprising: inoculating the zymomonas mobilis strain described in (1) into a fermentation medium containing molasses for culture.
(4) A method of producing ethanol, the method comprising:
inoculating the zymomonas mobilis strain in the step (1) into a fermentation medium containing molasses for culture; and
ethanol is harvested from the fermentation broth.
(5) The use of the Zymomonas mobilis strain described in (1) in fructose fermentation, molasses fermentation and ethanol production.
The technical effects of the zymomonas mobilis strains, the construction method, the molasses fermentation method, the ethanol production method and the application provided by the application are specifically illustrated in examples.
Drawings
FIG. 1 is a graph showing biomass results of various strains of the adaptive laboratory evolution of fructose by the strain 8b-1 and the strain 8b-2 provided in the examples of the present application.
FIG. 2 is a graph of fermentation growth test of strain 8b in RMF15 medium and 1/5BM medium, including results of testing fructose, ethanol and biomass, as provided in the examples herein.
FIG. 3 shows strain F74 and strain F74-B according to the examples of the present application - The test patterns for fermentation growth in RMS15 medium, respectively, included results from the detection of sucrose, fructose, glucose, levan, ethanol and biomass.
FIG. 4 shows strain F74-B according to the examples of the present application - C + The fermentation growth test patterns in RMS15 medium and 1/5BM medium include the results of sucrose, fructose, glucose, levan, ethanol and biomass
FIG. 5 is a schematic diagram showing the structures of the gene editing plasmid pL 2R-. DELTA.sacB and the expression plasmid 39P-Peno-sacC provided in the examples of the present application.
FIG. 6 is a schematic diagram showing the structure of the gene editing plasmid pL 2R-. DELTA.glf provided in the examples of the present application.
Fig. 7 is a schematic diagram of a fermentation broth levan detection operation flow provided in an embodiment of the present application.
Detailed Description
In order to make the objects, technical solutions and advantages of the present application more apparent, the present application will be further described in detail with reference to examples. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the present application. Reagents not specifically and individually described in this application are all conventional reagents and are commercially available; methods which are not specifically described in detail are all routine experimental methods and are known from the prior art.
It should be noted that, the terms "first," "second," and the like in the description and the claims of the present invention and the above drawings are used for distinguishing similar objects, and are not necessarily used for describing a particular sequence or order, nor do they substantially limit the technical features that follow. It is to be understood that the data so used may be interchanged where appropriate such that the embodiments of the invention described herein may be implemented in sequences other than those illustrated or otherwise described herein. Furthermore, the terms "comprises," "comprising," and "having," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.
For a better understanding of the present invention, and not to limit its scope, all numbers expressing quantities, percentages, and other values used in the present application are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. Each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
In this application, "Zymomonas mobilis8b" or "Z.mobilis 8b" or "Zymomonas mobilis b" are interchangeable herein as the same strain constructed according to the methods disclosed in "Zhang M, eddy C, deanda K, et al, metabolic Engineering of a Pentose Metabolism Pathway in Ethanologenic Zymomonas mobilis [ J ]. Science,1995,267 (5195):240-3 ], which can efficiently utilize xylose to produce ethanol and is deposited at the" national emphasis laboratory for biocatalysis and enzyme engineering, national institute of Cooperation, university of North lake, wuhan, hubei province.
In the present application, the RMF2 medium is a medium containing 10g/L yeast extract, 2g/L KH 2 PO 4 And 20g/L fructose. The RMF5 medium contained 10g/L yeast extract and 2g/L KH 2 PO 4 And 50g/L fructose. The RMF10 medium contains 10g/L yeast extract and 2g/L KH 2 PO 4 And 100g/L fructose. The RMF15 medium contained 10g/L yeast extract and 2g/L KH 2 PO 4 And 150g/L fructose.
In the present application, the RMS2 medium is a medium containing 10g/L yeast extract, 2g/L KH 2 PO 4 And 20g/L sucrose. The RMF5 medium contained 10g/L yeast extract and 2g/L KH 2 PO 4 And 50g/L sucrose. The RMF10 medium contains 10g/L yeast extract and 2g/L KH 2 PO 4 And 100g/L sucrose. The RMF15 medium contained 10g/L yeast extract and 2g/L KH 2 PO 4 And 150g/L sucrose.
In the present application, the RMG2 medium is a medium containing 10g/L yeast extract, 2g/L KH 2 PO 4 And 20g/L glucose. The RMG5 medium contained 10g/L yeast extract and 2g/L KH 2 PO 4 And 50g/L glucose. The RMG10 medium contains 10g/L yeast extract and 2g/L KH 2 PO 4 And 100g/L glucose. The RMG15 medium contains 10g/L yeast extract and 2g/L KH 2 PO 4 And 150g/L glucose.
In this application, reference to "molasses" is a by-product formed during the processing of sugar cane or sugar beet into sugar, typically a brown-black viscous liquid. For example, beet molasses is used in two batches, BM (2020) and BM (2021) according to the year of production, each of which is offered by the Lanzhou division of the national academy of sciences of China.
From the results of the measurement of the contents of various sugars (sucrose, glucose, fructose) in the two molasses batches, it can be seen that the proportions of fermentable sugars of the two molasses batches differ: the fermentable sugar in the 2020 beet molasses is mainly sucrose, and the glucose and fructose content is extremely low; the 2021 batch of beet molasses contained lower sucrose content than the 2020 batch, higher glucose and fructose content, but the total fermentable sugar content of the two batches of molasses was almost identical; the pH of both batches of beet molasses was around 5.8 and did not change with the dilution factor of the molasses (Table 1), with "-" in Table 1 indicating no detection.
TABLE 1 determination of various sugar contents and pH values of beet molasses of different batches
In the present application, the molasses medium comprises beet molasses and sterile water medium. For example, 1/5BM means that beet molasses is a medium with a volume ratio of sterile water of 1:4. 1/4BM means that beet molasses is a medium with a volume ratio of sterile water of 1:3.
As shown in FIG. 1, zymomonas mobilis8b was subjected to gradient culture in a liquid medium containing a fructose concentration of 20 to 150g/l to obtain Zymomonas mobilis F74 subjected to subculture. Strain F74 was able to efficiently utilize high concentrations of fructose. During this process, Z.mobilis 8b has undergone a process known as adaptive laboratory evolution (adaptive laboratory evolution, ALE). The process is a method for artificially simulating variation and selection process in natural evolution under laboratory conditions, realizing directional evolution of microorganisms by means of artificial selection pressure and screening individuals with excellent properties from an evolved population, and has good applicability to directional improvement of fructose utilization capacity of zymomonas mobilis. In some embodiments, 13 generations of acclimation, optionally 38 generations of acclimation, optionally 57 generations of acclimation, optionally 74 generations of acclimation are performed in total during the passaging acclimation. Wherein the F74 strain is subjected to 74-generation domestication, and the F74 strain is subjected to missense mutation at the 99 th codon of the glf gene relative to the Zymomonas mobilis8b strain.
In one example, starting strain 8b was used, and the strains were sub-cultured in two parallel groups (8 b-1 and 8 b-2) in medium (RMF 2, RMF5, RMF10, RMF 15) with fructose as the sole carbon source and increasing fructose concentration stepwise. The initial OD600 nm when the first generation 8b seed liquid is inoculated to the RMF2 culture medium is controlled to be 0.1, 100 mu L of culture liquid in each group of culture systems is inoculated to a new culture medium after the strain grows to a logarithmic phase, and the culture medium is replaced by RMF5, RMF10 and RMF15 with higher fructose concentration in the 13 th generation, 38 th generation and 57 th generation respectively, and the acclimation progress is estimated by measuring the biomass of each generation of strain. When domesticated to the 74 th generation, the biomass of 8b-1 is improved from an OD600 nm value of 1 and stabilized to an OD600 nm value of about 6, which indicates that the strain can be propagated in a large amount in a high fructose RMF culture medium, and the strain is a high sugar-resistant strain and named as F74.
In one test example, the domesticated strain F74 and the starting strain 8b evolved from the fructose adaptation laboratory were subjected to fermentation detection of fructose and molasses, and medium was respectively RMF15 and beet molasses (1/5-BM) diluted 5-fold with sterile water, and the initial OD600 nm when seed solution was inoculated to the fermentation medium was 0.1. The results of the fermentation are shown in FIG. 2. As a result, it was found that domesticated strain F74 was able to obtain higher biomass and higher ethanol content than 8b fermentation of fructose or molasses, while the fructose content, glucose content and sucrose content in the fermentation broth became lower.
As shown in FIG. 3, the sacB in the genome of Zymomonas mobilis F74 was knocked out to obtain strain F74-B - . The strain F74-B - Can effectively inhibit the conversion of sucrose into levan and enhance the fructose utilization capacity.
Further to Zymomonas mobilis strain F74-B - Transferring the expression plasmid for expressing sacC outside the nucleus to obtain zymomonas mobilis strain F74-B - C + . As shown in FIG. 4, the strain F74-B - C + Not only fructose but also molasses can be utilized, and ethanol can be produced. In some embodiments, the strain F74-B - C + Fermentation using a medium comprising fructose and/or molasses may result in a fermentation broth having a concentration of not less than 30g/l ethanol, optionally a fermentation broth of not less than 40g/l ethanol, optionally a fermentation broth of not less than 50g/l ethanol, optionally a fermentation broth of not less than 60g/l ethanol. In some embodiments, the strain F74-B - C + The glucose content in the fermentation broth is not higher than 10g/l, optionally not higher than 5g/l, optionally not higher than 2g/l, optionally not higher than 1g/l, optionally not higher than 0.5g/l, optionally not higher than 0.1g/l. In some embodiments, the strain F74-B - C + Fructose content in fermentation broth of (C)Above 10g/l, optionally not higher than 5g/l, optionally not higher than 2g/l, optionally not higher than 1g/l, optionally not higher than 0.5g/l, optionally not higher than 0.1g/l. In some embodiments, the strain F74-B - C + The levan content in the fermentation broth of (a) is not higher than 30g/l, optionally not higher than 10g/l, optionally not higher than 2g/l, optionally not higher than 1g/l, optionally not higher than 0.5g/l, optionally not higher than 0.1g/l.
To this end, the examples of the present application provide a strain of Zymomonas mobilis F74-B - C + Strain F74-B - C + Zymomonas mobilis F74 for knocking out sacB gene and achieving overexpression of sacC gene; wherein the zymomonas mobilis F74 strain is a strain obtained by performing fructose gradient domestication on zymomonas mobilis8 b. Zymomonas mobilis F74-B - C + The molasses ethanol is efficiently fermented, and F74-B-C+ can efficiently utilize sucrose in the molasses and simultaneously produce more ethanol on the premise of not producing byproducts such as levan, polyfructose and the like.
The embodiment of the application provides zymomonas mobilis F74-B - C + Can resist virus pollution, the zymomonas mobilis has strong restriction modification system, and common engineering strains such as escherichia coli and the like have stronger antiviral capability.
In one test example, zymomonas mobilis strain F74-B - And the strain F74 are respectively inoculated into a sucrose culture medium RMS15 for fermentation test, the contents of biomass, fructose, sucrose, glucose, levan and ethanol in fermentation liquid are detected, and the initial OD of the seed liquid when the seed liquid is inoculated into the fermentation culture medium is obtained 600 nm 0.1. The results are shown in FIG. 3, strain F74-B - The ethanol content and biomass in the fermentation broth are higher than those of the strain F74, and the fructose, sucrose, glucose and levan content are lower than those of the strain F74.
In one test example, zymomonas mobilis strain F74-B - C + And Strain F74B - Respectively inoculating into sucrose culture medium RMS15 for fermentation test, detecting biomass, fructose, sucrose, glucose, levan and ethanol content in fermentation broth, inoculating seed solution into fermentation culture mediumInitial OD at Medium 600 nm 0.1. The results are shown in FIG. 4, strain F74-B - C + The ethanol content and biomass in the fermentation broth are higher than those of the strain F74-B - Fructose, sucrose, glucose and levan content lower than strain F74B - 。
The embodiment of the application also discloses the zymomonas mobilis F74-B - C + The construction method of (1) comprises the following steps:
inoculating the zymomonas mobilis strain 8b into a fructose culture medium with gradient concentration for subculture;
transferring the domesticated strain into a gene editing plasmid for knocking out sacB genes, subculturing, and selecting a first positive clone;
transferring the expression plasmid for over-expressing sacC gene into the first positive clone and subculturing, and selecting a second positive clone.
Among them, the G99S mutation site of ZMO0366 in the mutant strain 8b-F74 obtained by adaptive laboratory evolution contributes significantly to the improvement of fructose utilization ability of the strain. In addition, the recombinant strain F74-B-C+ of the zymomonas mobilis constructed by the evolution of an adaptive laboratory and the gene editing can efficiently produce ethanol in molasses in a high-sugar environment without adding additional nutrients, and meanwhile, as the zymomonas mobilis is a facultative anaerobic microorganism, no additional dissolved oxygen control equipment is needed in the fermentation process, and the production cost can be effectively reduced.
In some embodiments, the fructose medium comprises a fructose concentration gradient of 20 to 150g/L.
In some embodiments, the gene editing plasmid carries a CRISPR expression cluster consisting of a donor sequence, a leader sequence, a repeat sequence, and a guide sequence, the nucleotide sequences of the donor sequence, the leader sequence, the repeat sequence, and the guide sequence being shown in sequence in SEQ ID nos. 1-4.
In some embodiments, the expression plasmid carries an operator sequence consisting of a Peno promoter and a sacC sequence, wherein the nucleotide sequences of Peno and sacC are shown in sequence in SEQ ID NO. 5-6.
The embodiment of the application also discloses a method for fermenting molasses, which comprises the step of inoculating the zymomonas mobilis strain provided in the embodiment to a fermentation medium containing molasses for culture. In some embodiments, the zymomonas mobilis strain is F74, F74-B - And/or F74-B - C + 。
The embodiment of the application also discloses a method for producing ethanol, which comprises the steps of inoculating the zymomonas mobilis strain provided in the embodiment to a fermentation medium containing molasses for culture; and harvesting ethanol from the fermentation broth. In some embodiments, the zymomonas mobilis strain is F74, F74-B - And/or F74-B - C + 。
Recombinant strain F74-B of Zymomonas mobilis - C + In a construction embodiment of (2), comprising the steps of:
(1) Culture medium used
The medium used in the present invention was RMG5 (10 g/L yeast extract, 2g/L KH) 2 PO 4 50g/L glucose), RMF2, RMF5, RMF10, RMF15 (10 g/L yeast extract, 2g/L KH) 2 PO 4 20, 50, 100 or 150g/L fructose), RMS15 (10 g/L yeast extract, 2g/L KH 2 PO 4 150g/L sucrose), 1/5-BM (sterile water with beet molasses at 4:1 volume ratio, beet molasses was not sterilized). The zymomonas mobilis is subjected to stationary culture at the temperature of 30 ℃.
(2) Adaptive evolution of Strain 8b
8b was subjected to adaptive laboratory evolution in medium with fructose as sole carbon source. Inoculating 8b glycerol bacteria into a freezing tube containing 1mL of RMG5, standing and activating to turbidity in a 30 ℃ incubator, pouring the freezing tube into a container containing a proper amount of culture medium to serve as fermentation seed liquid, standing and culturing in the 30 ℃ incubator to the middle and later logarithmic phase, respectively inoculating the seed liquid into two 15mL test tubes containing 5mL of RMF2 and respectively named as 8b-1 and 8b-2, and starting fructose adaptability laboratory evolution. After the strain grows to the logarithmic phase, 100. Mu.L of the culture solution in each culture system is transferred to two other new test tubes each containing 5ml of fresh RMF2 for repetition and passageReplacing the evolution culture medium with RMF5 by 13 generations, replacing the evolution culture medium with RMF10 by 38 generations, and replacing the evolution culture medium with RMF15 by 57 generations; the biomass of the culture broth was measured with an ultraviolet spectrophotometer at each transfer. When passing to passage 74, the biomass of strain 8b-1 in RMF15 reached and stabilized at 6OD 600 nm This strain was selected and designated as F74 and stored.
(3) F74 fermentation test
The resulting strain F74 was subjected to fermentation tests with the starting strain 8b in RMF15 and 1/5-BM. The glycerol bacteria of 8b and F74 are inoculated into a freezing tube containing 1mL of RMG5, and after standing and activating to turbidity in a 30 ℃ incubator, the glycerol bacteria are poured into a container containing a proper amount of culture medium to be used as fermentation seed liquid, and the fermentation seed liquid is subjected to standing culture in the 30 ℃ incubator until the glycerol bacteria are in the middle and later period of logarithm, and are respectively inoculated into bacterial bottles of RMF15 and 1/5-BM in an amount of 80 percent, and the initial OD600 nm is controlled to be 0.1. In the fermentation process, the cell growth at different time points is measured by an ultraviolet spectrophotometer, and fermentation liquid obtained at different time points is collected and then used for detecting the content of sucrose, glucose, fructose and ethanol in an HPLC (high performance liquid chromatograph). Adopts Shimadzu commercial company Agilent 1100 series high performance liquid chromatograph (LC-20 AD); the detector is a differential refraction detector (RID-10A); the chromatographic column is SUGAR series SC1011 chromatographic column (Shodex, japan); the temperature of the pool is 40 ℃ and the temperature of the column temperature box is 80 ℃; the mobile phase is ultrapure water, the flow rate is 0.6mL/min, the initial flow rate is set to 0.2mL/min when the instrument is operated, the initial temperature of the column temperature box is 25 ℃, the flow rate of 0.1mL/min gradually increases to 0.6mL/min after the column pressure is stable, and the temperature of the column temperature box is set to 80 ℃; the sample loading was 10. Mu.L. Configuration of mobile phase: taking 2L of ultrapure water into a 2L blue cap bottle as a mobile phase, and carrying out ultrasonic degassing on the mobile phase in the blue cap bottle for 20-30 min. And the product can be used after being restored to room temperature.
(4) Construction of Gene editing plasmid pL2R- ΔsacB
After obtaining mutant strain F74, constructing gene editing plasmid pL 2R-delta sacB for knocking out sacB, transferring gene editing plasmid pL 2R-delta sacB into mutant strain F74, and obtaining strain F74-B - . The method comprises the following specific steps:
selecting a PAM locus from sacB gene sequences, designing primers (sacB-gRNA-F shown as SEQ ID NO.7 and sacB-gRNA-R shown as SEQ ID NO. 8), obtaining fragment gRNA-sacB sequences (shown as SEQ ID NO. 4) by primer annealing self-connection, constructing gRNA-sacB sequences into plasmid pL2R, simultaneously taking DNA fragments with equal length (not containing sacB) at the upstream and downstream of the sacB as homology arms (shown as Up_stream-sacB in the figure, shown as SEQ ID NO. 9), respectively designing primers sacB-US-F (shown as SEQ ID NO. 10) and sacB-US-R (shown as SEQ ID NO. 11), and designing primers (shown as SEQ ID NO. 13) and sacB-DS-R (shown as SEQ ID NO. 12) by the sequence of down_stream-sacB, and carrying out sequence editing on the homology arms (shown as Up_stream-sacB) to obtain the DNA fragments with equal length (shown as Up_stream-sacB in the figure), and carrying out sequence editing on the homology arms into the plasmid pL 2. The structure of the gene editing plasmid pL 2R-. DELTA.sacB is shown in FIG. 5A.
In a specific embodiment, the method comprises the following steps:
primers were synthesized and designed (the underlined part is the cleavage site or homology arm).
sacB-gRNA-F gaaattcacttcggtaacgaagctgcgatggccaac, shown as SEQ ID NO.7
sacB-gRNA-R gaacgttggccatcgcagcttcgttaccgaagtgaa as shown in SEQ ID NO.8
sacB-US-F aggtcaccagctcaccgtctaataacctttgaaaaaatgggtattttacagcc, shown in SEQ ID NO.10
sacB-US-R caaccactcgatctgtggccgaaaaaagattaattcttgttctcgac, sacB-DS-F cacagatcgagtggttggcag as shown in SEQ ID NO.11 and SEQ ID NO.13
sacB-DS-R gctcgagatctgatatcactcatctttggaatagaaatagccgatgcg as shown in SEQ ID NO.14
The pL2R-spe plasmid was subjected to BsaI cleavage according to the following Table system, and recovered after purification. Wherein the "pL2R-spe plasmid" is a DNA fragment containing two tandem CRISPR repeats at pEZ Asp for artificial CRISPR site construction, see in particular "Zheng et al Characterization and repurposing of the endogenous Type I-F CRISPR-Cas system of Zymomonas mobilis for genome engineering [ J ] Nucleic Acids Research,2019, doi:10.1093/nar/gkz" 940.
TABLE 2pL2R-spe plasmid cleavage reaction System
Reagent(s) Volume of
pL2R-spe plasmid 3μg
BsaⅠ 0.5μL
Buffer 5μL
Double distilled water To 50μL
The primers sacB-Spacer-F and sacB-Spacer-R were annealed at 95℃for 5min, immediately after the completion, taken out and cooled to room temperature, and then the recovered pL2R-spe digested vector was subjected to enzyme ligation with the gRNA-sacB annealed product (reaction system is shown in Table 3), and the enzyme ligation system is shown in the following Table. Then E.coli was transformed, screening was performed using resistant plates of spectinomycin (100. Mu.g/mL), single colonies were picked for PCR verification, the band size was verified by sequencing in agreement with the expectations, and the constructed plasmid was designated pL2R-B.
TABLE 3pL2R-spe enzyme-linked and gRNA-sacB enzyme-linked reaction system
Reagent(s) Volume of
pL2R-spe plasmid 3μg
gRNA-sacB 2μg
T4 ligase 0.5μg
Buffer 1μL
Double distilled water To 10μL
And (3) connecting the two DNA fragments of the Up_stream-sacB and the Down_stream-sacB into a long fragment by using overlap PCR, transferring the long fragment and the vector skeleton of the pL2R-B into the DH5 alpha cell competence of the escherichia coli by a Gibbsen assembly method, and carrying out PCR to verify positive cloning on a flat plate, and extracting plasmids in the positive clone after overnight culture (plasmid extraction is carried out according to a standard step of a plasmid extraction kit) to obtain the plasmid pL 2R-delta sacB. The reaction system for the Gibbsen assembly is shown in Table 4. Screening was performed using a spectinomycin resistant plate, single colonies were picked, and a verification PCR amplification procedure was set up by PCR with the appropriate primers: pre-denaturation at 98℃for 3min; the plasmid pL2R- ΔsacB was verified by sequencing, with a denaturation at 98℃of 10s, an annealing at 55℃of 10s and an extension at 72℃of 15s for 30 cycles, the band size being consistent with that expected.
TABLE 4 Gibbsen reaction System
(5) Construction of expression plasmid 39P-Peno-sacC
Construction of expression plasmid 39P-Peno-sacC for overexpression of sacC and transfer of expression plasmid 39P-Peno-sacC into Strain F74-B - Obtaining the strain F74-B - C + 。
The primers Peno-sacC-F (SEQ ID NO. 15) and Peno-sacC-R (SEQ ID NO. 16) were designed to amplify the sacC fragment using the genome of strain F74 as a template, and the sacC fragment was integrated into the 39P-Peno-kana plasmid to obtain the 39P-Peno-sacC plasmid. The structure of the 39P-Peno-sacC plasmid is shown in FIG. 5B.
The PCR amplification procedure included: pre-denaturation at 98℃for 3min; denaturation at 98℃for 10s, annealing at 55℃for 10s, extension at 72℃for 15s for 30 cycles, and recovery of the PCR product to obtain sacC fragments. The sacC fragment and 39P-Peno-kana vector were transferred into E.coli DH 5. Alpha. Cell competence by the Gibbsen assembly method, and the specific method and system were the same as above, and plasmid 39P-Peno-sacC was obtained after kanamycin resistance plate selection.
(6) Construction of Strain F74-B - C +
Preparation of mutant F74 competent:
a proper amount of mutant strain F74 glycerol bacteria are selected by an inoculating loop, streaked on a non-resistance RMF5 solid culture medium plate, and inversely cultured for 2-3 days at 30 ℃ for activation; the single colony which is activated is picked and transferred into a RMF5 liquid culture medium containing about 10mL, and is subjected to stationary culture at 30 ℃ until mid-log phase is used as seed liquid; transferring the seed liquid into a 250mL blue cap bottle containing 200mL of RMF5 liquid culture medium, and controlling the initial OD between 0.025 and 0.03. Standing and culturing at 30 ℃ until OD=0.4-0.6; cooling the blue cap bottle filled with the bacterial liquid on ice for 30min, centrifuging at 4000rpm/min with a precooled 50mL centrifuge tube for 10min to collect bacterial cells, and discarding the supernatant; adding 30mL of pre-cooled sterile water into the centrifuge tube, re-suspending and washing thalli, uniformly mixing, centrifuging at 4000rpm/min for 10min, and discarding the supernatant; adding 30mL of pre-cooled 10% glycerol into a centrifuge tube to resuspend and wash thalli, uniformly mixing, centrifuging at 4000rpm/min for 10min, discarding the supernatant, and repeating the steps once; adding 1% (volume ratio) pre-cooled 10% glycerol re-suspended thallus, slowly mixing, packaging on ice, packaging every 50 μl into sterile 1.5mL centrifuge tube, quick freezing in liquid nitrogen, and storing at-80deg.C.
Transferring the gene editing plasmid pL2R- ΔsacB into F74 competent cells:
f74 competent cells were taken on ice, 50. Mu.L was added to the electrocuvette after the competent cells had thawed, and 1. Mu.g of plasmid was added to the electrocuvette. The electrical switching conditions were 160V, 25. Mu.F, 200Ω. Resuscitates in an incubator at 30℃in RMF5 liquid medium after the electrotransfer. Resuscitates the cultures for 4-6 hours at 6000rpm,1min centrifugation and part of the supernatant removed. The suspension cells were plated at 100. Mu.L on 100. Mu.g/mL spectinomycin-resistant plates and incubated at 30℃for 2 days. After colonies grow out, colony PCR detection is carried out on the recombinant strain, and the PCR amplification program is set as follows: pre-denaturation at 98℃for 2min; denaturation at 98℃for 10s, annealing at 55℃for 10s, extension at 72℃for 15s for 30 cycles; the obtained correct positive clone is activated in a medium with resistant liquid RMF5 and then is subjected to glycerol sterilization, and an appropriate amount of recombinant strain F74-B is selected by an inoculating loop - streaking spe glycerol bacteria on a spectinomycin resistant RMF5 solid culture medium plate, reversely culturing at 30 ℃ for 2-3 days for activation, selecting a plurality of monoclonal antibodies for PCR verification, screening out sacB deletion strains, and preserving the glycerol bacteria after activation to obtain the strain F74-B - spe. To activated F74-B - Inoculating spe strain into non-resistant RMF5 liquid culture medium, subculturing to remove the plasmid pL 2R-delta sacB with resistance gene, and picking appropriate amount of F74-B with inoculating loop until the fifth generation - Streaking the strain on a non-resistance RMF5 solid culture medium plate, and culturing the strain in an inverted way at 30 ℃ for 2-3 days for activation; selecting a plurality of activated single colonies for PCR verification, selecting single colonies without a plasmid PCR verification target band, inoculating to RMF5 for glycerol sterilization after activation, and obtaining a strain F74-B - 。
Strain F74-B - Competent preparation:
and (3) selecting a proper amount of recombinant strain F74-B-glycerinum by using an inoculating loop, streaking on a non-resistant RMF5 solid culture medium plate, and inversely culturing at 30 ℃ for 2-3 days for activation to prepare competence, wherein the specific preparation method is the same as F74 competence preparation.
Strain F74-B - sacC overexpression of strain:
transfer of the over-expression plasmid 39P-Peno-sacC into F74-B - In the strain, the transformation method was the same as that of F74 competent cells. F74-B successfully transferred into 39P-Peno-sacC plasmid after selection by kanamycin resistance plate - The strain is activated and glycerolized for bacterial preservation, namely the recombinant strain F74-B - C+。
(7) Genome re-sequencing and glf editing plasmid construction method of strain F74
Genomic resequencing of strain F74:
activated strain F74 was inoculated into RMF15 fermentation medium, and the cells were collected by a refrigerated centrifuge at mid-log stage (4000 rpm,10min,4 ℃) and stored at-80℃and the treated cell samples were subjected to genome re-sequencing by the Biotechnology Co., ltd. In Suzhou Jin Weizhi.
Editing plasmid pL2R-glf wt Is constructed and transformed:
construction of the editing plasmid pL2R-glf wt For glf in mutant F74 G99S Single base mutation was performed to reverse the mutation to wild type glf. Selecting a PAM site from the vicinity of the glf mutation site of the mutant strain F74, designing primers (the sequences are shown as SEQ ID NO.17, the primers are shown as glf-gRNA-F, the primers are shown as SEQ ID NO.18 and glf-gRNA-R, the primers are shown as SEQ ID NO. 19), obtaining fragment gRNA-glf by annealing the primers in a self-ligating mode, constructing the gRNA-glf into a plasmid pL2R, simultaneously designing the primers by taking a DNA fragment with equal length adjacent to the selected PAM site as a homology arm, obtaining a glf homology arm DNA fragment Up_stream-glf (the sequences are shown as SEQ ID NO.20, the amplified primers are shown as glf-US-F, SEQ ID NO.21, glf-US-R, SEQ ID NO. 22) and the amplified primers are shown as glf-DS-F, the primers are shown as SEQ ID NO.24, and integrating the primers into the plasmid pL2 after the sequence is integrated into the plasmid pL 2. The construction method is shown in fig. 6.
Primers were designed (restriction sites or homology arms are underlined).
gaaagccggttttggtgctgcgttaaccgaaaaatt of glf-gRNA-F, SEQ ID NO.18
gaacaatttttcggttaacgcagcaccaaaaccggc glf-gRNA-R, SEQ ID NO.19
Glf-US-F accagctcaccgtcttaatcgtagatgatcgacgcaaatattg, SEQ ID NO.21
Glf-US-R gcaccaaaactggcagcgacgaaacaaatggaactc, SEQ ID NO.22
gccagttttggtgctgcgttaac of glf-DS-F, SEQ ID NO.24
Agatctgatatcactaaagcaaacaaacctgcgctgcttttg glf-DS-R, SEQ ID NO.25
Construction of plasmid and strain transformation method, construction method of plasmid pL 2R-delta sacB and strain F74-B - The transformation method is the same. Obtaining the strain F74-glf after transformation and editing wt 。
(8) Detection of levan
Since levan produced by zymomonas mobilis during sucrose metabolism has different polymerization degrees, the levan cannot be quantitatively detected through high performance liquid chromatography, and the invention uses an acidolysis method to detect the content of fructose in levan so as to estimate levan. F74, F74-B as shown in FIG. 7 - F74-B - C + Seed solutions of the three strains were inoculated into a fermentation medium RMS15, respectively, 5mL of the culture solution was collected after culturing at 30℃until the stationary phase, centrifuged (4000 rpm,10 min) and the supernatant was retained; adding 75% ethanol into the supernatant to precipitate levan, centrifuging (4000 rpm,10 min) the system again, and collecting the precipitated levan; 5mL of 0.1M hydrochloric acid was added to the precipitate and the system was subjected to hydrolysis at a high temperature of 100deg.C; and finally, detecting the content of fructose in the levan hydrolysate by using high performance liquid chromatography.
The foregoing is merely a preferred embodiment of the present application, but the scope of the present application is not limited thereto, and any changes or substitutions easily contemplated by those skilled in the art within the technical scope of the present application should be covered by the scope of the present application.

Claims (10)

1. The strain is zymomonas mobilis F74 which knocks out sacB genes and realizes overexpression of sacC genes; wherein the zymomonas mobilis F74 strain is a strain obtained by performing fructose gradient domestication on zymomonas mobilis8 b.
2. The zymomonas mobilis of claim 1, wherein the zymomonas mobilis F74 strain is missense mutated at codon 99 of the glf gene relative to the zymomonas mobilis8b strain.
3. The zymomonas mobilis of claim 1, wherein the strain is fermentable by a medium comprising fructose and/or molasses to a fermentation broth having a concentration of not less than 30g/l ethanol, optionally a fermentation broth of not less than 40g/l ethanol, optionally a fermentation broth of not less than 50g/l ethanol, optionally a fermentation broth of not less than 60g/l ethanol;
the glucose content in the fermentation broth is not higher than 10g/l, optionally not higher than 5g/l, optionally not higher than 2g/l, optionally not higher than 1g/l, optionally not higher than 0.5g/l, optionally not higher than 0.1g/l;
the fructose content in the fermentation broth is not higher than 10g/l, optionally not higher than 5g/l, optionally not higher than 2g/l, optionally not higher than 1g/l, optionally not higher than 0.5g/l, optionally not higher than 0.1g/l;
the levan content in the fermentation broth is not higher than 30g/l, optionally not higher than 10g/l, optionally not higher than 2g/l, optionally not higher than 1g/l, optionally not higher than 0.5g/l, optionally not higher than 0.1g/l.
4. A method of constructing a zymomonas mobilis strain according to any one of claims 1 to 3, comprising:
inoculating the zymomonas mobilis strain 8b into a culture medium containing fructose with gradient concentration for subculturing and domestication;
transferring the domesticated strain into a gene editing plasmid for knocking out sacB genes, subculturing, and selecting a first positive clone;
transferring the expression plasmid for over-expressing sacC gene into the first positive clone and subculturing, and selecting a second positive clone.
5. The method according to claim 4, wherein the fructose medium comprises a fructose concentration gradient of: 20g/L, 50g/L, 100g/L and 150g/L.
6. The construction method according to claim 4, wherein the gene editing plasmid carries a CRISPR expression cluster consisting of a donor sequence, a leader sequence, a repeat sequence and a guide sequence, and the nucleotide sequences of the donor sequence, the leader sequence, the repeat sequence and the guide sequence are shown in SEQ ID nos. 1 to 4 in sequence.
7. The construction method according to claim 4, wherein the expression plasmid carries an operator sequence consisting of a Peno promoter and a sacC sequence, wherein the nucleotide sequences of Peno and sacC are shown in SEQ ID NO. 5-6.
8. A method of fermenting molasses, the method comprising: inoculating the zymomonas mobilis strain according to any one of claims 1-3 into a fermentation medium containing molasses for cultivation.
9. A method of producing ethanol, the method comprising:
inoculating the zymomonas mobilis strain according to any one of claims 1-3 into a fermentation medium containing molasses for cultivation; and
ethanol is harvested from the fermentation broth.
10. Use of a zymomonas mobilis strain according to any one of claims 1-3 in fructose fermentation, molasses fermentation and ethanol production.
CN202310298017.9A 2023-03-24 2023-03-24 Ethanol-producing zymomonas mobilis and application thereof Pending CN116496965A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310298017.9A CN116496965A (en) 2023-03-24 2023-03-24 Ethanol-producing zymomonas mobilis and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310298017.9A CN116496965A (en) 2023-03-24 2023-03-24 Ethanol-producing zymomonas mobilis and application thereof

Publications (1)

Publication Number Publication Date
CN116496965A true CN116496965A (en) 2023-07-28

Family

ID=87315736

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310298017.9A Pending CN116496965A (en) 2023-03-24 2023-03-24 Ethanol-producing zymomonas mobilis and application thereof

Country Status (1)

Country Link
CN (1) CN116496965A (en)

Similar Documents

Publication Publication Date Title
ES2599579T3 (en) Zymomonas with improved arabinose utilization
CN110106206B (en) Corynebacterium glutamicum construction method for improving yield and stability of L-lysine
CN106995817B (en) Construction of high concentration CO resistance by using gene of coding chloroplast carbonic anhydrase2Application of industrial engineering microalgae capable of rapidly growing
CN115806922A (en) Genetically engineered strain of zymomonas mobilis and application thereof
CN107937296B (en) Recombinant saccharomyces cerevisiae with acetic acid, furfural and vanillin tolerance, and preparation method and application thereof
CN103966249B (en) A kind of carrier and application thereof for building without screening label cyanobacteria
CN109706104B (en) Application of sll0528 gene in improvement of ethanol tolerance of synechocystis PCC6803
CN116496965A (en) Ethanol-producing zymomonas mobilis and application thereof
CN115927432A (en) Construction method and application of corynebacterium glutamicum engineering bacteria producing L-amino acid
CN116926092A (en) Pantothenate kinase gene RkPank and application thereof
CN114525215A (en) Recombinant strain for producing terpenoid, construction method thereof, method for producing terpenoid through fermentation and application of recombinant strain
CN109370969B (en) Application of recombinant Klebsiella in preparation of 1, 3-propylene glycol
CN110029081B (en) Engineering bacterium for over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof
CN116515724B (en) Zymomonas mobilis utilizing inorganic nitrogen source, application and nitrogen metabolism regulation gene
CN114015634B (en) Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof
CN109370972A (en) A kind of acetobacter engineering bacteria and its application
CN116042666B (en) Overexpression genes galK, galT and engineering bacteria thereof
CN116716321B (en) Application of HMX1 and encoding gene thereof in improving fermentation performance and acetic acid tolerance of saccharomyces cerevisiae xylose
CN114774421B (en) Mutant of endogenous promoter of zymomonas mobilis
CN116426448B (en) Visualized zymomonas mobilis, construction method and application
CN115851563B (en) Engineering bacterium for electrosynthesis of 3-hydroxybutyric acid by fixing carbon dioxide and construction method
CN114606170B (en) CRISPR-Cas 9-based ergothioneine biosynthesis method and application
CN108676080B (en) Aureobasidium pullulans carbon response transcription factor Cat8, and recombinant expression vector and application thereof
CN115044525B (en) Method for improving oxidation resistance of corynebacteria by using Sigma factor
CN109762779B (en) Application of corynebacterium gene JNy31014 in improving L-lysine yield

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20230728

RJ01 Rejection of invention patent application after publication