CN116479030A

CN116479030A - Construction and application of Bradyyeast expressing erythromycin degrading enzyme EreA

Info

Publication number: CN116479030A
Application number: CN202310255631.7A
Authority: CN
Inventors: 孙坚; 贺骞; 林卓宇; 张晓净; 廖晓萍; 刘雅红
Original assignee: Guangdong Provincial Laboratory Of Lingnan Modern Agricultural Science And Technology; South China Agricultural University
Current assignee: Guangdong Provincial Laboratory Of Lingnan Modern Agricultural Science And Technology; South China Agricultural University
Priority date: 2023-03-16
Filing date: 2023-03-16
Publication date: 2023-07-25

Abstract

The invention is thatBelongs to the technical field of genetic engineering, and in particular discloses construction and application of a Bradyyeast expressing erythromycin degrading enzyme EreA. The invention firstly constructs uracil auxotroph strain S.boulardii/URA3 ^‑/‑ Inserting the optimized opera gene into plasmid pURA containing URA3 gene, extracting positive transformant plasmid and transferring to S.boulderi/URA 3 ^‑/‑ Competent, and obtaining engineering probiotic yeast with high-level expression by comparing chromosome and plasmid-mediated engineering yeast expression level screening. The engineering yeast can efficiently express erythromycin degrading enzyme EreA, has biological functions and has efficient degradation effect on erythromycin in vivo and in vitro. The use of the engineering yeast can not influence the distribution of erythromycin in tissues and blood plasma, has no influence on the systemic treatment effect, and prevents the leakage of a clinically important drug-resistant gene ereA.

Description

Construction and application of Bradyyeast expressing erythromycin degrading enzyme EreA

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to construction and application of a Bradyyeast expressing erythromycin degrading enzyme EreA.

Background

The first antibiotic, penicillin, was discovered since 1928, alexander Fleming, and it became an irreplaceable medical product for humans and animals. One survey predicts that global antibiotic consumption will increase by 67.0% from 63151 ±1560 tons (2010) to 105596 ±3605 tons (2030). Veterinary gazettes in China 2020 and 2021 show that the national macrolide antibiotics consume 3020.05 and 3266.309 tons in 2019 and 2020 respectively, accounting for 9.77% and 9.97% of the total annual antibiotic consumption, and are in the fourth two years in succession. Among them, erythromycin is one of the most widely used macrolide antibiotics, and is a persistent contaminant due to its persistence in the environment. Erythromycin is widely used as a growth promoter in livestock, and is metabolically absorbed in the small intestine, and the remaining erythromycin is excreted in the body with feces as it is, with about half of the oral erythromycin excreted into the feces at a dose of 20 mg/kg. Thus, animal waste is one of the major sources of antibiotic contamination in the environment. Medicaments and personal care products (Pharmaceutical andPersonal Care Products, PPCPs) are defined as an emerging class of environmental pollutants that are of great importance for the elimination of erythromycin in the environment because of their inherent harm to the human body's metabolic impact at low doses.

The existing antibiotic elimination methods are divided into biological elimination and non-biological elimination, wherein most of the two methods are methods for eliminating antibiotics in the environment and almost no source is used for eliminating antibiotic residues. Minrui Liu et al J Hazard Mater.2020Apr15,388:122032 discloses a method for reducing antibiotic residues in animal faeces by expressing erythromycin esterase in E.coli as a host bacterium. However, to our knowledge, bacteria have biological safety risks as host bacteria for surface expression of ereA. And the selection pressure of the positive transformant is antibiotic, so that plasmid loss caused by separation or structural instability can be avoided. However, the use of antibiotic resistance as a selectable marker requires the supply of antibiotics throughout the culture device, which is costly.

Yeast has received increasing attention in recent years as a tool for expressing recombinant proteins. The s.board ii probiotic product has been marketed worldwide and has good efficacy in the prevention and treatment of antibiotic-associated diarrhea, traveler's diarrhea, HIV/AIDS-associated diarrhea, pediatric acute gastroenteritis and repeated infection with clostridium difficile, etc., with few reported adverse reactions such as bacteremia. In view of its excellent probiotic effect, more and more foreign companies use buddyyeast in dietary supplements. In addition, food new entry Shen Zi (2017) number 0001 in the national guard committee new food material management in 2017 of China has also begun to accept s.board ii as a declaration of new food material. There is no report on the current study of expressing the erythromycin degrading enzyme EreA using S.boulardii.

Disclosure of Invention

Aiming at the defects existing in the prior art, the invention provides a probiotics S.boulardii which can realize in-situ degradation of erythromycin in intestinal tracts. The invention mainly aims at source elimination of antibiotics, takes S.board ii as host bacteria for expressing ereA, can realize elimination of source (intestinal tract) of erythromycin residue while exerting original probiotic function, and maximally avoids erythromycin from flowing into surrounding environment. On the other hand, the defect of the traditional genetic engineering bacteria can be avoided, and the leakage risk of the clinical important drug-resistant gene ereA is avoided.

The primary aim of the invention is to provide an engineering probiotic S.board ii expressing erythromycin degrading enzyme EreA.

The second object of the invention is to provide a method for constructing engineering probiotics S.boulardii expressing erythromycin degrading enzyme EreA.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

an engineering probiotics S.board ii for expressing erythromycin degrading enzyme EreA, the construction method comprises the following steps:

s1 construction of Uracil (Uracil) auxotrophic Strain S.boulardii/URA3 ^-/- ；

S2, inserting the OPEREA-carrying gene into a plasmid pURA containing URA3 genes, and constructing and extracting positive transformant plasmids;

s3, transforming the positive transformant plasmid extracted in the step S2 into Uracil (Uracil) auxotrophic strain S.boulderi/URA 3 described in the step S1 ^-/- And in the prepared competence, the conversion solution is coated on a culture medium to obtain EreA engineering probiotics expressing erythromycin degrading enzyme through screening.

In our earlier experiments, it was found that plasmids showing resistance to transfer into yeast, even though antibiotics were used to apply additional pressure, the plasmids marked with antibiotics still appeared to be easily lost with increasing cell density during the culture in the later stage of the culture, which severely affected the screening efficiency of positive transformants. Therefore, uracil (Uracil) is selected as a screening marker, the original bacterium URA3 gene is knocked out, and plasmids containing the URA3 gene are transferred into the strain, so that as long as the bacteria losing the plasmids die because Uracil cannot be synthesized, the surviving strains are all strains containing the plasmids, the plasmid carrying rate in living bacteria is improved, and the expression level can be improved.

In order to furthest improve the expression quantity of the erythromycin degrading enzyme EreA, the optimized codon sequence is used for expression, and the OPeA gene is the EreA with the optimized sequence and has a nucleotide sequence shown as SEQ ID NO. 1.

Preferably, in order to stably express the degrading enzyme, the Uracil (Uracil) auxotrophic s.boulderi strain described in step S1 is constructed by: the gene is obtained by constructing a homology arm selected from G418 resistance (Kan) and Zeocin resistance (ble) resistance genes, inserting the homology arms one by one to replace the homology arm on URA3 on S.boulderi chromosome, and removing the resistance genes by using a LoxP/Cre recombinase system.

The invention relates to a Uracil (Uracil) auxotroph strain S.boulderi/URA 3 described in step S1 ^-/- Verifying whether the construction is successful or not, and verifying the URA3 gene deletion phenotype by culturing for 2 days at 37 ℃ on YPD medium, SD/-Ura medium and 5-FOA medium; the phenotype of Kan and ble gene insertion and deletion was confirmed by culturing on G418 YPD medium, zeocin-containing YPD medium, G418-containing and Zeocin-containing medium at 37℃for 2 d.

S.boulder ii/URA3 in the present invention ^-/- Since deletion of URA3 gene was unable to grow on auxotrophic medium lacking Uracil (SD/-Ura medium), but could grow on medium supplemented with Uracil and 5-FOA (5-FOA medium), it was confirmed that the strain URA3 gene was knocked out. S.Board ii/URA3 ^-/- Growth on each plate was not possible due to lack of resistance. Successful construction of uracil auxotroph Yeast Strain S.boulardii/URA3 was demonstrated by both genotypic and phenotypic verification ^-/- 。

The invention respectively constructs plasmid and chromosome-mediated engineering probiotic yeast, compares the expression level of erythromycin degrading enzyme, and screens to obtain the engineering probiotic yeast with high-level expression of erythromycin degrading enzyme EreA.

The third object of the invention is to provide the application of the engineering probiotics S.boulardii in expressing erythromycin degrading enzyme EreA.

A fourth object of the present invention is to provide the use of the engineering probiotic s.boulderi described above for degrading erythromycin residues.

Preferably, the engineering probiotics S.boulardii can be applied to in-situ degradation of erythromycin residues in intestinal tracts in vivo.

Compared with the prior art, the invention has the beneficial effects that:

the optimized ereA gene is transferred into the probiotics S.boulardii for the first time, and the engineering probiotics yeast with high-level expression is obtained through comparing chromosome and plasmid-mediated engineering yeast expression level screening. As can be seen from in vitro microbial degradation experiments and in vivo animal experiments, the constructed engineering yeast S.boulardii/URA3 ^-/- The pURA-opera has biological function, has high-efficiency degradation effect on erythromycin in vivo and in vitro, and engineering bacteria cannot colonize in vivo due to probiotics, so that the original flora of intestinal tracts is prevented from being damaged. In addition, S.boulderi/URA 3 ^-/- Oral use of pURA-opera does not affect the distribution of erythromycin in tissues and plasma and therefore has no effect on systemic therapeutic effects; meanwhile, the defect of the traditional genetic engineering bacteria can be avoided, and the leakage risk of the clinical important drug-resistant gene ereA is avoided.

Drawings

FIG. 1 is uracil auxotroph yeast strain S.boulardii/URA3 ^-/- Is a schematic diagram of the construction of (a).

FIG. 2 is a gel electrophoresis chart of PCR products of Loxp-Kan/ble-Loxp inserts: m is 2000DNA mark; 1 is a Loxp-Kan-Loxp insert; 2 is Loxp-ble-Loxp insert; 3 is a negative control.

FIG. 3 shows the genotyping gel electrophoresis of S.boulardii WT, S.boularii #1, S.boularii #2 transformants: m is 2000DNA markers; a is S.boulder ii/URA3N-F, deltaURA 3-R primer pair; b is a S.boulderi/URA 3N-F, deltaKan-R primer pair; c is S.boulderi/URA 3N-F, deltable-R primer pair.

FIG. 4 is a S.boulderi/URA 3 ^-/- Gel electrophoresis diagram for verifying genotype of transformant: m is 2000DNA markers; a is S.boulder ii/URA3N-F, deltaURA 3-R primer pair; b is a S.boulderi/URA 3N-F, deltaKan-R primer pair; c is S.boularkii/URA 3N-F, deltable-R primer pair.

FIG. 5 is a S.boulderi/URA 3 ^-/- Loss of pPL5071_TEF1-cre_URA3 plasmid in transformant: m is 2000DNA markers; 1 is S.boulderi/URA 3 before serial passage ^-/- The method comprises the steps of carrying out a first treatment on the surface of the 2 is S.boulderi/URA 3 after serial passage ^-/- 。

FIG. 6 is S.boulder ii WT, S.boulder ii #1, S.boulder ii #2, S.boulder i/URA3 ^-/- And (5) phenotype verification.

FIG. 7 shows the results of protein immunoblotting of plasmid and chromosome-mediated EreA expressing strains: S.Board ii/URA3 ^-/- pURA-opera is a plasmid-mediated strain, S.boulderi/URA 3 ^-/- pZEURA-opera is a strain of chromosome-mediated expression.

FIG. 8 is a S.boulderi/URA 3 ^-/- Evaluation of the degradation effect of pURA-operaA on erythromycin in different in vitro media.

FIG. 9 is a S.boulderi/URA 3 ^-/- Evaluation of the degradation effect of pURA-opera on erythromycin in mice.

FIG. 10 is a S.boulderi/URA 3 ^-/- Effects of gastric lavage by pURA-opera on the concentration profile of erythromycin in plasma and tissues.

FIG. 11 is a S.boulderi/URA 3 ^-/- Binding transfer results of pURA-opera.

Detailed Description

The technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The test methods used in the embodiment of the invention are all conventional methods unless specified otherwise; the materials, reagents and the like used, unless otherwise specified, are those commercially available.

EXAMPLE 1 uracil auxotroph Yeast Strain S.boulardii/URA3 ^-/- Construction of (3)

By constructing homology arms with different resistances, inserting and replacing the homology arms one by one on alleles of URA3 on S.boulli chromosome (see figure 1), and removing double antibodies by using Cre-LoxP recombinase system to reach S.boulli/URA 3 ^-/- Is a construction of (3).

(1) Acquisition of Loxp-Kan/ble-Loxp insert

To obtain homology arms with G418 resistance (Kan) and Zeocin resistance (ble), PCR amplification was performed on plasmids pCEV-G4-Km and pCEV-G4-Ph using primers Loxp-F/R, respectively, with the following reaction system and conditions:

Loxp-F(5’-3’)：

ACCCAACTGCACAGAACAAAAACCTGCAGGAAACGAAGATAAATCTTGGATCA TGGTAGACAACCC；

Loxp-R(5’-3’)：

AATTTGTGAGTTTAGTATACATGCATTTACTTATAATACAGTTTTTCGCTCCTAG TGGATCTGATATC。

the underlined parts are the homologous parts at the left and right ends of the URA3 gene of the S.boulderi genome.

The PCR amplification system (50. Mu.L) was: 10. Mu.L of double pure water, 25. Mu.L of 2 XKOD Buffer, 10. Mu.L of dNTPs, 1.5. Mu.L of upstream primer, 1.5. Mu.L of downstream primer, 1. Mu.L of KOD enzyme and 1. Mu.L of template.

The reaction conditions for PCR amplification were: pre-denaturation at 94℃for 3min; denaturation at 98℃for 10s, annealing at 58℃for 30s, elongation at 68℃for 1min for 30s for 30 cycles; final extension at 68℃for 7min; preserving at 4 ℃.

After the PCR products are separated by 1.2% agarose gel electrophoresis, a band of 1595bp and 1172bp is respectively amplified, which meets the expected size (see figure 2).

(2) Insertion of Loxp-Kan/ble-Loxp fragment

YPD medium resuscitator laboratory stored s.board i (isolated from commercial pharmaceutical products) and s.board i competes with reference to the Coolabe saccharomyces cerevisiae competence preparation kit (PEG LiAc method) instructions.

Preparing a fragment conversion premix:

360. Mu.L of the premix was added to 1 100. Mu.L of S.board. Competent cells, and the mixture was repeatedly blown and mixed to thoroughly suspend the yeast cells in the premix. Incubating in a water bath at 30 ℃ for 30min, and mixing the materials uniformly after reversing every 10 min. 20 μl DMSO is added, heat-shocked in a water bath at 42deg.C for 20min, and mixed upside down every 10 min. Centrifuge at 12000rpm for 15s, discard supernatant. The bacterial pellet was resuspended in 1mL YPD LiquidMedium and shake cultured at 30℃with shaking at 180rpm for 1h. Centrifuge at 12000rpm for 15s, discard supernatant. The pellet was resuspended in 1mL of sterile deionized water, 100. Mu.L of the transformation solution was pipetted into YPD medium containing 0.2mg/mL G418 and incubated at 30℃for 3 days. Transformants were screened for genes using primers S.boulardii/URA3N-F, deltaURA 3-R, deltaKan-R, deltable-R. Three pairs of primer amplification were performed using single colonies of the wild type (S.boulli WT) and the transformant (S.boulli # 1) as templates, and the reaction system and conditions were as follows:

S.boulardii/URA3N-F(5’-3’)：AGGAAGAACGAAGGAAGGAGCAC

△URA3-R(5’-3’)：AATCTTTGTCGCTCTTCGCAATG

the PCR amplification system (50. Mu.L) was: double pure water 21. Mu.L, 2 XMix 25. Mu.L, upstream primer 2. Mu.L, downstream primer 2. Mu.L.

The reaction conditions for PCR amplification were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 15s, annealing at 62℃for 15s, extension at 72℃for 45s for 35 cycles; final extension at 72℃for 5min; preserving at 4 ℃.

S.boulardii/URA3N-F(5’-3’)：AGGAAGAACGAAGGAAGGAGCAC

△Kan-R(5’-3’)：ACGCGATCGCTGTTAAAAGGAC

The reaction conditions for PCR amplification were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 15s, annealing at 58℃for 15s, extension at 72℃for 1min for 35 cycles; final extension at 72℃for 5min; preserving at 4 ℃.

S.boulardii/URA3N-F(5’-3’)：AGGAAGAACGAAGGAAGGAGCAC

△ble-R(5’-3’)：AGCTGAACCAACTCGCGAGGGGATC

After the PCR products are separated by 1.2% agarose gel electrophoresis, the wild type can only amplify 666bp bands, and the S.boulderi #1 transformant can respectively amplify 666bp bands and 1023bp bands (see figure 3), so that the Loxp-Kan-Loxp is proved to be successfully inserted into one of the allele areas of URA3 on the chromosome.

The S.boulderi #1 transformant was picked up to prepare competent cells, loxp-ble-Loxp was transformed into the prepared competent cells in the same manner, and screening was performed on the S.boulderi #2 transformant on a double-plate using YPD medium containing 0.2mg/mL G418 and 0.05mg/mL Zeocin.

After the PCR products are separated by 1.2% agarose gel electrophoresis, the S.board#2 transformant is respectively amplified into bands of 782bp and 1023bp, and the band of 666bp is not amplified (see FIG. 3), which proves that Loxp-ble-Loxp is successfully inserted into another allele region of URA3 on the chromosome.

(3) Elimination of Loxp-Kan/ble-Loxp inserts

After the S.bouldeii #2 transformant is prepared into competent cells, the plasmid pPL5071_TEF1-cre_URA3 is transformed into competent cells by the same method, and Cre enzyme is introduced to achieve the aim of removing Kan/ble resistance. The transformation liquid is screened on SD/-Ura culture medium to obtain transformant S.boulardii/URA3 ^-/- 。

Picking transformants S.boulder ii/URA3 ^-/- Inoculated into 4ml of a blank YPD liquid medium at 30℃and 180rpm for 12 hours, 100. Mu.L of the culture medium was aspirated into a new 4ml of a blank YPD liquid medium, and the above operation was repeated 1 time. The culture after continuous culture was diluted and spread on a blank YPD plate, and after incubation at 30℃for 3d, the monoclonal strain was selected to verify whether pPL5071_TEF1-cre_URA3 was lost. The reaction system and conditions were as follows:

CreY-F(5’-3’)：TAACGCCAGGGTTTTCCCAGTCAC

CreY-R(5’-3’)：TCGACGACCTCCCATTGATATTTG

The reaction conditions for PCR amplification were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 15s, annealing at 60℃for 15s, extension at 72℃for 2min for a total of 35 cycles; final extension at 72℃for 5min; preserving at 4 ℃.

The double resistance genes (Kan, ble) and URA3 deletion were simultaneously confirmed using the three pairs of primers described above for the verification of transformants.

After the PCR products were separated by 1.2% agarose gel electrophoresis, none of the four pairs of specific primers amplified bands (see FIGS. 4 and 5) indicated at S.boulder ii/URA3 ^-/- In the transformant, the engineering plasmid pPL5071_TEF1-cre_URA3 is successfully lost through continuous passage after the Cre recombinase is expressed to delete the Kan and ble genes.

(4) Phenotype verification of Gene knockout Strain

Single colonies S.board ii WT, S.board ii#1, S.board ii#2, S.board ii/URA3 were picked up separately ^-/- Inoculated into 4mL of blank YPD liquid medium, cultured at 37℃and 180rpm overnight. 1mL of the overnight culture was aspirated, centrifuged at 5000rpm for 5min, the supernatant was discarded, the cell pellet was resuspended in 1mL of 0.01mol/L PBS, centrifuged at 5000rpm for 5min, and the supernatant was discarded. After adjusting the OD600 to about 0.5 by using 0.01mol/L PBS, 100 mu L of the suspension is sucked and added into 900 mu L of 0.01mol/L PBS to be mixed uniformly by vortex, and the mixture is diluted to 10 in turn by multiple ratio ^-5 。

mu.L of the diluent (10) was aspirated separately ^-2 、10 ^-3 、10 ^-4 、10 ^-5 ) Dropping the plates onto YPD medium, SD/-Ura medium, and 5-FOA medium, culturing at 37deg.C for 2d to verify URA3 gene deletion phenotype, and simultaneously sucking 5 μl of diluent (10 ^-2 、10 ^-3 、10 ^-4 、10 ^-5 ) Plates were incubated at 37℃for 2d with 0.2mg/mL G418 YPD medium, 0.05mg/mL Zeocin YPD medium, 0.2mg/mL G418 and 0.05mg/mL Zeocin medium to verify the phenotype of Kan, ble gene insertion and deletion.

All strains phenotypes were confirmed to be expected (see FIG. 6), S.bouldekiWT, S.bouldekii#1, S.bouldekii#2,S.boulardii/URA3 ^-/- S.Board ii #2, S.Board ii/URA3 of (B) ^-/- Since deletion of URA3 gene was unable to grow on auxotrophic medium lacking Uracil (SD/-Ura medium), but could grow on medium supplemented with Uracil and 5-FOA (5-FOA medium), it was confirmed that the strain URA3 gene was knocked out. Whereas S.boulardii WT, S.boularii#1 containing URA3 gene cannot grow on 5-FOA medium because URA3 gene can convert 5-FOA component in medium into toxic substance. In addition, S.Board i WT and S.Board ii/URA3 ^-/- The lack of resistance did not allow growth on each plate, whereas S.board ii #1 had Kan gene and could therefore grow on 0.2mg/mL G418 single plates, but not on plates containing 0.05mg/mL Zeocin. S. boulder ii #2 was grown on 0.2mg/mL G418 and 0.05mg/mL Zeocin double plates due to the presence of Kan and ble genes. Overall, verification from both genotype and phenotype demonstrated successful construction of uracil auxotroph yeast strain S.boulardii/URA3 ^-/- 。

Example 2 screening of engineering strains expressing EreA at high levels

(1) Chromosome-mediated engineering bacterium construction

The optimized foreign gene opereA (according to the preference of eukaryotes and prokaryotes for codons during the translation of proteins, in order to increase the preference of the ereA in uracil auxotrophy yeast strain S.board I/URA 3) was amplified by PCR using the plasmid pPIC3.5K-opereA (the optimized opereA was inserted into the EcoR I site of pPIC3.5K by homologous recombination, and can be constructed by a person skilled in the art by conventional methods) as a template ^-/- The original sequence is optimized firstly, and for the convenience of subsequent research, a 6xHis tag sequence is added before a stop codon to obtain an optimized operaA nucleotide sequence as shown in SEQ ID NO. 1), and the reaction system and the conditions are as follows:

opereA-infF(5’-3’)：

ATCTAAGTTTTAATTACAAGGATCCATGACCTGGAGAACTACTAGAAC

opereA-infR(5’-3’)：

CTATAGTGAGTCGTATTACGGATCCTTAGTGGTGATGATGGTGATGC

The reaction conditions for PCR amplification were: pre-denaturation at 94℃for 3min; denaturation at 98℃for 10s, annealing at 56℃for 30s, extension at 68℃for 30s for 35 cycles; final extension at 68℃for 7min; preserving at 4 ℃ and recovering PCR products.

Plasmid pZEURA was extracted (purchased through a commercial channel, purchased with the website https:// www.rjmart.cn/#/detailProductId=200239318434 & suppl=67716 & source=2), and single-digested with BamHI restriction enzymes to recover the digested product.

The two recovered products are sucked, evenly mixed according to the mass ratio of 3:1, and incubated overnight at 16 ℃ under the action of T4 ligase.

mu.L of the ligation product was pipetted into DH 5. Alpha. Competence, ice-cooled for 30min, heat-shocked at 42℃for 60s, and immediately after the heat-shock was completed, ice-cooled for 3min. Subsequently 900. Mu.L LB broth was added and resuscitated at 37℃for 1h at 180 rpm.

Centrifugation at 5000rpm for 5min, removal of 800. Mu.L of supernatant, resuspension of the bacterial pellet with the remaining broth and aspiration of the whole spread onto LB plates containing Amp100, incubation at 37℃for 24h followed by selection of positive transformants. Positive transformant plasmids were extracted and amplified for expression cassettes using the following primers:

the reaction system and conditions were as follows:

rDNA-Up-F(5’-3’)：CCGGAACCTCTAATCATTCG

rDNA-Down-R(5’-3’)：AACGAACGAGACCTTAACCT

The reaction conditions for PCR amplification were: pre-denaturation at 94℃for 3min; denaturation at 98℃for 10s, annealing at 56℃for 30s, extension at 68℃for 3min for 35 cycles; final extension at 68℃for 7min; preserving at 4 ℃ and recovering PCR products.

The recovered product was converted to S.board i/URA3 as in example 1 ^-/- In the method, positive transformants were screened on SD/-Ura mediumSelecting S.boulder ii/URA3 ^-/- -pZEURA-opereA。

(2) Plasmid-mediated engineering bacterium construction

The plasmid pPIC3.5K-opera is used as a template to amplify the optimized exogenous gene opera through PCR. The reaction system and conditions were as follows:

opereA-infF(5’-3’)：

ATCTAAGTTTTAATTACAAGGATCCATGACCTGGAGAACTACTAGAAC

opereA-infR(5’-3’)：

GCGGATCTTAGCTAGCCGCGGTACCCTTAGTGGTGATGATGGTGATGC

The backbone region of the expression plasmid was amplified by PCR using the plasmid pURA (commercially available from the commercial site: https:// www.rjmart.cn/#/detail. The reaction system and conditions were as follows:

TEF1-infF1(5’-3’)：GGTACCGCGGCTAGCTAAGAT

TEF1-infR1(5’-3’)：GGATCCTTGTAATTAAAACTTAGATTAGATTGC

The reaction conditions for PCR amplification were: pre-denaturation at 94℃for 3min; denaturation at 98℃for 10s, annealing at 58℃for 30s, extension at 68℃for 3min for 35 cycles; final extension at 68℃for 7min; preserving at 4 ℃ and recovering PCR products.

Sucking the two recovered products according to the mass 3:1, and incubating for 30min at 50 ℃ under the action of homologous recombination enzyme. Absorbing 10 μl of recombinant product, adding into DH5 alpha competence, ice-bathing for 30min, heat-shocking at 42deg.C for 60s, and immediately ice-bathing after heat-shocking3min. Subsequently 900. Mu.L LB broth was added and resuscitated at 37℃for 1h at 180 rpm. Centrifugation at 5000rpm for 5min, removal of 800. Mu.L of supernatant, resuspension of the bacterial pellet with the remaining broth and aspiration of the whole spread onto LB plates containing Amp100, incubation at 37℃for 24h followed by selection of positive transformants. Positive transformant plasmids were extracted and transformed into S.boulderi/URA 3 as described in example 1 ^-/- In the method, positive transformants are screened on SD/-Ura medium to obtain S.boulardii/URA3 ^-/- -pURA-opereA。

(3) Screening of high expression strains

The resulting chromosome-and plasmid-mediated EreA-expressing yeasts were inoculated into 200mL SD/-Ura medium, respectively, and cultured continuously at 30℃and 220rpm for 72 hours. 2ml of the culture broth was aspirated, centrifuged at 15000rpm for 5min, the supernatant was discarded, the cells were washed once with ultrapure water, and the OD600 was adjusted to 0.5. The adjusted bacterial solutions were aspirated 1ml and centrifuged at 15000rpm for 5min, and the supernatants were discarded. After adding 500. Mu.L of 0.3M NaOH, the mixture was left to stand for 5 minutes, and centrifuged at 15000rpm for 5 minutes, the supernatant was discarded. 500. Mu.L of ultrapure water was added, vortexed and homogenized, centrifuged at 15000rpm for 5min, and the supernatant was discarded. Adding 300 μl of the lysate, mixing, boiling with boiling water for 10min, centrifuging at 15000rpm for 5min, and collecting 200 μl of supernatant as extracted intracellular protein. Western blot was performed on the extracted proteins using a murine His primary antibody and HRP-labeled goat anti-murine secondary antibody. Grey values were semi-quantitative using ImageJ after chemiluminescent imaging. The experimental results show that the expression level of plasmid-mediated EreA is far higher than that of chromosome (FIG. 7) on the premise of the same bacterial load, and the plasmid is transiently expressed, and the transient expression is higher than that of chromosome-mediated stable expression on the expression level although the plasmid is inferior to the chromosome-mediated expression on the aspect of gene stability.

Example 3S. Boulder ii/URA3 ^-/- Verification of in vitro degradation effect of pURA-opera strain

Inoculation of S.boulder ii/URA3 ^-/- The pURA-opera strain was cultured continuously in 200mL SD/-Ura medium at 30℃and 220rpm for 72 hours. Centrifuge at 5000rpm for 5min, discard supernatant, and re-suspend the bacteria in 40mL PBS for one wash. Centrifuging at 5000rpm for 5min, discarding supernatant, adding appropriate amount of PBS for resuspension, and packaging into 2mL centrifuge tube. Centrifuging at 5000rpm for 5min, adding the bacterial precipitate into 5mL PBS,5mL PBS suspension containing feces and 5mL PBS solution containing fecesIn 5mL of PBS suspension containing cecum content, test tubes all contained erythromycin at 4 μg/mL, with erythromycin drug alone as blank and empty plasmid-containing bacteria as control. After incubating the above suspension at 37℃for 12 hours, it was centrifuged at 12000rpm for 5 minutes, 20. Mu.L of the supernatant was pipetted onto an MH agar plate coated with ATCC795, and after 5 hours of incubation at 60℃the diameter of the zone of inhibition was measured and the size of the zone of inhibition was inversely proportional to the effect of drug degradation. The results showed that it contained S.boulderi/URA 3 only ^-/- The phenomenon of shrinkage of the zone of inhibition of the group of pURA-opera strains (FIG. 8) confirms S.boulardii/URA3 ^-/- The pURA-opera strain allows to achieve in vitro degradation of erythromycin in different media.

EXAMPLE 4S boulder ii/URA3 ^-/- Verification of in vivo degradation Effect of pURA-opera A Strain

24 female KM mice of 6 weeks of age were randomly divided into 4 cages, 6 per cage, respectively numbered ABCD groups.

Group A was fed with pure water containing no erythromycin and group BCD was fed with pure water containing 25mg/L erythromycin. The mice in each group were free to drink and eat, and the mice in group C were perfused with stomach 10 each day from 0 days ⁸ Empty vector of CFU, group D mice were perfused with stomach 10 per day 0 days later ⁸ CFU S.boulder ii/URA3 ^-/- pURA-opera bacteria. Mouse faeces were collected on day 6 and the presence of erythromycin residues in the faeces was detected by LC-MS/MS. The experimental results are shown in FIG. 9, in which no erythromycin residue was detected in the feces of mice that were drinking pure water, and in which high levels of erythromycin residue were detected without significant differences in the feces of mice that were drinking pure water alone and mice that were free to drink pure water and empty stomach bacteria. While free drinking of pure water containing erythromycin while stomach-lavage S.boulardii/URA3 ^-/- Lower levels of erythromycin residuals were detected in the feces of mice from pURA-OPeereA bacteria, with significant differences compared to mice that had only been given erythromycin pure water. The results confirm S.boulder ii/URA3 ^-/- The pURA-opera strain can realize in-situ degradation of intestinal erythromycin in vivo, and the erythromycin degradation rate is 1563.7 mug/kg feces, which is far higher than that of the prior report.

To better solve S.boulder ii/URA3 ^-/- Whether the administration of pURA-opera will affect the concentration profile of erythromycin in the plasma and tissues. 18 female 6 weeks old KM mice were randomly divided into 3 cages, 6 per cage, each numbered EFG group. Group E was filled with pure water without erythromycin and group FG was filled with erythromycin solution at a dose of 50mg/kg for 1 continuous filling every day for 3 days. Wherein group D is re-intragastric 10 after intragastric erythromycin ⁸ CFU S.boulder ii/URA3 ^-/- Each group of mice was sacrificed 1h after the end of the third day of gastric lavage by pURA-opera bacteria, and plasma, liver, spleen, lung, kidney were collected. All samples were subjected to erythromycin extraction using acetonitrile, and the extract was filtered through a 0.22. Mu.L filter and injected into LC-MS/MS for erythromycin content determination. Experimental results show that S.boulderi/URA 3 ^-/- The use of pURA-opera bacteria showed no significant differences in the concentration profile of erythromycin in plasma and all tissues (FIG. 10), indicating S.boulderi/URA 3 ^-/- Oral administration of pURA-opera does not affect the in vivo distribution of erythromycin and therefore has no effect on the systemic therapeutic effect of erythromycin.

Example 5 engineering Yeast biosafety assessment

To contain pGEN: : standard strains ATCC700603, ATCC14028 and ATCC25922 of bleR are recipient strains, and engineering yeast S.boulardii/URA3 is used ^-/- The following experiments were carried out with pURA-opera as donor bacteria, which were first cultivated separately and subsequently treated as recipient bacteria: donor bacteria = 3:1, and the mixture was dropped onto 0.22 μm of LB medium and cultured at 37℃for 18 hours. Then scraping thalli into PBS, mixing evenly, diluting the thalli to 10 times ^-6 100. Mu.L of each dilution was pipetted onto LB agar containing 8. Mu.g/mL erythromycin and 200. Mu.g/mL bleomycin for screening.

Experimental results show that the engineering yeast S.board ii/URA3 ^-/- pURA-opera failed to passage the drug-resistant gene to standard strains due to species isolation, a relatively safer degradation strategy (FIG. 11).

It should be understood that the foregoing description of the specific embodiments is merely illustrative of the invention, and is not intended to limit the invention, and that any modifications, equivalents, improvements, etc. that fall within the spirit and principles of the invention are intended to be included within the scope of the invention.

Claims

1. A method for constructing engineering probiotics S.board ii for expressing erythromycin degrading enzyme EreA, which is characterized by comprising the following steps:

s1 construction of uracil auxotroph Strain S.boulardii/URA3 ^-/- ；

S2, constructing plasmids: inserting the OPEReA gene into a plasmid pURA containing URA3 genes, constructing and extracting positive transformant plasmids;

s3, transforming the positive transformant plasmid extracted in the step S2 into the uracil auxotroph strain S boulardii/URA3 in the step S1 ^-/- In the prepared competence, the conversion solution is coated on a culture medium to obtain EreA engineering probiotics expressing erythromycin degrading enzyme through screening;

the OPEReA gene is the EReA after sequence optimization, and has a nucleotide sequence shown as SEQ ID NO. 1.

2. The construction method according to claim 1, wherein the uracil auxotrophic S.boulderi strain of step S1 is constructed by constructing homology arms selected from G418 resistant Kan and Zeocin resistant ble resistant genes, inserting and replacing the homology arms one by one on URA3 alleles on S.boulderi chromosome, and removing the resistant genes by using LoxP/Cre recombinase system.

3. The method according to claim 1, wherein the specific steps of constructing the plasmid in step S2 are: the gene opera after optimization is amplified by PCR by taking pPICC 3.5K-opera as a template, the skeleton region of the expression plasmid is amplified by PCR by taking plasmid pURA as a template, two PCR products are subjected to homologous recombination, and the recombination products are added into DH5 alpha competence to extract positive transformant plasmids.

4. An engineered probiotic s.board ii expressing the erythromycin degrading enzyme EreA, characterized in that it is constructed by the method of any one of claims 1-3.

5. Use of the engineered probiotic s.boulardii of claim 4 for expressing the erythromycin degrading enzyme EreA.

6. Use of the engineered probiotic s.boulardii of claim 4 for degrading erythromycin residues.

7. The use according to claim 6, characterized in that it is the in situ degradation of erythromycin residues in the intestinal tract in vivo.