CN116479151A - VNTR locus combination, primer pair combination, kit and method for genotyping lactobacillus plantarum - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to a VNTR locus combination, a primer pair combination, a kit and a method for genotyping lactobacillus plantarum. The VNTR locus combination provided by the invention comprises 4 VNTR loci, shows certain differentiation capacity in different isolates, can distinguish different isolates on agarose gel, and can be reserved for implementation of multiplex PCR. The 4 VNTR locus combinations can be used for efficiently and rapidly genotyping the lactobacillus plantarum, and the intra-species discrimination degree is high, so that the working efficiency of lactobacillus plantarum identification and typing is improved. The primer pair combination provided by the invention is designed according to the 200bp region flanking the VNTR site, and has good specificity. By utilizing the VNTR locus combination, the primer pair combination or the kit provided by the invention, the lactobacillus plantarum can be rapidly and effectively subjected to genotyping through multiplex PCR.

Description

VNTR locus combination, primer pair combination, kit and method for genotyping lactobacillus plantarum

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a VNTR locus combination, a primer pair combination, a kit and a method for genotyping lactobacillus plantarum.

Background

Lactobacillus plantarum has many health care effects, such as immunoregulation, pathogenic bacteria inhibition, serum cholesterol content reduction, intestinal flora balance maintenance, nutrient absorption promotion, lactose intolerance alleviation, tumor cell formation inhibition and the like. The probiotics have the characteristics of strain specificity in functionality and safety, and researches show that lactobacillus plantarum from different sources has different probiotics potentials and can generate different effects, so that the reliable and rapid lactobacillus plantarum identification method has positive significance for traceability analysis, strain screening, function prediction, safety evaluation, functional development, industrial application and deep research.

The accurate identification of strain level can adopt various phenotype or genotyping technologies, and the principle and effect of different genotyping methods are different. Multiple site variable number tandem repeat sequence analysis is a molecular typing technique that has been developed and rapidly applied in recent years. The variable number of tandem repeats (Variable Number of Tandem Repeats, VNTR), also known as the small satellite DNA sequence, consists of several tens of nucleotide repeats in tandem, usually 2 to 20 times. Each specific VNTR site consists of two parts, the core region and the flanking regions. The core region is a repeated sequence, the number of the repeated sequences is randomly variable, and the flanking regions are fragments which can be specifically identified by restriction enzymes. Different individuals appear to have identical flanking regions and different numbers of units are repeated in tandem. In general, the greater the number of core region repeats of a VNTR sequence, the greater the number of alleles and the greater the polymorphism. The multi-site variable number tandem repeat sequence analysis (multiple locus VNTRs analysis, MLVA) technology based on a plurality of VNTRs combines the RAPD technology and the AFLP technology, has the characteristics of high efficiency, convenience and the like of the RAPD technology, has the advantages of high reliability, high repeatability and the like of the AFLP technology, is mainly applied to epidemiology, phylogenetic development and the like at present, and is particularly widely applied to evolution research. However, there is no precedent for the identification of lactic acid bacteria.

Disclosure of Invention

Aiming at the technical problems, the invention provides a VNTR locus combination, a primer pair combination, a kit and a method for genotyping lactobacillus plantarum. By utilizing the VNTR locus combination, the primer pair combination and the kit provided by the invention, the lactobacillus plantarum can be rapidly and effectively subjected to genotyping through multiplex PCR.

In order to achieve the aim of the invention, the invention adopts the following technical scheme:

in a first aspect, the invention provides a VNTR site combination for genotyping lactobacillus plantarum, comprising a VNTR site with a sequence shown as SEQ ID NO.1, a VNTR site with a sequence shown as SEQ ID NO.2, a VNTR site with a sequence shown as SEQ ID NO.3, and a VNTR site with a sequence shown as SEQ ID NO. 4.

Wherein the sequence of SEQ ID NO.1 is:

GCAGTACCATTGCCATCTGGTTTAGTTGTCGTGCTACCATTTTCATCCGGC TTAACG；

the sequence of SEQ ID NO.2 is:

CCCACGGAAGTATTTGAGCCCACTGACCCAAGCTTAGCAGCGTCGGCAGC CGCCATAAATGCGCCTAGCGCGGTAAGCTCGGCAATATCGGCAGGC；

the sequence of SEQ ID NO.3 is:

ACGTCGGCCGCTAGCCAAAGCAGTACTAGTCAAGCCAGTGCTAGTTCAGT CACTAGTACGACGAGCCAGAGTGCA；

the sequence of SEQ ID NO.4 is:

AACCGGAAGAACCGGGGCAACCTGAGCAACCAAGTC。

during DNA replication, the region where the VNTR sequence is present undergoes relative sliding, the so-called "slide mismatch", due to the occurrence of local melting, resulting in the generation of polymorphisms. The invention develops a novel MLVA molecular typing method based on the variable number of tandem repeat sequences for the first time, selects a plurality of different VNTR sites, and realizes the typing of lactobacillus plantarum strains according to different sequence repeat numbers of different sites in different strains. The VNTR sites described above were obtained from unpublished lactobacillus plantarum genome data. Through testing by different lactobacillus plantarum strains, the VNTR locus shows certain differentiation capacity in different isolates, can generate specific amplicons, has certain differentiation, can distinguish different isolates on agarose gel, and can be reserved for the implementation of multiplex PCR; the VNTR locus has shorter repeat unit length, higher repeat number and higher conservation degree between repeated sequences compared with other tandem repeat loci by taking the maximized polymorphism as a standard.

In a second aspect, the invention provides a primer pair combination for genotyping lactobacillus plantarum, comprising a primer pair consisting of an upstream primer shown in SEQ ID No.5 and a downstream primer shown in SEQ ID No.6, a primer pair consisting of an upstream primer shown in SEQ ID No.7 and a downstream primer shown in SEQ ID No.8, a primer pair consisting of an upstream primer shown in SEQ ID No.9 and a downstream primer shown in SEQ ID No.10, and a primer pair consisting of an upstream primer shown in SEQ ID No.11 and a downstream primer shown in SEQ ID No. 12.

Wherein the sequence of SEQ ID NO.5 is: 5'-ATGCTTGTCGGGTTTGACAG-3'; the sequence of SEQ ID NO.6 is: 5'-ACGGTACAGAAGTGCTTGTG-3';

the sequence of SEQ ID NO.7 is: 5'-ACAGACCGGCAGTGATTC-3'; the sequence of SEQ ID NO.8 is: 5'-CAGCAGCCGCATTAACAG-3';

the sequence of SEQ ID NO.9 is: 5'-TCAGCCGTTAGCCAGAGCAG-3'; the sequence of SEQ ID NO.10 is: 5'-CTTGGCAGCAGCCTCAGATG-3';

the sequence of SEQ ID NO.11 is: 5'-CTGCCGATCAGGTTATAGTG-3'; the sequence of SEQ ID NO.12 is: 5'-TGACGTCCGTGATTGTTC-3'.

The primer is a specific amplification primer designed on the 200bp side of the VNTR site according to the sequence of the VNTR site. The GC content and nucleotide distribution of the primers can avoid the serial arrangement of more than 5 purine or pyrimidine nucleotides, thereby avoiding the formation of non-specific bands caused by the complementation of the two primers.

And, the invention also provides a kit for genotyping lactobacillus plantarum, which comprises the primer pair consisting of the upstream primer shown in SEQ ID No.5 and the downstream primer shown in SEQ ID No.6, the primer pair consisting of the upstream primer shown in SEQ ID No.7 and the downstream primer shown in SEQ ID No.8, the primer pair consisting of the upstream primer shown in SEQ ID No.9 and the downstream primer shown in SEQ ID No.10, and the primer pair consisting of the upstream primer shown in SEQ ID No.11 and the downstream primer shown in SEQ ID No. 12.

Preferably, the kit further comprises Taq DNA polymerase, dNTPs, mgCl ₂ The PCR reaction buffer, the PCR reaction enhancer, the optimizing agent and the stabilizing agent. The above reagents may be selected from commercially available reagents for PCR amplification, such as 2X Taq PCR MasterMix in which the above reagents are collected.

The embodiment of the invention also provides a lactobacillus plantarum genotyping method, which uses the primer pair to amplify and analyze lactobacillus plantarum through multiplex PCR so as to distinguish the genotypes of the lactobacillus plantarum to be detected.

Preferably, the method specifically comprises the steps of:

s1, extracting genome DNA of lactobacillus plantarum to be detected, and taking the genome DNA as template DNA for multiplex PCR amplification;

s2, performing multiplex PCR amplification by using the primer pair to obtain an amplification product; the amplified products were analyzed using 1.5% agarose gel imaging, and different lactobacillus plantarum strains were judged and distinguished from different sets of band positions.

Preferably, the reaction system of the PCR amplification is:

the amplification reaction procedure was: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 58℃for 30s, elongation at 72℃for 1min,30 cycles; extending at 72 ℃ for 10min; preserving at 4 ℃.

Preferably, the concentration of the agarose gel in S2 is 15g/L.

The invention has the beneficial effects that:

the VNTR locus provided by the invention has certain differentiation capacity on different isolates, and can realize the typing of lactobacillus plantarum through multiple PCR; compared with other tandem repeat loci, the tandem repeat locus has shorter repeat unit length, higher repeat number and higher conservation degree between the repeat sequences. The 4 VNTR loci can be used for efficiently and rapidly genotyping the lactobacillus plantarum, and the degree of intra-species differentiation is high, so that the working efficiency of lactobacillus plantarum identification and typing is improved, and the deep research of lactobacillus is facilitated. The primer pair combination provided by the invention is designed aiming at the 200bp region flanking the VNTR site, has good specificity and can avoid forming a nonspecific band. The primer pair is used for multiplex PCR amplification, so that genotypes of different lactobacillus plantarum can be identified.

Drawings

FIG. 1 shows the results of gel electrophoresis imaging of the multiple PCR amplification products of 14 Lactobacillus plantarum strains of example 3 of the present invention; lanes 1 and 17 are D2000DNA markers, lane 2 is a negative control, and lanes 3-16 are gel electrophoresis bands of multiple PCR amplification products of 14 Lactobacillus plantarum;

FIG. 2 is a dendrogram of 14 Lactobacillus plantarum strains in example 3 of the present invention.

Detailed Description

The present invention will be described in further detail with reference to specific embodiments in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

The lactobacillus plantarum has a plurality of health care effects, and lactobacillus plantarum from different sources has different probiotics potential and can generate different effects, so that the reliable and rapid lactobacillus plantarum identification method is constructed and has positive significance for development, application and deep research.

Aiming at the problem, the invention provides the polymorphism of the variable tandem repeat sequences in different strains for the first time to type the lactobacillus plantarum so as to distinguish different lactobacillus plantarum strains and realize rapid identification work. In order to obtain VNTR sites which can be used for genotyping lactobacillus plantarum, firstly, the VNTR sites which can be used for analysis on agarose gel are identified in unpublished lactobacillus plantarum genome data, the VNTR sites are initially screened according to the general principle of the VNTR sites, the VNTR sites comprise sites with the size exceeding 20bp or the copy number exceeding 2 units, further, the VNTR sites show different copy numbers in different strains according to the VNTR sites, then specific amplification primers of tandem repeat loci are designed for each site, the differentiation capacity of the loci is detected by using different lactobacillus plantarum isolates, and finally four tandem repeat loci with shorter repeat unit length, higher repeat number and higher conservation degree among the repeat sequences, namely VNTR sites with the sequence shown as SEQ ID No.1, VNTR sites with the sequence shown as SEQ ID No.2, VNTR sites with the sequence shown as SEQ ID No.3 and VNTR sites with the sequence shown as SEQ ID No.4 are screened. The tandem repeat loci have different copy numbers in at least two genomes, have certain differentiation capacity on different isolates, generate specific amplicons in different isolates and have certain difference, and can realize the typing of lactobacillus plantarum through multiplex PCR.

The invention also provides a specific amplification primer of the VNTR locus. Each specific VNTR site consists of two parts, the core region and the flanking region, different individuals appear as flanking regions being identical and the number of tandem repeat units being different. The primers provided by the invention are designed for the 200bp flanking region of the VNTR locus, namely a primer pair consisting of an upstream primer shown in SEQ ID NO.5 and a downstream primer shown in SEQ ID NO.6, a primer pair consisting of an upstream primer shown in SEQ ID NO.7 and a downstream primer shown in SEQ ID NO.8, a primer pair consisting of an upstream primer shown in SEQ ID NO.9 and a downstream primer shown in SEQ ID NO.10, and a primer pair consisting of an upstream primer shown in SEQ ID NO.11 and a downstream primer shown in SEQ ID NO. 12. The primer pair meets the requirement of the PCR amplification pair primer, and can be used for PCR amplification programs.

The invention is illustrated by the following specific examples.

Unless otherwise indicated, all technical means used in the following examples are conventional means well known to those skilled in the art, and materials, reagents and the like used in the following examples are commercially available.

Example 1

The embodiment of the invention provides a primer pair combination for identifying the genotype of lactobacillus plantarum, wherein each primer pair is designed aiming at a VNTR site with a sequence shown as SEQ ID NO.1, a VNTR site with a sequence shown as SEQ ID NO.2, a VNTR site with a sequence shown as SEQ ID NO.3 and a VNTR site with a sequence shown as SEQ ID NO.4, and the specific sequence and the corresponding VNTR site are shown in table 1.

TABLE 1VNTR sites and corresponding primers

Example 2

The embodiment of the invention provides a kit for identifying the genotype of lactobacillus plantarum, which specifically comprises the following components:

(1) A primer pair consisting of an upstream primer shown in SEQ ID No.5 and a downstream primer shown in SEQ ID No.6, a primer pair consisting of an upstream primer shown in SEQ ID No.7 and a downstream primer shown in SEQ ID No.8, a primer pair consisting of an upstream primer shown in SEQ ID No.9 and a downstream primer shown in SEQ ID No.10, and a primer pair consisting of an upstream primer shown in SEQ ID No.11 and a downstream primer shown in SEQ ID No. 12;

(2) Template DNA,2 x Taq PCR MasterMix.

Example 3

The embodiment of the invention provides a method for genotyping lactobacillus plantarum by utilizing multiplex PCR based on a variable number of tandem repeats, and the primer pair combination provided in the embodiment 1 is used for detecting the genotype of a lactobacillus plantarum test strain.

1. Preparation of test strain of Lactobacillus plantarum

14 Lactobacillus plantarum isolates were inoculated onto MRS solid medium, cultured at 37℃for 48h, repeatedly purified using streak isolation, obtained single colony cells, and inoculated into MRS broth, cultured at 37℃for 48h for genomic DNA extraction.

The MRS solid culture medium consists of the following components in percentage by mass: glucose 2%, peptone 1%, beef extract 1%, yeast extract 0.5%, sodium acetate 0.5%, tween 80 0.1%, hydrogen diamine citrate 0.1%, magnesium sulfate 0.02%, manganese sulfate 0.005%, agar powder 1.5%, and distilled water in balance.

2. Genomic DNA extraction

Extracting genome DNA of a lactobacillus plantarum test strain by using phenol and chloroform:

firstly, taking 2mL of MRS overnight culture solution (37 ℃ C., 48 h) and centrifuging at 10000rpm for 2min, removing supernatant, suspending sediment in 250 mu L of SET buffer, transferring to a 2mL grinding tube, adding a proper amount of grinding beads, and freezing and crushing cells in a freeze-grinding instrument (20 m/s, working for 60s, interval 120s, repeating for 3 times); after centrifugation at 6000rpm for 10min, accurately transferring the supernatant to a new 2mL centrifuge tube, adding 2.5 mu L lysozyme (100 mg/mL) and 10 mu L RNase (10 mg/mL), mixing the mixture upside down, and incubating at 37 ℃ for 30min; then 7.5. Mu.L of protease K (20 mg/mL) and 20. Mu.L of SDS (10%) are added and mixed reversely, and incubated for 30min at 55 ℃; after the incubation, 750 μl of SET buffer, 600 μl of phenol, was added: chloroform: isoamyl alcohol mixed solution (25:24:1, v/v/v), mixing the mixture upside down, standing the mixture at room temperature for 15min, centrifuging the mixture at 10000rpm for 5min, and accurately transferring an upper layer of water into a new 2mL centrifuge tube; this operation was repeated twice; to the aqueous layer solution obtained was added 500. Mu.L of chloroform: isoamyl alcohol mixed solution (24:1, v/v), centrifuging at 10000rpm for 5min, and accurately transferring the upper layer water layer to a new 2mL centrifuge tube; adding 10% (v/v) sodium acetate solution (3M), mixing, standing for 2min, adding 66% isopropanol (v/v), mixing, standing for 15min, and waiting for DNA precipitation; centrifuging at 10000rpm for 10min, and discarding supernatant; washing the precipitate particles with 80% ethanol for 3 times, discarding supernatant, and air drying; add 50. Mu.L TE buffer or deionized water to dissolve DNA and incubate at 55℃for 15min. All the above centrifugation conditions were carried out at 4 ℃.

The amount and quality of the separated DNA were detected using a micro ultraviolet spectrophotometer at 230nm, 260nm and 280nm. The non-fragmented DNA sample is DNA with molecular weight of about 1 mug, the concentration is between 20 ng/. Mu.L and 50 ng/. Mu.L, the OD 260/280 ratio is between 1.8 and 2.0, and the OD 260/230 ratio is higher than 1.5. Verification was performed on 1% agarose gels, with DNA being a high molecular fragment of greater than 5 kb. The extracted DNA was used as a template DNA.

3. Multiplex PCR amplification

MLVA typing of the lactobacillus plantarum test strain is detected by multiplex PCR amplification. The extracted genomic DNA is diluted by deionized water, so that the concentration of the DNA template for multiplex PCR amplification of all the isolates is ensured to be the same.

The PCR reaction used a 50. Mu.L system: 1. Mu.L of template DNA (10 ng), 1. Mu.L of forward primer (final concentration of 0.2. Mu.M), 1. Mu.L of reverse primer (final concentration of 0.2. Mu.M), 2X Taq PCR MasterMix. Mu.L, H were added to each VNTR site ₂ O was added to 50. Mu.L.

The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 58℃for 30s, elongation at 72℃for 1min,30 cycles; extending at 72 ℃ for 10min;4 ℃ and infinity.

4. Lactobacillus plantarum MLVA genotyping

Amplification products from multiplex PCR were resolved on 1.5% (w/vol) agarose gel. D2000DNAMarker was used as a DNA molecular weight marker and normalization reference. Images obtained from the gel were further analyzed on molecular evolution genetic analysis software (MEGA) and a dendrogram was generated.

The experimental results show that the established multiplex PCR is used for genotyping the lactobacillus plantarum from different samples, the typing results are shown in figure 1, and the gel ultraviolet imaging shows the separation results. The images were further analyzed in molecular evolution genetic analysis software (MEGA) and a dendrogram was generated as shown in fig. 2. 14 lactobacillus plantarum are divided into 7 genotypes, and the first 5 lactobacillus plantarum are similar in sources and all come from Xinjiang traditional fermented milk and are divided into a genotype A;3-1 is classified into genotype B;6-1 is classified into genotype C; CZ-13, XQ-18 and XQ-22 are identified as a genotype D, and are all derived from the yogurt of the herdsman; d13, D19, D20 are derived from inner mongolia fermented dairy products, divided into genotypes E and F; WCFS1 was identified as genotype G.

The above results demonstrate that the VNTR combinations provided by the present invention have good typing capabilities, and also demonstrate that there is a significant correlation between MLVA genotypes and isolated geographical areas.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, or alternatives falling within the spirit and principles of the invention.

Claims (8)

1. A VNTR locus combination for genotyping lactobacillus plantarum is characterized by comprising a VNTR locus with a sequence shown as SEQ ID NO.1, a VNTR locus with a sequence shown as SEQ ID NO.2, a VNTR locus with a sequence shown as SEQ ID NO.3 and a VNTR locus with a sequence shown as SEQ ID NO. 2.

2. A primer pair combination for genotyping lactobacillus plantarum, comprising a primer pair consisting of an upstream primer shown in SEQ ID No.5 and a downstream primer shown in SEQ ID No.6, a primer pair consisting of an upstream primer shown in SEQ ID No.7 and a downstream primer shown in SEQ ID No.8, a primer pair consisting of an upstream primer shown in SEQ ID No.9 and a downstream primer shown in SEQ ID No.10, and a primer pair consisting of an upstream primer shown in SEQ ID No.11 and a downstream primer shown in SEQ ID No. 12.

3. A kit for genotyping lactobacillus plantarum, characterized in that the kit comprises the above primer pair consisting of the upstream primer shown in SEQ ID No.5 and the downstream primer shown in SEQ ID No.6, the primer pair consisting of the upstream primer shown in SEQ ID No.7 and the downstream primer shown in SEQ ID No.8, the primer pair consisting of the upstream primer shown in SEQ ID No.9 and the downstream primer shown in SEQ ID No.10, and the primer pair consisting of the upstream primer shown in SEQ ID No.11 and the downstream primer shown in SEQ ID No. 12.

4. A kit for genotyping lactobacillus plantarum according to claim 3, further comprising Taq DNA polymerase, dNTPs, mgCl ₂ The PCR reaction buffer, the PCR reaction enhancer, the optimizing agent and the stabilizing agent.

5. A method for genotyping Lactobacillus plantarum, characterized in that the primer pair of claim 2 is used for amplifying and analyzing Lactobacillus plantarum by multiplex PCR, thereby distinguishing the genotype of the Lactobacillus plantarum to be tested.

6. The method for genotyping lactobacillus plantarum according to claim 5, comprising the following steps:

s1, extracting genome DNA of lactobacillus plantarum to be detected, and taking the genome DNA as template DNA for multiplex PCR amplification;

s2, carrying out multiplex PCR amplification by using the primer pair, and analyzing an amplification product by using 1.5% agarose gel imaging, and judging and distinguishing different lactobacillus plantarum strains according to different band position sets.

7. The method for genotyping lactobacillus plantarum according to claim 6, wherein the reaction system of the PCR amplification is:

8. the method for genotyping lactobacillus plantarum according to claim 7, wherein the reaction system of the PCR amplification is:

the amplification reaction procedure was: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 58℃for 30s, elongation at 72℃for 1min,30 cycles; extending at 72 ℃ for 10min; preserving at 4 ℃.