CN116438193A

CN116438193A - OmpA mutation enhances OMV production in bordetella pertussis

Info

Publication number: CN116438193A
Application number: CN202180074521.XA
Authority: CN
Inventors: P·A·范德莱; A·J·斯洛特斯; A·A·J·范德阿尔克
Original assignee: Intravacc LLC
Current assignee: Intravacc LLC
Priority date: 2020-09-04
Filing date: 2021-09-03
Publication date: 2023-07-14
Also published as: WO2022049222A1; EP4208472A1

Abstract

The present invention relates to mutant Bordetella (Bordetella) OmpA polypeptides. Bordetella comprising said mutant polypeptide has a high foaming phenotype. The invention therefore further relates to a method of producing OMVs, wherein the method comprises the step of culturing a bordetella bacterial population comprising a modified OmpA polypeptide under conditions conducive to the production of OMVs. Furthermore, the invention relates to OMVs produced by bordetella comprising a mutated OmpA polypeptide, and the use of such OMVs for the treatment and prevention of bordetella infections.

Description

OmpA mutation enhances OMV production in bordetella pertussis

Technical Field

The present invention is in the field of vaccinology, in particular in the field of prevention or treatment of Bordetella (Bordetella) infections.

The present invention relates to modified bordetella bacteria having increased OMV production, and OMVs obtainable from said modified OMV bacteria. The invention further relates to a composition comprising modified bordetella and/or OMV and the use of said composition for the prevention and/or treatment of bordetella infections.

Background

Pertussis, also known as cough (whooping cough), is a highly contagious respiratory disease caused by Bordetella (b.) pertussis. Pertussis is characterized by a severe cough episode followed by forceful inhalation with a characteristic pertussis sound. Symptoms may vary depending on the age of the individual and/or the level of immunization. Infants are particularly at risk of entering life threatening conditions, which may lead to respiratory failure and thus death. In addition to life threatening infants, this disease also causes social and economic barriers in adults. Pertussis is more often diagnosed today in older children and adults than in newborns and infants.

Bordetella pertussis was first identified in 1906 as the causative agent of pertussis. Bordetella pertussis is a gram-negative bacterium that specifically infects humans. Bacteria are transmitted from person to person by inhalation of respiratory droplets. Pertussis vaccination was performed in most developed countries between 1940 and 1950. The vaccine consists of inactivated bordetella pertussis in combination with diphtheria and tetanus toxoid. By introducing an infant vaccination program, including three injections in the first half of life, the incidence of pertussis is significantly reduced. This decrease indicates the effectiveness of these so-called whole cell pertussis (wP) vaccines. While effective and reducing morbidity, the wP vaccine was replaced by a cell-free (aP) vaccine in the late 1990's. The main reason for substitution is related to some serious complications of the use of wP vaccine. The aP vaccine contains some of the most important combinations of bordetella pertussis virulence factors, such as pertussis toxin, filiform hemagglutinin, pertactin and

pilin

2 and 3. These virulence factors introduce an effective immune response against bordetella pertussis.

Due to the lack of protection for newborns, different protection strategies for these young infants have been investigated. First, an aP vaccination program should be able to prevent pertussis infection, but attenuation of immunity has been described in several studies. In addition, an increase in cases of bordetella pertussis infection has been reported. In addition to primary vaccination programs, several other strategies have been explored and suggested. Since 2006, the U.S. center for disease control and prevention (CDC) recommended the adoption of coating strategies (cocon strategy). By this strategy, newborns are protected from bordetella pertussis infection by administering an aP-booster vaccine to family members and to all intimate persons in regular contact with the newborns. By this strategy, a coating is formed around the neonate. However, the formation of coating alone is likely insufficient to prevent the neonate from infecting pertussis. Funds are also a limiting factor in coating newborns, even if hospitals make additional investments. The second strategy studied was vaccination during pregnancy, with maternal antibodies being effective by placental transfer. However, maternal antibody levels decrease rapidly, fail to provide protection for infants beyond 6 to 8 weeks, and may interfere with active immunity induced by primary vaccination protocols. Immediately after birth, newborns can be protected by vaccination with DTaP (diphtheria, pertussis and tetanus) or an aP vaccine followed by a conventional vaccination program. This approach is challenged by a decrease in antibody levels against important bordetella pertussis toxins later in the infant. In contrast, other studies observed an increased antibody response to bordetella pertussis in the later stages of the infant, but a decreased antibody level to haemophilus influenzae type b (Haemophilus influenza B) and hepatitis b. Based on factors such as sustainability, finance and logistics, developing new vaccines is considered a long term optimal solution.

In order to prevent pertussis from erupting worldwide and prevent it from getting around, there is an urgent need in the art for a more effective vaccine. Over the last few years, more and more people have begun to pay attention to the use of Outer Membrane Vesicles (OMVs) as potential vaccines, as more insight is gained into their effect on immunomodulation (Ellis, t.n. and m.j.kuehn, MMBR,2010.74 (1): p.81-94). One advantage of OMVs as vaccine platforms is that their broad antigen in the native conformation of the OMV surface can induce a protective immune response. In addition, these OMVs are equipped with their own adjuvants and are easily taken up by immune cells. All these properties together make OMVs attractive for vaccine development (van der Pol, l., et al Biotechnology Journal,2015.10 (11): p.1689-1706). Recently, vaccines composed of OMVs, such as OMV-based neisseria meningitidis (Neisseria meningitidis) vaccines (Ellis, t.n., supra; fernandez, S., et al, BMC Immunology,2013.14 (Suppl 1): p.s8-S8), have been successfully developed and used. In addition to injection of OMVs derived from neisseria meningitidis, intranasal administration of OMVs also induced a highly protective antibody response. Furthermore, some studies have shown promising results for OMV-based bordetella pertussis vaccines against pertussis (Roberts, r., et al, vaccine,2008.26 (36): p.4639-4646; acevedo, r., et al, frontiers in Immunology,2014.5: p.121; asensio, c.j.a., et al, vaccine,2011.29 (8): p.1649-1656).

OMVs may be produced by gram-negative bacteria, about 20 to 250 nanometers (nm) in diameter. OMVs are formed by the budding process, obtaining vesicles with an Outer Membrane (OM) on their surface exposed side, but the exact mechanism is still poorly understood. Events believed to play a role in the budding mechanism are weak or absent links between OM and Peptidoglycan (PG) layers and accumulation (protein/molecule) in the periplasmic space (van der Pol, l., above). Furthermore, the productivity of OMVs varies from species, strain, and even growth phase. Productivity can be affected by environmental factors and pressure. OMVs are considered "sample packs" of bacteria which contain a large number of all components of the original biological content, but exist in non-replicating form (Kaparamkis-Liaskos, M.and R.L.Ferrro, nat Rev Immunol 2015.15 (6): p.375-387). Biological content may include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), LPS, PG, enzymes, and proteins, including virulence factors and pathogen-associated molecular patterns (PAMPs). OMVs play a role in long distance delivery, biofilm formation, promotion of pathogenesis, bacterial survival and regulation of interactions within bacterial communities. The presence of pertussis toxin, pilin 3 and pertactin has previously been demonstrated in proteoliposomes derived from inactivated bordetella pertussis. These three virulence factors are thought to be important for the virulence of bordetella pertussis. OMVs are proteoliposomes composed of OM phospholipids and other proteins. OMVs have an advantage in that they have more commonality with the actual bacteria and therefore are closer to mimicking natural infection than the aP vaccines currently in use. In addition to mimicking natural infection, OMVs have another advantage in that they can be easily taken up by immune cells, thereby enhancing their immunogenic properties. OMVs contain LPS and overdosing may lead to toxic effects. However, it may also function as a natural adjuvant (Raeven, r.h.m., et al Journal of Proteome Research,2015.14 (7): p.2929-2942).

Bordetella pertussis does not secrete high levels of OMV. For sustainability of OMV-based pertussis vaccines, the secretion rate of spontaneously formed OMVs should be optimized. Various protocols have been designed to enhance vesicle production by gram-negative bacteria, including treatment with detergents or ultrasound. However, these treatments may alter the composition and properties of OMVs compared to spontaneously produced outer membrane vesicles (ssomv). In some cases, detergent-free and/or ultrasonic methods may therefore be preferred.

Thus, there is a need in the art to increase OMV production in bordetella, in particular to increase OMV vaccine production. Furthermore, there remains a need for modified bordetella bacteria with increased foaming phenotype. Furthermore, there is a need in the art for bordetella having increased immunogenicity, preferably in combination with an increased foaming phenotype.

Summary of The Invention

The invention may be summarized in the following embodiments:

in one embodiment, the invention relates to a polypeptide comprising a sequence having at least 50% sequence identity to SEQ ID No. 1 and comprising a mutation in the OmpA-like domain.

Preferably, the mutation is located at a position corresponding to any one of positions 110-140 of SEQ ID NO. 1.

Preferably, the polypeptide comprising said mutation increases OMV production when expressed in bordetella compared to an otherwise identical polypeptide not comprising said mutation.

In one embodiment, the mutation in the polypeptide is a mutation of a single amino acid residue.

In one embodiment, the mutation in the polypeptide is a substitution of an amino acid residue, preferably a substitution at a position corresponding to position 124 of SEQ ID NO. 1, preferably a D124N substitution.

In one embodiment, the invention relates to a polynucleotide encoding a polypeptide of the invention, preferably wherein said polynucleotide has at least 50% sequence identity to SEQ ID NO. 4.

In one embodiment, the invention relates to a bordetella bacterium comprising a genomic modification in a gene encoding a polypeptide having at least 50% sequence identity to SEQ ID No. 1, wherein preferably the mutation is in the open reading frame of the gene.

In one embodiment, the mutation increases OMV (outer membrane vesicle) production of bordetella compared to the same bacterium that does not comprise the mutation.

In one embodiment, the genomic modification results in expression of a polypeptide of the invention.

In one embodiment, the mutation is in a gene comprising a sequence having at least 50% sequence identity to SEQ ID NO. 2.

In one embodiment, the bordetella is at least one of bordetella pertussis, bordetella parapertussis, and bordetella bronchiseptica.

In one embodiment, the bordetella further comprises a mutation in an endogenous gene encoding LpxA.

In one embodiment, the bacterium further comprises a mutation in an endogenous gene encoding Pertactin (Pertactin).

In one embodiment, the bacterium further comprises a mutation in at least one of:

i) An endogenous gene encoding Ptx; and

ii) an endogenous gene encoding DNT.

In one embodiment, the present invention relates to bordetella OMVs obtainable from bordetella as defined herein.

In one embodiment, the bordetella OMV of the invention comprises a polypeptide as defined herein.

In one embodiment, the invention relates to a method of generating OMVs, wherein the method comprises the steps of:

i) Culturing the bordetella population of the invention under conditions conducive to OMV production; and

ii) optionally, recovering the OMV.

In one embodiment, the present invention relates to a composition comprising at least one of:

i) Bordetella as defined herein, wherein preferably the bacteria are inactivated bacteria; and

ii) OMVs as defined herein.

Preferably, the composition is a pharmaceutical composition.

In one embodiment, the invention relates to a composition as defined herein for use as a medicament.

In one embodiment, the composition is for use in treating or preventing bordetella infection.

Preferably, the infection is a bordetella pertussis infection.

In one embodiment, the composition as defined herein or for use as defined herein is a cell-free vaccine or a cell vaccine.

The composition as defined herein or for use as defined herein preferably further comprises at least one non-bordetella antigen.

Definition of the definition

Various terms relating to the methods, compositions, uses and other aspects of the invention are used throughout the specification and claims. Unless otherwise indicated, these terms are to be given their ordinary meaning in the art to which this invention pertains. Other specifically defined terms are to be construed in a manner consistent with the definitions provided herein. Although any methods and materials similar or equivalent to those described herein can be used in the practice to test the present invention, the preferred materials and methods are described herein.

Methods of practicing conventional techniques used in the methods of the present invention will be apparent to the skilled artisan. Practice of routine techniques in molecular biology, biochemistry, computational chemistry, cell culture, recombinant DNA, bioinformatics, genomics, sequencing and related fields are well known to those skilled in the art and are discussed, for example, in the following documents: sambrook et al molecular cloning.a Laboratory Manual,2nd Edition,Cold Spring Harbor Laboratory Press,Cold Spring Harbor,N.Y, 1989; ausubel et al Current Protocols in Molecular Biology, john Wiley & Sons, new York,1987 and periodic updates; and a series of Methods in Enzymology, academic Press, san Diego.

"a", "an" and "the": these singular terms include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a cell" includes a combination of two or more cells, and the like.

As used herein, the term "about" is used to describe and explain small variations. For example, the term may refer to less than or equal to + -10%, such as less than or equal to + -5%, less than or equal to + -4%, less than or equal to + -3%, less than or equal to + -2%, less than or equal to + -1%, less than or equal to + -0.5%, less than or equal to + -0.1%, or less than or equal to + -0.05%. Furthermore, amounts, ratios, and other numerical values are sometimes presented herein in a range format. It is to be understood that such range format is used for convenience and brevity and should be interpreted flexibly to include the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For example, ratios in the range of about 1 to about 200 are understood to include the explicitly recited limits of about 1 and about 200, but also include individual ratios such as about 2, about 3, and about 4, as well as sub-ranges such as about 10 to about 50, about 20 to about 100, etc.

"and/or": the term "and/or" means that one or more of the specified conditions may occur alone or in combination with at least one of the specified conditions until all of the specified conditions.

"comprise": this term is to be interpreted as inclusive and open-ended, rather than exclusive. In particular, the terms and variations thereof are meant to include the specified features, steps or components. These terms should not be interpreted to exclude the presence of other features, steps or components.

The terms "homology", "sequence identity", and the like are used interchangeably herein. Sequence identity is defined herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In the art, "identity" also refers to the degree of sequence relatedness between amino acid or nucleic acid sequences, as determined by the match between strings of such sequences. "similarity" between two amino acid sequences is determined by comparing the amino acid sequence of one polypeptide and conservative amino acid substitutions thereof with the sequence of a second polypeptide. "identity" and "similarity" can be easily calculated by known methods.

"sequence identity" and "sequence similarity" can be determined by aligning two peptides or two nucleotide sequences using global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., needleman Wunsch) that optimally aligns sequences over their entire length, while sequences of significantly different lengths are preferably aligned using a local alignment algorithm (e.g., smith Waterman). Sequences may be said to be "substantially identical" or "substantially similar" when they share at least a certain minimum percentage of sequence identity (as defined below) when optimally aligned by, for example, the programs GAP or BESTFIT using default parameters. GAP uses Needleman and Wunsch global alignment algorithms to align two sequences over the entire length (full length), maximizing the number of matches and minimizing the number of space bits. When two sequences have similar lengths, global alignment is suitable for determining sequence identity. Typically, GAP creation penalty = 50 (nucleotides)/8 (proteins) and GAP extension penalty = 3 (nucleotides)/2 (proteins) using GAP default parameters. For nucleotides, the default scoring matrix used is nwsgapdna and for proteins, blosum62 (Henikoff & Henikoff,1992, PNAS 89, 915-919). The percent sequence alignment and percent sequence identity scores may be determined using a computer program, such as GCG Wisconsin Package, version 10.3, available from Accelrys inc.,9685Scranton Road,San Diego,CA 92121-3752USA, or using open source software, such as program "needle" (using global Needleman Wunsch algorithm) or "water" (using local Smith Waterman algorithm), embossWIN version 2.10.0, using the same parameters as the GAPs described above, or using default settings (10.0 for both "needle" and "water'" and for protein and for DNA alignments, 0.5 for default GAP opening penalty, 0.62 for default GAP extension, and dnaul for default score matrix for DNA). When the sequences have significantly different overall lengths, local alignments are preferred, such as those using the Smith Waterman algorithm.

Alternatively, the similarity or percent identity may be determined by searching a public database using algorithms such as FASTA, BLAST, etc. Thus, the nucleic acid and protein sequences of the invention may be further used as "query sequences" to search against public databases, for example, to identify other family members or related sequences. Such searches may be performed using the BLASTN and BLASTX programs of Altschul, et al (1990) J.mol.biol.215:403-10 (version 2.0). BLAST nucleotide searches can be performed using the NBLAST program with a score of = 100 and a word length of = 12 to obtain nucleotide sequences homologous to ompA nucleic acid molecules of the invention. BLAST protein searches can be performed using the BLASTx program with score=50 and word length=3 to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain a gap alignment for comparison purposes, gapped BLAST can be used, as described in Altschul et al, (1997) Nucleic Acids Res.25 (17): 3389-3402. When using BLAST and Gapped BLAST programs, default parameters for the respective programs (e.g., BLASTX and BLASTN) can be used. See homepage National Center for Biotechnology Information, with the web address http:// www.ncbi.nlm.nih.gov/.

Optionally, the skilled artisan can also consider so-called "conservative" amino acid substitutions in determining the degree of amino acid similarity, as will be clear to the skilled artisan. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic hydroxyl side chains are serine and threonine; a group of amino acids having amide-containing side chains are asparagine and glutamine; a group of amino acids having aromatic side chains are phenylalanine, tyrosine and tryptophan; a group of amino acids with basic side chains are lysine, arginine and histidine; one group of amino acids with sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acid substitutions are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, aspartic acid-glutamic acid, and asparagine-glutamine. Substituted variants of the amino acid sequences disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted at its position. Preferably, the amino acid changes are conservative. Preferred conservative substitutions for each naturally occurring amino acid are as follows: substitution of Ala to ser; arg is substituted with lys; asn is substituted with gln or his; asp is substituted by glu; cys is substituted by ser or ala; gln is substituted with asn; glu is substituted with asp; gly is substituted by pro; his is substituted with asn or gln; lie is substituted by leu or val; leu is substituted by ile or val; lys is substituted with arg; gln or glu; met is substituted by leu or ile; phe is substituted with met, leu or tyr; ser is substituted with thr; thr is substituted with ser; trp is substituted with tyr; tyr is substituted with trp or phe; and val is substituted as ile or leu.

As used herein, the terms "selectively hybridizes," "selectively hybridizes," and like terms are intended to describe conditions of hybridization and washing under which nucleotide sequences that are generally at least 66%, at least 70%, at least 75%, at least 80%, more preferably at least 85%, even more preferably at least 90%, preferably at least 95%, more preferably at least 98%, or more preferably at least 99% homologous to each other remain hybridized to each other. That is, such hybrid sequences may share at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, more preferably at least 85%, even more preferably at least 90%, more preferably at least 95%, more preferably at least 98% or more preferably at least 99% sequence identity.

One preferred, non-limiting example of such hybridization conditions is hybridization in 6 XSSC/sodium citrate (SSC) at about 45℃followed by one or more washes in 1 XSSC, 0.1% SDS at about 50℃preferably at about 55℃preferably at about 60℃and even more preferably at about 65 ℃.

High stringency conditions include, for example, hybridization at about 68℃in 5 XSSC/5 XDenhardt's solution/1.0% SDS and washing at room temperature in 0.2 XSSC/0.1% SDS. Alternatively, the washing may be performed at 42 ℃.

Those skilled in the art will know which conditions apply to stringent and highly stringent hybridization conditions. Other guidelines for such conditions are also readily available in the art, for example from Sambrook et al, 1989,Molecular Cloning,ALaboratory Manual,Cold Spring Harbor Press,N.Y; and Ausubel et al (eds.), sambrook and Russell (2001) "Molecular Cloning: A Laboratory Manual (3 rd edition), cold Spring Harbor Laboratory, cold Spring Harbor Laboratory Press, new York 1995,Current Protocols in Molecular Biology (John Wiley & Sons, n.y.).

Of course, polynucleotides that hybridize only to a polyA sequence (e.g., the 3' -terminal poly (a) sequence of an mRNA) or to the complement of a T (or U) residue are not included in the polynucleotides of the invention for specifically hybridizing to a portion of a nucleic acid of the invention, as such polynucleotides would hybridize to any nucleic acid molecule containing a poly (a) sequence or complement thereof (e.g., nearly any double-stranded cDNA clone).

"nucleic acid construct" or "nucleic acid vector" is understood herein to mean an artificial nucleic acid molecule produced using recombinant DNA techniques. Thus, the term "nucleic acid construct" does not include naturally occurring nucleic acid molecules, although the nucleic acid construct may comprise (parts of) naturally occurring nucleic acid molecules. The term "expression vector" or "expression construct" refers to a nucleotide sequence capable of effecting expression of a gene in a host cell or host organism compatible with such sequences. These expression vectors typically include at least suitable transcriptional regulatory sequences, and optionally 3' transcriptional termination signals. Other factors necessary or helpful to achieve expression may also be present, such as expression enhancer elements. The expression vector will be introduced into a suitable host cell and will enable expression of the coding sequence in an in vitro cell culture of the host cell. The expression vector is suitable for replication in a host cell or organism of the invention.

As used herein, the term "promoter" or "transcriptional regulatory sequence" refers to a nucleic acid fragment that functions to control transcription of one or more coding sequences and is located upstream of the direction of transcription relative to the transcription initiation site of the coding sequence, and is structurally identified by the presence of binding sites for DNA-dependent RNA polymerase, transcription initiation sites, and any other DNA sequences including, but not limited to, transcription factor binding sites, repressor and activator binding sites, and any other nucleotide sequences known to those of skill in the art that directly or indirectly regulate the amount of transcription of a promoter. A "constitutive" promoter is a promoter that is active in most cells, preferably bacterial cells, under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically or developmentally regulated, for example, by the application of a chemical inducer.

The term "selectable marker" is a term well known to those of skill in the art and is used herein to describe any genetic entity that, when expressed, can be used to select for one or more cells that contain the selectable marker. The term "reporter gene" is used interchangeably with label, although it is used primarily to refer to a visible label, such as Green Fluorescent Protein (GFP). The selection markers may be explicit or implicit or bi-directional.

As used herein, the term "operably linked" refers to the linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a transcriptional regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous and, in the case of joining two protein coding regions, need to be contiguous and in reading frame.

The term "peptide" as used herein is defined as a chain of amino acid residues, typically having a defined sequence. As used herein, the term peptide may be used interchangeably with the terms "polypeptide" and "protein". In the context of the present invention, the term "peptide" is defined as any peptide or protein comprising at least two amino acids linked by modified or unmodified peptide bonds. The term "peptide" refers to a short chain molecule such as an oligopeptide or oligomer or a long chain molecule such as a protein. The proteins/peptides may be linear, branched or cyclic. The peptide may include D amino acids, L amino acids, or a combination thereof. The peptide according to the invention may comprise modified amino acids. Thus, the peptides of the invention may also be modified by natural processes such as post-transcriptional modification or by chemical processes. Some examples of such modifications are: acetylation, acylation, ADP-ribosylation, amidation and deamidation, covalent bonding with flavin, covalent bonding with heme, covalent bonding with a nucleotide or nucleotide derivative, covalent bonding with a modified or unmodified carbohydrate moiety, bonding with a lipid or lipid derivative, covalent bonding with phosphatidylinositol, crosslinking, cyclization, disulfide bond formation, demethylation, cysteine molecule formation, pyroglutamic acid formation, formylation, gamma-carboxylation, hydroxylation, iodination, methylation, oxidation, phosphorylation, racemization, and the like. Thus, any peptide modification that does not have the effect of eliminating peptide immunogenicity is contemplated within the scope of the invention.

The term "gene" refers to a DNA fragment comprising a region (transcribed region) transcribed into an RNA molecule (e.g., mRNA) in a cell, operably linked to a suitable regulatory region (e.g., a promoter). Genes typically comprise several operably linked fragments, such as a promoter, a 5' leader, a coding region, and a 3' -untranslated sequence (3 ' -end) comprising a polyadenylation site. "expression of a gene" refers to a process in which a DNA region operably linked to a suitable regulatory region, particularly a promoter, is transcribed into RNA that is biologically active, i.e., which is capable of being translated into a protein or peptide that is biologically active. When used in reference to the relationship between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, the term "homologous" is understood to mean that the nucleic acid or polypeptide molecule is produced in nature by a host cell or organism of the same species, preferably the same variety or strain. If homologous to the host cell, the nucleic acid sequence encoding the polypeptide is typically (but not necessarily) operably linked to another (heterologous) promoter sequence outside its natural environment and, if applicable, to another (heterologous) secretion signal sequence and/or terminator sequence. It will be appreciated that the regulatory sequences, signal sequences, terminator sequences and the like may also be homologous to the host cell.

The terms "heterologous" and "exogenous" when related to a nucleic acid (DNA or RNA) or protein refer to a nucleic acid or protein that does not naturally occur as part of the organism, cell, genome, or DNA or RNA sequence in which it resides, or is found in a cell or in one or more locations in the genome or DNA or RNA sequence that is different from that found in nature. Heterologous and exogenous nucleic acids or proteins are not endogenous to the cell into which they are introduced, but have been obtained, for example, from another cell or synthetically or recombinantly produced. Typically, but not necessarily, such nucleic acids encode a protein, i.e., an exogenous protein, which is not normally produced by the cell that transcribes or expresses the DNA. Similarly, an exogenous RNA can encode a protein that is not normally expressed in a cell in which the exogenous RNA is present. Heterologous/exogenous nucleic acids and proteins may also be referred to as exogenous nucleic acids or proteins. Any nucleic acid or protein that is foreign to the cell in which it is expressed is considered by those of skill in the art to be encompassed herein by the term heterologous or exogenous nucleic acid or protein. The terms heterologous and exogenous also apply to non-natural combinations of nucleic acid or amino acid sequences, i.e., at least two of the sequences being combined in a combination are foreign relative to each other.

The term "immune response" as used herein refers to the production of antibodies and/or immune cells (e.g., T lymphocytes) directed against and/or assisting in the breakdown and/or inhibition of specific antigenic entities that carry and/or express or present antigens and/or antigenic epitopes on their surfaces. For the purposes of the present invention, the phrases "effective immune protective response", "immune protection" and the like refer to an immune response to one or more antigenic epitopes of a pathogen, pathogen-infected cell or cancer cell, so as to protect against pathogen infection or cancer in an vaccinated subject. For the purposes of the present invention, protection against pathogen infection or protection against cancer includes not only absolute prevention of infection or cancer, but also, for example, a decrease in the extent or speed of any detectable pathogen infection or cancer, or a detectable decrease in the severity of a disease or any symptom or condition caused by pathogen infection or cancer in an vaccinated subject, as compared to an unvaccinated infected subject. In the case of cancer, an effective immunoprotection response also includes clearing cancer cells, thereby reducing the size of the cancer or even eliminating the cancer. Vaccination to achieve this is also known as therapeutic vaccination. Alternatively, an effective immunoprotective response may be induced in a previously uninfected pathogen and/or a uninfected pathogen or a subject not yet suffering from cancer at the time of vaccination, which may be referred to as prophylactic vaccination.

According to the present invention, the term "antigen" is used generically herein to refer to any molecule that specifically binds to an antibody. The term also refers to any molecule or fragment of a molecule that can be bound by an MHC molecule and presented to a T cell receptor. The antigen may be, for example, a proteinaceous molecule, i.e. a polyamino acid sequence, optionally comprising non-protein groups such as carbohydrate moieties and/or lipid moieties, or the antigen may be, for example, a molecule that is not a protein, such as a carbohydrate. An antigen may be, for example, any portion of a protein (peptide, partial protein, full-length protein), wherein the protein is a naturally occurring or synthetically derived, cellular composition (whole cell, cell lysate or broken cell), organism (whole organism, lysate or broken cell), or carbohydrate or other molecule, or portion thereof, that is capable of eliciting an antigen-specific immune response (humoral and/or cellular immune response) in a particular subject, preferably as measured by some assay or method.

The term "antigen" is herein understood to be a structural substance that serves as a target for the receptor of an adaptive immune response. Thus, the antigen serves as a target for TCR (T cell receptor) or BCR (B cell receptor) or secreted forms of BCR (i.e. antibodies). Thus, an antigen may be a protein, peptide, carbohydrate, or other hapten that is typically part of a larger structure such as a cell or virosome. The antigen may originate from the in vivo ("autoantigen") or from the external environment ("non-autoantigen"). Because of the negative selection of T cells in the thymus, the immune system will normally not react to "self" antigens and should only recognize and attack "non-self" invading agents from the outside or modification/harmful substances present in the body under e.g. disease conditions. The antigenic structure as a target of the cellular immune response is presented by Antigen Presenting Cells (APCs) in the form of processed antigenic peptides to T cells of the adaptive immune system via histocompatibility molecules. Depending on the type of antigen and histocompatibility molecule presented, several types of T cells may be activated. For T Cell Receptor (TCR) recognition, antigens are processed into small peptide fragments within the cell and presented to the T cell receptor via the Major Histocompatibility Complex (MHC).

The term "immunogen" is used herein to describe an entity comprising or encoding at least one epitope of an antigen, whereby a specific humoral and/or cellular immune response is elicited in the subject against said epitope and the antigen comprising the epitope, when administered to the subject, preferably with an appropriate adjuvant. The immunogen may be identical to the antigen or at least comprise a portion of the antigen, e.g. a portion comprising an epitope of the antigen. Thus, in one embodiment, vaccinating a subject against a particular antigen means that an immune response against the antigen or immunogenic portion thereof is elicited as a result of administration of an immunogen comprising at least one epitope of the antigen. Vaccination preferably produces a protective or therapeutic effect in which subsequent exposure to an antigen (or antigen source) elicits an immune response against the antigen (or source), thereby reducing or preventing a disease or disorder in a subject. The concept of vaccination is well known in the art. The immune response elicited by administration of the prophylactic or therapeutic compositions of the invention can be any detectable change in any aspect of the immune state (e.g., cellular response, humoral response, cytokine production) as compared to the absence of administration of the vaccine.

An "epitope" is defined herein as a single immunogenic site within a given antigen sufficient to elicit an immune response in a subject. One skilled in the art will recognize that T cell epitopes are different in size and composition from B cell epitopes, and that T cell epitopes presented by the MHC class I pathway are different from epitopes presented by the MHC class II pathway. Depending on the type of immune response, the epitope may be a linear sequence or a conformational epitope (conserved binding region). The antigen may be as small as a single epitope or may be larger and may include multiple epitopes. Thus, the size of the antigen may be as small as about 5 to 12 amino acids (e.g., peptides), or as large as, for example: full-length proteins, including multimeric proteins, protein complexes, virosomes, particles, whole cells, whole microorganisms, or portions thereof (e.g., whole cell lysates or extracts of microorganisms).

An adjuvant is herein understood to be an entity which, when administered in combination with an antigen to a human or animal subject to generate an immune response against the antigen in the subject, stimulates the immune system, thereby eliciting, enhancing or promoting an immune response against said antigen, preferably without necessarily generating a specific immune response against the adjuvant itself. Preferred adjuvants enhance the immune response to a given antigen by at least 1.5, 2, 2.5, 5, 10 or 20-fold compared to an immune response to the antigen under the same conditions but without the adjuvant. Tests for determining a statistically-average enhancement of an immune response against a given antigen by an adjuvant in a group of animal or human subjects relative to a corresponding control group are available in the art. The adjuvant is preferably capable of enhancing an immune response against at least two different antigens.

OMVs (also known as "vesicles (blebs)") are bilayer membrane structures, generally spherical, with diameters in the range of 20-250nm (sometimes 10-500 nm), which pinch off from the outer membrane of gram-negative bacteria. OMV membranes contain Phospholipids (PL) inside and Lipopolysaccharides (LPS) and PL outside and mix with membrane proteins at different positions, largely reflecting their structure from the pinch-off bacterial outer membrane. The lumen of OMVs may contain various compounds from the periplasm or cytoplasm, such as proteins, RNA/DNA and Peptidoglycans (PGs), but unlike bacterial cells OMVs lack the ability to self-replicate. In the context of the present invention, three types of OMVs can be distinguished according to their method of generation. sOMVs are spontaneous or natural OMVs, purified and concentrated from culture supernatants by separating intact cells from the OMVs that have been formed. The detergents OMV, dOMV, are extracted from cells with detergents such as deoxycholate, which also reduce the level of reactive LPS. After extraction with detergent, the dOMVs are separated from the cells and cell debris, and further purified and concentrated. Finally, the term natural nOMV is used herein to describe OMVs produced from concentrated dead cells using non-detergent cell disruption techniques, or OMVs extracted from cells using other (non-destructive) detergent-free methods (e.g., using chelators such as EDTA) in order to be able to distinguish them from wild-type spontaneous OMVs and detergent-extracted dOMV. One particular type of nOMV is "eOMV," which is used herein to describe OMVs extracted from cells using the chelator EDTA.

Any reference herein to a nucleotide or amino acid sequence accessible in a public sequence database refers to a version of the sequence entry available at the filing date of this document.

Detailed Description

Polypeptides

The present invention relates to the surprising discovery that: mutations in the Bordetella (Bordetella) ompA gene increase OMV production. In other words, bordetella having a mutation in the endogenous ompA gene has a so-called high foaming phenotype. The bordetella OmpA polypeptide may have a sequence as noted in SEQ ID No. 1.

OmpA comprises an N-terminal domain that traverses OM with eight antiparallel β chains. The C-terminal domain remains in the periplasm and is suggested to interact with the PG layer (refer, A.W. and S. Ayalew, veterinary Microbiology,2013.163 (3-4): p.207-222; mittal, R., et al, the Journal of Biological Chemistry,2011.286 (3): p.2183-2193). Coli (e.coli), salmonella (Salmonella spp.), and Acinetobacter baumannii (A.baumannii) lacking OmpA showed increased OMV production (Schwechheimer C.and M.J.Kuehn, nat Rev Micro,2015.13 (10): p.605-619). Furthermore, the deletion of the periplasmic protein Rmpm in Neisseria (Neisseria) resulted in an increase in OMV production (Maharjan, S., et al, microbiology,2016.162 (2): p.364-375;van de Waterbeemd et al,Vaccine 2010,28 (30): 4810-4516). Rmpm has limited homology to E.coli (Klugman K.P.et al, effect Immun,1989,57 (7): 2066-71), bordetella pertussis (B.pertussis), and outer membrane protein A (OmpA) of various other gram-negative species.

The deletion of OmpA (BP 0943) or any OmpA homologs BP2019 and BP3342 in bordetella has been shown to be detrimental to viability (unpublished results). Thus OmpA and its homologs appear to be proteins necessary for bordetella survival. Surprisingly, specific mutations in bordetella OmpA provide living bacteria with a high foaming phenotype.

In a first aspect, the invention relates to a mutated OmpA polypeptide, i.e. an OmpA polypeptide having a mutation. Preferably, the invention relates to a polypeptide comprising a sequence having at least about 50% sequence identity to SEQ ID No. 1, and wherein said polypeptide comprises a mutation.

Preferably, the polypeptide comprising said mutation increases OMV production when expressed in bordetella compared to an otherwise identical polypeptide not comprising said mutation. Preferably, bordetella expressing an OmpA polypeptide comprising a mutation as defined herein has increased OMV production compared to bordetella expressing an endogenous OmpA polypeptide, otherwise identical. Preferably, the endogenous OmpA polypeptide is identical to the polypeptide comprising the mutation, except that the endogenous polypeptide does not comprise the mutation.

The mutant polypeptide comprising the mutation may comprise a sequence having at least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to SEQ ID No. 1. Preferably, the polypeptide may comprise a sequence having SEQ ID NO. 1, except for mutations as defined herein.

A mutant polypeptide comprising the mutation may comprise a sequence having at least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to a sequence having NCBI reference sequence NP 879744.1. Preferably, the polypeptide may comprise a sequence having the NCBI reference sequence NP879744.1, except for mutations as defined herein.

The mutant polypeptide may be a mutant of an ortholog or paralog of the OmpA polypeptide having SEQ ID No. 1, preferably the mutant polypeptide may be a mutant of an ortholog of the OmpA polypeptide. Preferably, the ortholog is bordetella parapertussis (b. Parapertussis) OmpA or bordetella bronchiseptica (b. Bronchipeptica) OmpA. Preferably, bordetella parapertussis OmpA has at least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity with SEQ ID No. 8, except for mutations as defined herein. Preferably, the mutation is located at a position corresponding to position D124 in SEQ ID NO. 1. Preferably, bordetella bronchiseptica OmpA has at least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity with SEQ ID No. 9, except for mutations as defined herein. Preferably, the mutation occurs at a position corresponding to position D124 in SEQ ID NO. 1.

The mutant polypeptide may comprise a sequence having at least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to SEQ ID No. 3.

Preferably, the mutation is located in the OmpA-like domain of the polypeptide. Preferably, the OmpA-like domain has at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or about 100% sequence identity to positions 75-191 of SEQ ID No. 1. Thus, the polypeptide preferably has a mutation at a position corresponding to any one of positions 75 to 191 of SEQ ID NO. 1.

The mutation may be located at a position corresponding to any of positions 110-140 of SEQ ID NO. 1. Preferably, the mutation may be at a position corresponding to any of positions 80-180, 85-170, 90-160, 95-150, 100-140, 110-130, 115-130, 120-128 or 122-126 of SEQ ID NO. 1. The mutation may be located at a position corresponding to any of positions 120, 121, 122, 123, 124, 125, 126, 127, 128, 129 and 130 of SEQ ID NO. 1, preferably at any of positions 122, 123, 124, 125, 126 of SEQ ID NO. 1. Preferably, the mutation is at a position corresponding to position 124 of SEQ ID NO. 1.

Preferably, the OmpA polypeptide comprising said mutation is an endogenous protein, except for the mutations as defined herein. Thus, preferably, the OmpA polypeptide may be derived from a bordetella bacterium, and wherein the OmpA polypeptide further comprises a mutation as defined herein.

In one embodiment, the mutation is a mutation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid residues in a sequence having at least 50% sequence identity to SEQ ID No. 1. Preferably, the mutation is a mutation of 1, 2, 3, 4 or 5 amino acid residues in a sequence having at least about 50% sequence identity to SEQ ID NO. 1. Preferably, the mutation is a mutation of a single amino acid residue in a sequence having at least 50% sequence identity to SEQ ID NO. 1.

The mutation may be any one of deletion, addition, and substitution of one or more amino acid residues. Preferably, the mutation is at least one of deletion, addition and substitution of a single amino acid residue. Preferably, the mutation is a substitution of a single amino acid residue. Preferably, the mutation is a substitution of the amino acid residue corresponding to position 124 in SEQ ID NO. 1. Preferably, the mutation is a substitution of an aspartic acid amino acid residue at a position corresponding to position 124 in SEQ ID NO. 1.

Amino acid residue substitutions may be conservative or non-conservative amino acid residue substitutions. Conservative amino acid residue substitutions are defined herein as the substitution of an amino acid residue with a different amino acid residue having similar biochemical properties, e.g., at least one of similar charge, hydrophobicity, and size.

Preferably, the acidic residues may be substituted with different acidic residues. Preferably, the acidic residue is selected from aspartic acid, glutamic acid, asparagine, and glutamine.

Preferably, the basic residues may be substituted with different basic residues. Preferably, the basic residue is selected from histidine, lysine and arginine.

Preferably, the aliphatic residues may be substituted with different aliphatic residues. Preferably, the aliphatic residue is selected from glycine, alanine, valine, leucine and isoleucine.

Preferably, the hydroxyl-or sulfur/selenium-containing residue may be substituted with a different hydroxyl-or sulfur/selenium-containing residue. Preferably, the hydroxyl-or sulphur/selenium-containing residues are selected from serine, cysteine, selenocysteine, threonine and methionine.

Preferably, the aromatic residues may be substituted with different aromatic residues. Preferably, the aromatic residues are selected from phenylalanine, tyrosine and tryptophan.

In the mutant polypeptides of the present invention, preferably aspartic acid at a position corresponding to position 124 in SEQ ID NO. 1 may be substituted with at least one of glutamic acid, asparagine and glutamine. Preferably, aspartic acid, preferably aspartic acid at a position corresponding to position 124 in SEQ ID NO. 1, may be substituted with asparagine (i.e. a substitution of D to N).

Preferably, the mutant polypeptides of the invention have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to SEQ ID NO. 3.

Preferably, the polypeptide is isolated from its natural environment. The polypeptide may be a recombinant, synthetic or artificial polypeptide.

Polynucleotide

In a second aspect, the invention relates to a polynucleotide encoding a polypeptide as defined herein. Preferably, the polynucleotide encodes a polypeptide having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% sequence identity with SEQ ID No. 1, except for mutations as defined herein. Some or all of the codons may be optimized for expression in bacteria, preferably in bordetella as defined herein. The codon may be identical to the codon of the endogenous bordetella ompA coding sequence except for the mutations as defined herein. The polynucleotide may be preceded by an endogenous promoter, preferably an endogenous promoter driving expression of OmpA in bordetella. Preferably, the polynucleotide is isolated from its natural environment. The polypeptide may be a recombinant, synthetic or artificial polynucleotide. The polynucleotide may comprise one or more nucleotides not present in a naturally occurring bordetella OmpA encoding polynucleotide.

Preferably, the polynucleotide has one or more nucleotides not present in a naturally occurring bordetella OmpA encoding polynucleotide.

Preferably, the polynucleotide has at least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to SEQ ID NO. 4.

Preferably, the polynucleotide has at least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity with SEQ ID NO. 2, except for mutations as defined above. Preferably, the polynucleotide has at least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to SEQ ID NO. 2, except for the mutation at positions 370, 371 and/or 372, i.e. the codon corresponding to position 124 of SEQ ID NO. 1.

In a third aspect, the present invention relates to a gene encoding a polypeptide as defined in the first aspect. Preferably, the gene comprises a polynucleotide as defined in the second aspect. The gene may comprise elements that modulate the expression of OmpA polypeptides. Preferably, the gene comprises a promoter controlling expression of a mutated (OmpA) polypeptide as defined herein. The promoter may be a constitutively active promoter or an inducible promoter. The promoter may be an endogenous promoter driving the expression of OmpA in bordetella.

In a fourth aspect, the invention relates to a vector comprising at least one of the polynucleotide of the second aspect and the gene of the third aspect. The vector is preferably suitable for transformation into bacteria, preferably into bordetella. Preferably, the vector is a DNA plasmid, preferably a naked DNA plasmid.

Bordetella bacterium

In a fifth aspect, the present invention relates to genetically modified bordetella. Preferably, the genetically modified bordetella has increased OMV production compared to an otherwise identical bordetella that does not comprise the mutation, preferably when grown under the same conditions. Preferably, the genetically modified bordetella comprises and/or expresses a modified polypeptide as defined herein. Preferably, the genetically modified bordetella does not comprise an endogenous OmpA polypeptide.

In one embodiment, the bordetella of the invention comprises a modification, preferably a genomic modification, wherein said modification results in the expression of a mutant OmpA polypeptide as defined herein. Preferably, the modified bordetella does not express an endogenous OmpA polypeptide.

The modification may be the insertion of a vector as defined herein. The vector may remain episomal or may be inserted into the bacterial genome. The modification may be the insertion of at least one of a polynucleotide and a gene as defined herein into the genome of bordetella. The modified bordetella may further comprise modifications which reduce or eliminate expression of the endogenous OmpA polypeptide. Preferably, the genetically modified bordetella may comprise a genomic modification, preferably in the OmpA gene, that reduces or eliminates expression of the endogenous OmpA polypeptide. Preferably, the mutation in the OmpA gene is a genomic modification in a regulatory element controlling expression of an endogenous OmpA polypeptide or a mutation in the OmpA polypeptide coding sequence.

The modification may be the insertion of a suicide vector, preferably the suicide vector pSS1129 (Stinitz, S. Use of conditionally counterselectable suicide vectors for allelic exchange. Methods enzymes, 1994.235: p.458-65). Insertion of the suicide vector results in expression of the mutant OmpA polypeptide and deletion of expression of the endogenous OmpA polypeptide.

The modification may be a modification of the bordetella genome, wherein the modification modifies the coding sequence of the endogenous OmpA polypeptide resulting in expression of the mutant OmpA polypeptide as defined herein. The genome-encoded OmpA polypeptide may be modified using any suitable means known to those skilled in the art. Preferably, the mutation is located in the coding sequence and/or preferably the mutation results in the expression of a mutant OmpA polypeptide as defined herein.

Preferably, the genetically modified bordetella bacteria of the invention comprise a genomic modification in the sequence encoding a polypeptide having at least about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to SEQ ID No. 1, wherein the mutation results in increased expression of the mutant polypeptide produced by the OMV. Preferably, the mutation results in the expression of a mutant polypeptide as defined herein.

Preferably, the genetically modified bordetella bacteria of the invention comprise a genomic modification in a coding sequence having at least about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to SEQ ID No. 2, wherein the mutation results in increased expression of the mutant polypeptide produced by the OMV. Preferably, the mutation results in the expression of a mutant polypeptide as defined herein.

Preferably, the genetically modified bordetella bacteria of the invention comprise a genomic modification in a gene encoding a polypeptide having at least about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to SEQ ID No. 8, wherein the mutation increases OMV production.

Preferably, the genetically modified bordetella of the invention comprises a genomic modification in a gene encoding a polypeptide having at least about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to SEQ ID No. 9, wherein the mutation increases OMV production.

Preferably, OMV production is increased compared to bordetella which does not comprise a mutation as defined herein but is otherwise identical or substantially identical. OMV production is herein understood to be at least one of sOMV (spontaneous or natural OMV) production, dwmv (detergent OMV) production and nOMV (natural OMV) production. Preferably OMV production as defined herein refers to at least one of sOMV and dOMV production.

Preferably, OMV production is increased by at least about 1.5-fold, or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or at least about 100-fold. The increase in OMV production may depend on the bordetella strain comprising the mutation as defined herein.

Preferably, spontaneous or supernatant (sOMV) production or yield is increased by at least about 1.5-fold, or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or at least about 100-fold. Additionally or alternatively, the detergent OMV (dOMV) production or yield is increased by at least about 1.5-fold, or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or at least about 100-fold. Additionally or alternatively, natural OMVs (nomvs) are produced or produced at least about 1.5-fold, or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or at least about 100-fold. Additionally or alternatively, EDTA-extracted (eOMV) production or yield is increased by at least about 1.5-fold, or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or at least about 100-fold.

OMV production by bordetella may be determined using any conventional method known in the art. As a non-limiting example, the OMV production may be determined using the FM4-64 assay.

The modified bacteria are preferably Bordetella, preferably selected from the group consisting of Bordetella ansorpii, bordetella guanfaciens (Bordetella avium), bordetella bronchiseptica (Bordetella bronchialis), bordetella bronchiseptica (Bordetella bronchiseptica), bordetella flabilis, bordetella euphoria (Bordetella hinzii), bordetella choleraesuis (Bordetella holmesii), bordetella muralis, bordetella parapertussis (Bordetella parapertussis), bordetella pertussis, bordetella petri (Bordetella petrii), bordetella pseudoxini (Bordetella pseudohinzii), bordetella sputigena, bordetella trematum, bordetella tumbae and Bordetella tumulicola. Preferably, the bordetella used in the present invention is at least one of bordetella pertussis, bordetella parapertussis and bordetella bronchiseptica. Preferably, the modified bordetella is bordetella pertussis.

In a preferred embodiment, the modified bordetella is bordetella pertussis. Preferably, the genetically modified bacterium is a bordetella pertussis Tohama I strain or a derivative thereof. Preferably, the derivative Tohama I strain is a streptomycin resistant derivative of the Tohama I strain, and most preferably the genetically modified bacterium is derived from strain B213 or a derivative thereof. Alternatively, the genetically modified bacterium is a bordetella pertussis strain B1917 or B1920 or a derivative thereof.

Additionally or alternatively, the modified bordetella as defined herein may comprise at least one of the following mutations:

-a mutation resulting in expression of a mutant OmpA polypeptide as defined herein;

-a mutation that results in Prn93 (93 kDa pertactin) remaining in the outer membrane;

-a mutation resulting in heterologous acyltransferase activity;

-mutations that lead to detoxification of pertussis toxin (Ptx); and

-reducing or eliminating mutations in the expression of skin necrosis toxins (DNTs).

In one embodiment, a modified bordetella as defined herein may comprise the following mutations:

-a mutation resulting in expression of a mutant OmpA polypeptide as defined herein; and

-a mutation that results in Prn93 (93 kDa pertactin) remaining in the outer membrane.

-a mutation resulting in heterologous acyltransferase activity.

-mutations that lead to detoxification of pertussis toxin (Ptx).

In one embodiment, the modified bordetella as defined herein comprises the following mutations:

-a mutation resulting in heterologous acyltransferase activity;

-mutations that lead to detoxification of pertussis toxin (Ptx); and

Pertussis adhesion agent (93 kDa)

In one embodiment, the modified bordetella as defined herein further comprises a mutation resulting in Prn93 (93 kDa pertactin) remaining in the outer membrane, preferably resulting in Prn93 remaining in the OMV.

Pertactin (Prn) is a known protective antigen. Prn is a autotransporter that is cleaved by bordetella pertussis during growth. Modified bordetella as defined herein preferably comprises mutations that prevent autocatalytic cleavage, resulting in the full length Prn (93 kDa) remaining in OMVs rather than Prn (69 kDa) shedding in the environment.

The pertactin polypeptide preferably has at least about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to SEQ ID No. 5 and comprises a mutation that prevents autocatalytic cleavage. Preferably, the mutation is at position D738, which corresponds to position SEQ ID NO. 5. Preferably, the mutation is a substitution of a conserved amino acid residue. Preferably, the mutation is a substitution of Asp (D) to Asn (N), preferably a D738N mutation. Preferably, the mutant pertactin polypeptide has at least about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% sequence identity to SEQ ID No. 11.

Preferably, retention of Prn93 in OMVs increases the protective immunity of OMVs. The inventors found that retention of Prn93 in the outer membrane of OMVs surprisingly resulted in a significant increase in the immunogenicity of OMVs, for example when compared to the immunogenicity of the same amount of (purified) Prn in OMV combinations. Preferably, the protective immunity of OMVs comprising Prn93 in their outer membrane is increased by about 1.5, 2, 2.5, 3, 3.5 or at least about 4-fold compared to the protective immunity of the same or similar OMVs not comprising Prn93 in combination, the same or similar amount of (purified) pertactin. The protective immunity can be determined using any conventional means known in the art. Preferably, protective immunity is determined by intranasal administration challenge and determination of anti-Prn antibody concentration following mouse vaccination.

Acyltransferase

In one embodiment, the modified bordetella as defined herein further comprises heterologous acyl transferase activity. Thus, the modified bordetella preferably further comprises a modification introducing heterologous acyltransferase activity. Preferably, the modification is as described in WO2018/167061, which is incorporated herein by reference.

The modification that introduces heterologous acylase activity may confer at least one of heterologous LpxA and heterologous LpxD acylase activity on the cell.

Preferably, the modification introduces the expression of at least one of the heterologous lpxA and heterologous lpxD genes. Preferably, the modification introduces the expression of at least a heterologous lpxA gene. Preferably, the modification is a genomic modification.

Preferably, the heterologous lpxA gene has a nucleotide sequence encoding an lpxA acyltransferase that has at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% amino acid sequence identity with SEQ ID No. 6. The lpxA gene may be or may be obtained from Pseudomonas, preferably a Pseudomonas aeruginosa (Pseudomonas aeruginosa) species.

Preferably, the heterologous lpxD gene has a nucleotide sequence encoding an lpxD acyltransferase having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or at least about 100% amino acid sequence identity with SEQ ID No. 7. The lpxD gene may be obtained or obtainable from a pseudomonas species, preferably a pseudomonas aeruginosa species.

Preferably, the modified bordetella further comprises a genomic modification that reduces or eliminates the activity of the lpxA and/or lpxD acyltransferase encoded by the endogenous lpxA gene and/or endogenous lpxD gene, respectively.

The introduction of heterologous acyltransferase activity into bordetella has been shown in the art to reduce LPS endotoxicity. The inventors have now found that the introduction of heterologous LpxA acyltransferase in bordetella also increases OMV production, i.e. results in a high foaming phenotype. In particular, heterologous acyltransferase activity as defined herein surprisingly increases the production of at least one of ssomv and nOMV.

Pertussis toxin (Ptx)

Although pertussis toxin is secreted and therefore not part of the OMV, there is a small amount of potential for residue in or on the OMV. Thus, in one embodiment, the modified bordetella as defined herein further comprises a mutation that reduces or eliminates pertussis toxin (Ptx) toxicity. Preferably, the mutation results in reduced or eliminated toxicity of pertussis toxin having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID No. 5.

Any suitable method known in the art for partially or completely detoxifying Ptx is equally suitable for use in the present invention. As a non-limiting example, one or more mutations may be introduced into the Ptx gene that result in a partially or fully detoxified Ptx. These one or more mutations may be point mutations, such as, but not limited to, point mutations that may result in inactivation of the enzymatic site in Ptx subunit 1. Such mutations can prevent or reduce leukocytosis in mice, and the like. Preferred mutations are located at R43 and/or E163, preferably at position 43 and/or at position 163, preferably at R43K and/or E163G of the amino acid sequence SEQ ID NO. 12.

Skin necrosis toxin (DNT)

Bordetella OMVs may contain small amounts of the cytoplasmic protein skin necrosis toxin (DNT), and residual DNT may contribute to the reactivities of OMVs. DNT is so named because it can cause necrotic skin lesions when injected subcutaneously in mice. In one embodiment, the modified bordetella as defined herein further comprises a mutation resulting in reduced or complete absence of DNT expression. Preferably, the DNT has a sequence having at least about 80%, 85%, 90%, 95%, 96%, 97%, 99% or 100% sequence identity to SEQ ID NO. 10.

As non-limiting examples, DNT gene expression may be reduced by knocking down or knocking out the gene encoding DNT, such as, but not limited to, genomic modifications to elements controlling DNT expression and/or genomic modifications to sequences encoding DNT.

Outer Membrane Vesicle (OMV)

In another aspect, the invention relates to bordetella OMVs obtainable or obtained from modified bordetella as defined herein.

In one aspect, the invention relates to OMVs comprising a modified polypeptide as defined herein, preferably said OMVs are bordetella OMVs.

OMVs (also known as "vesicles (bleb)") for use in vaccines, for example, have traditionally been prepared by detergent extraction (dcmv purification procedure) in which a detergent such as deoxycholate is used to remove LPS and increase vesicle release. OMV formulations prepared by cell sonication and DOC treatment in combination with alum adjuvants provided protection against pertussis challenge in a mouse model [ Roberts, r., vaccine 2008,26,4639-4646], with effects comparable to those of whole cell vaccines. Another OMV containing PagL deacylated modified LPS showed protective effects and lower reactivities, the latter determined in vivo by weight gain and cytokine induction [ Asensio, c.j., vaccine 2011,29,1649-1656]. Another interesting finding concerning Bode parapertussis OMVs is their cross-protection against pertussis and parapertussis [ Bottero, D.vaccine 2013,31,5262-5268].

Above a certain threshold, the wild-type LPS of bordetella may be toxic, and detergents may be used to remove the wild-type LPS, for example during OMV extraction. Alternatively or additionally, LPS may be modified to reduce endotoxin. Thus in one embodiment, the bordetella and/or OMV of the invention comprise a modified LPS with reduced toxicity. As a non-limiting example, modified LPS with reduced endotoxicity may be obtained by introducing heterologous acyltransferase activity in bordetella, as described in WO 2018/167061. The modified LPS from such modified Bode bacteria preferably has a modified lipid A moiety compared to the lipid A moiety of the wild-type Bode bacteria LPS, because of the shorter length of at least one acyl chain. Preferably, the acyl chain at position 3 of the modified lipid A moiety is not longer than the acyl chain at the same position 3 of the wild type B.bordetella lipid A moiety, preferably modifiedIs not longer than C ₁₀ Wherein more preferably the acyl chain length at position 3 of the modified lipid A moiety is the same as the acyl chain length at position 3 of the lipid A moiety of wild-type B.bordetella, preferably the acyl chain length at position 3 is C ₁₀ . Preferably, the shorter acyl chain is selected from the following:

i) An acyl chain at the 3' position of the lipid a moiety;

ii) a primary acyl chain at the 2' position of the lipid a moiety;

iii) A secondary acyl chain at the 2' position of the lipid a moiety; and

iv) acyl chain in the 2 position of lipid A moiety.

Additionally or alternatively, bordetella of the present invention have or have increased 3-O-deacylase activity, e.g. as described in WO/2006/065139, which is incorporated herein by reference. Preferably, such modified bordetella comprises 3-O-deacylated LPS.

The bordetella LPS with reduced endotoxicity may be present in OMVs at higher concentrations than the toxic wild-type LPS. Thus, OMVs as defined herein may be obtained by extraction from bordetella detergents or spontaneous release.

Preferred OMVs comprising bordetella according to the invention may be supernatant or spontaneous OMVs, i.e. somvs as defined above, or natural OMVs, i.e. nomvs as defined above. Alternatively, OMVs are detergent extracted OMVs, i.e. domvs as defined above.

In a further aspect, the invention relates to a method for producing OMVs, preferably OMVs as defined herein. Preferably, the method comprises the steps of: i) Culturing a bordetella bacterial flora as defined herein under conditions conducive to OMV production; and optionally recovering OMVs.

Methods of making dOMVs, sOMVs, and nOMVs are described in van de Waterbeemd et al (2010) and van de Waterbeemd et al (2013) (van de Waterbeemd B et al, vaccine.2010;28 (30): 4810-6 and van de Waterbeemd B., PLoS one.2013; 8 (5): e 65157), and WO2013/006055, all of which are incorporated herein by reference.

The method of generating OMVs may be any conventional detergent extraction method. Alternatively, the extraction method may be a detergent-free extraction method, for example as described in WO/2013/006055. It is understood herein that OMV production methods other than detergent extracted OMVs do not preclude the use of low concentration detergents and/or the use of mild detergents.

The OMV production of modified bordetella as defined herein is increased compared to OMV production of otherwise identical bordetella without modification as defined herein. Preferably, OMV production is increased by at least about 1.5-fold, or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or at least about 100-fold.

Composition and method for producing the same

In one aspect, the invention relates to a composition comprising modified bordetella as defined herein and at least one of OMVs as defined herein.

Preferably, the composition is a pharmaceutical composition. The pharmaceutical compositions may comprise pharmaceutically acceptable excipients, carriers, vehicles, or delivery vehicles generally known in the art (see, e.g., "Handbook of Pharmaceutical Excipients", edited by Rowe et al, 7 th edition, www.pharmpress.com). Pharmaceutically acceptable stabilizers, osmotic agents, buffers, dispersing agents, and the like may also be incorporated into the pharmaceutical composition. The preferred form of the composition depends on the intended mode of administration and therapeutic application. The pharmaceutical carrier may be any compatible, non-toxic substance suitable for delivery to a patient.

Examples of pharmaceutically acceptable carriers for parenteral delivery are sterile buffered 0.9% NaCl or 5% glucose, optionally supplemented with 20% albumin. Alternatively, the active ingredients of the present invention may be suspended in Phosphate Buffered Saline (PBS). Formulations for parenteral administration must be sterile. The parenteral route of administration of the active ingredients of the invention is by known methods, for example by injection or infusion by intravenous, intraperitoneal, intramuscular and intraarterial or intralesional routes. Alternatively, the composition may be administered by inhalation. The composition may be administered continuously by infusion or bolus injection. Preferably, the composition is administered by bolus injection. Typical pharmaceutical compositions for intramuscular injection will be formulated as phosphate buffered saline containing, for example, 1-10ml of the active ingredient of the present invention in an effective dose. Methods for preparing parenterally administrable compositions are well known in the art and are described in more detail in various sources, including, for example, "Remington: the Science and Practice of Pharmacy "(ed. Allen, l.v. 22 nd edition 2012, www.pharmpress. Com). The "active ingredient of the present invention" is herein understood to be at least one of modified bordetella and OMV as defined herein.

Modified bordetella as defined herein may be attenuated or inactivated bordetella. The bordetella may be inactivated using any conventional method known in the art for inactivating bacteria, such as, but not limited to, further genome modification of bordetella, chemical treatment or heat inactivation of bordetella. The preferred chemical inactivation is formaldehyde treatment.

The composition may also comprise at least one additional antigen, preferably at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additional antigens. Preferably, the composition may further comprise at least one additional non-bordetella antigen, preferably at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additional non-bordetella antigens.

The composition of the present invention may further comprise 1, 2, 3 or more antigens of bordetella bacteria. The composition may further comprise an inactivated bordetella toxin, alone or in combination with other bordetella components such as filiform hemagglutinin, pilus antigen and pertactin.

It is understood herein that these components may be added alone to a composition comprising at least one of modified bordetella and OMV, or that one or more of these components are part of modified bordetella and OMV in the composition.

The composition may further comprise one or more adjuvants. An adjuvant may be present in at least one of the modified bordetella and OMV. Alternatively or additionally, an (additional) adjuvant may be added to the composition comprising at least one of the modified bordetella and OMV. The adjuvant may be an organic adjuvant or an inorganic adjuvant. Preferred inorganic adjuvants are aluminum salts such as, but not limited to, aluminum phosphate and aluminum hydroxide. Preferred organic adjuvants may be modified LPS, preferably modified Neisseria or Bode LPS, modified LOS, squalene, QS21 or monophosphoryl lipid A (MPL).

The composition as defined herein may be a bordetella vaccine.

Medical application

In one aspect, the invention relates to a composition comprising at least one of modified bordetella as defined herein and OMVs as defined herein for use as a medicament. In other words, the present invention thus relates to the use of at least one of the modified bordetella of the present invention, the OMV of the present invention and the pharmaceutical composition of the present invention as a medicament. The invention also relates to a method of treatment using at least one of modified bordetella, OMV and pharmaceutical composition as defined herein.

In another aspect, the invention relates to a composition comprising at least one of modified bordetella and OMV as defined herein for use in therapy, comprising inducing an immune response in a subject. Alternatively, the invention relates to a composition comprising at least one of modified bordetella and OMV as defined herein for use in therapy, comprising stimulating an immune response in a subject. In particular, the invention thus relates to a method of vaccination. Preferably, the immune response is induced or stimulated against bordetella infection.

In one aspect, the invention relates to a composition as defined herein for use in the treatment or prevention of bordetella infection. For this purpose, three species of bordetella are known to be human pathogens (bordetella pertussis, bordetella parapertussis and bordetella bronchiseptica). Thus, the bordetella infection is preferably at least one of bordetella pertussis, bordetella parapertussis and bordetella bronchiseptica infection, preferably a bordetella pertussis infection.

Bordetella pertussis and occasionally bordetella parapertussis cause pertussis or tussive cough in humans, and some bordetella parapertussis strains may colonise sheep. Bordetella bronchiseptica rarely infects healthy people, but the disease has been reported in immunocompromised patients. Bordetella bronchiseptica causes a variety of diseases in other mammals, including kennel coughing and atrophic rhinitis in dogs and pigs, respectively. Other members of this genus cause similar diseases in other mammals and birds (bordetella xintzfeldt-jakob (b. Hinzii), bordetella guanylate (b. Avium)).

Most preferably, an immune response is induced or stimulated against bordetella pertussis infection. In a further preferred embodiment, the present invention relates to a composition as defined herein for use in the treatment or prevention of tussive cough. For this purpose, the subject is not vaccinated or may have been vaccinated with bordetella before. It should also be noted that the terms "pertussis", "pertussis" and "pertussis (100-day cough)" are used interchangeably herein.

In a preferred embodiment, the pharmaceutical composition of the invention is a vaccine. The vaccine may be a cell-free vaccine preferably comprising OMVs as defined herein. Alternatively, the vaccine is a whole cell vaccine comprising at least modified bordetella as defined herein.

The present invention relates to a (pharmaceutical) composition for the treatment or prevention of bordetella infection, wherein the composition is a whole cell vaccine comprising a modified bordetella as defined herein. The modified bordetella of the present invention may be a live bacterium or a live attenuated bacterium or a non-live bacterium. Preferably, the bacteria are inactivated or killed using means known per se in the art. For example, modified bordetella may be inactivated by freezing, heat treatment, mechanical disruption, chemical treatment or other methods known in the art of pharmacy and vaccination (see e.g. J.L.pace, H.A.Rossi, V.M. Esposito, S.M. Frey, K.D.Tucker, R.I.Walker.Inactivated whole-cell bacterial vaccines: current status and novel strategies.vaccine 16:1563-1574 (1998)). Preferably, the bacterium is bordetella pertussis, bordetella parapertussis or bordetella bronchiseptica, most preferably bordetella pertussis.

In an alternative preferred embodiment, the (pharmaceutical) composition according to the invention is a cell-free vaccine comprising OMVs as defined herein.

In another embodiment, the invention relates to a composition as defined herein for use as a medicament or for use in a treatment comprising inducing or stimulating an immune response in a subject, wherein the composition further comprises at least one non-bordetella antigen. The antigen is any antigen as defined herein. In particular, the bordetella vaccine may be combined with other vaccines known in the art. In a preferred embodiment, the bordetella vaccine is combined with at least one of a diphtheria vaccine and a tetanus vaccine. In one embodiment, the bordetella vaccine is combined with a diphtheria vaccine and a tetanus vaccine.

The pharmaceutically acceptable compositions and vaccines according to the present invention are useful in methods of treating a subject suffering from or at risk of acquiring a bordetella infection comprising administering at least one of a pharmaceutical composition, a whole cell vaccine and a cell free vaccine according to the present invention. The particular adjuvants used, the relative and absolute amounts of materials in the composition, and the dosage regimen to be administered are known or determinable by the skilled artisan and may be adjusted according to, for example, the particular pathogen infection or the condition of the particular subject to be treated, and the like. The dosage regimen may include a single dose but may also include multiple doses, e.g., booster doses, and may preferably be administered orally, intranasally, or parenterally. Various dosage regimens for vaccination purposes are known in the art and can be appropriately adjusted by the skilled person.

Other aspects

In one aspect, the invention relates to a method of producing a modified bordetella or OMV of the invention. The method preferably comprises the steps of: a) Culturing a modified bordetella as defined herein; and optionally b) at least one of purifying and inactivating said modified bordetella. OMVs may be extracted and/or purified in addition to step b), or instead of step b). Methods for purifying and inactivating bordetella are well known in the art. Similarly, the purification/extraction of OMVs may be performed using any suitable method known in the art.

In one aspect, the invention relates to the production of a vaccine formulation comprising at least one of preferably inactivated modified bordetella and OMV as defined herein. The method preferably comprises the steps of: a) Culturing a modified bordetella as defined herein; b) Purifying and inactivating at least one of the genetically modified bacteria, and c) formulating the modified at least one of bordetella and OMV, optionally together with other vaccine components, into a vaccine formulation. In addition to step b), or instead of step b), OMVs may be extracted and/or purified prior to step c).

It will also be appreciated that the use of the composition in the treatment of a medical condition as specified herein also includes the use of the composition in the manufacture of a medicament for use in a corresponding medical treatment, and a method of treating a subject suffering from such a medical condition by administering to the subject an effective amount of the composition.

In one aspect, the invention relates to bordetella, preferably bordetella pertussis, comprising a mutation resulting in Prn93 (93 kDa pertactin) remaining in the outer membrane. The bordetella may further comprise at least one of the following mutations:

-a mutation resulting in heterologous acyltransferase activity;

-mutations that lead to detoxification of pertussis toxin (Ptx); and

In one embodiment, the invention relates to OMVs obtainable from said bordetella, wherein preferably said OMVs have increased or improved immunogenicity, e.g. compared to the immunogenicity of the same amount of (purified) Prn as the OMVs combination.

In a further embodiment, the present invention relates to the production, use and compositions comprising at least one of OMV and bordetella, preferably as defined above with respect to modified bordetella comprising an OmpA mutation.

In one aspect, the invention relates to bordetella, preferably bordetella pertussis, comprising a mutation resulting in heterologous acyltransferase activity. The modified bordetella preferably expresses a protein having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% sequence identity to SEQ ID No. 6 (LpxA) or SEQ ID No. 7 (LpxD). The bordetella may further comprise at least one of the following mutations:

-mutations that lead to detoxification of pertussis toxin (Ptx); and

In one embodiment, the invention relates to a method of producing OMVs, wherein the method comprises the step of culturing a population of bordetella bacteria under conditions conducive to the production of OMVs, wherein the bordetella bacteria have heterologous acyltransferase activity as defined herein, and optionally recovering OMVs. Preferably, the method of producing OMVs is the same as or similar to the method of producing OMVs from modified bordetella comprising an OmpA mutation, as described above.

In one aspect, the invention relates to bordetella, preferably bordetella pertussis, comprising a mutation resulting in detoxification of pertussis toxin (Ptx). The bordetella may further comprise at least one of the following mutations:

-a mutation resulting in heterologous acyltransferase activity; and

In one aspect, the invention relates to bordetella, preferably bordetella pertussis, comprising a mutation that reduces or eliminates expression of dermonecrotic toxin (DNT). The bordetella may further comprise at least one of the following mutations:

-a mutation resulting in heterologous acyltransferase activity; and

All patent and literature references cited in this specification are incorporated herein by reference in their entirety.

The following examples are for illustration only and are not intended to limit the scope of the invention in any way.

Table 1: sequence identifier

SEQ ID NO.	Description of the invention
		1	Bordetella pertussis ompaa
2	Bordetella pertussis OmpA nt. (wt)
		3	Bordetella pertussis OmpA D124N mutation a.a.
4	Bordetella pertussis OmpA D124N mutant nt.
		5	Bordetella pertussis pertactin a.a. (wt.)
6	LpxA Pseudomonas aeruginosa a.a.
		7	LpxD Pseudomonas aeruginosa a.a.
8	Bordetella parapertussis OmpA a.a.
		9	Bordetella bronchiseptica OmpA a.a.
10	Bordetella pertussis DNT a.a.
		11	Bordetella pertussis pertactin D738N mutation a.a.
12	Pertussis bordetella toxin (wt)

Drawings

FIG. 1: schematic overview of isolation of sOMVs from bordetella pertussis cultures. Unless otherwise indicated, sOMVs were isolated from 200ml cultures after about 30 hours of growth under standard laboratory conditions. From this sOMV isolation procedure, 22 μm sterile filtered supernatant, centrifuged +22 μm sterile filtered supernatant and purified sOMV preparation were obtained. Samples were stored at 4 ℃ prior to the ssomv identification experiment.

Fig. 2: sOMV concentration of isolated sOMV preparations obtained from bacterial cultures of B1917 (Wt), B1917/OmpA-D124N, B1917/BP2019-D50N and B1917/OmpA-D124N/BP2019-D50N of bordetella pertussis. The bacterial culture was grown at 200rpm at 35℃for about 30 hours. The sOMVs were isolated from 200ml of culture and concentrated to 1ml. The concentration of sOMVs determined by the FM4-64 assay was corrected for the concentration factor to obtain the original sOMVs concentration, P >0.0001. The grey border line represents two separately grown bacterial cultures.

FIG. 3: effect of stress on Botrytis pertussis B1917/Wt, B1917/OmpA-D124N, B1917/BP2019-D50N and B1917/OmpA-D124N/BP2019-D50N secretion of sOMVs. sOMV concentration was directly recovered simultaneously with the sample by the FM4-64 assayThe collected sterile filtered supernatant samples were assayed to measure OD and pH. Growing B1917 (Wt), B1917/OmpA-D124N, B1917/BP2019-D50N and B1917/OmpA-D124N/BP2019-D50N in 200ml of medium at 35℃for about 30 hours at 200rpm with or without stress treatment, P<0.0001. A) sOMV secretion under stress conditions based on sterile filtered supernatant after about 30 hours of growth, and B) sOMV secretion under non-stress conditions based on sterile filtered supernatant after about 30 hours of growth.

Fig. 4: sOMV concentration of isolated sOMV preparations obtained from bacterial cultures of B213 (Wt), B213/PagL-KI, B213/BP2329-KO and B213/OmpA-D124N of bordetella pertussis. The bacterial culture was grown at 200rpm at 35℃for about 30 hours. The sOMVs were isolated from 200ml of culture and concentrated to 1ml. The concentration of the sOMV determined by the FM4-64 assay was corrected for the concentration factor to obtain the original sOMV concentration, P <0.01, P <0.001.

FIG. 5: protein concentration measured in isolated sOMV preparations obtained from bacterial cultures of the B213 mutant of Bordetella pertussis compared to the corresponding wild-type and OmpA-D124N mutants. The bacterial culture was grown at 200rpm at 35℃for about 30 hours. The sOMVs were isolated from 200ml of culture and concentrated to 1ml. Protein concentration was determined by BCA assay and corrected for the original volume of bacterial culture, P>0.05，**P>0.01，****P>0.0001. Protein concentration measured by BCA in sOMV preparations of B213 (Wt), B213/PagL-KI, B213/BP2329-KO and B1917/OmpA-D124N.

Fig. 6: LPS concentrations were normalized to 25. Mu.g of purified sOMVs secreted by B213/PagL-KI and B213/BP2329-KO from B213/PagL-KI of Botrytis pertussis compared to the corresponding wild-type and OmpA-D124N mutants. The bacterial culture was grown at 200rpm at 35℃for about 30 hours. The sOMVs were isolated from 200ml of culture and concentrated to 1ml. LPS concentration was determined by the phenol sulfuric acid method, normalized to 25. Mu.g protein and corrected according to concentration coefficient to obtain the original LPS concentration/25. Mu.g protein. * P >0.05, P <0.001.LPS concentrations were normalized to 25 μg sOMV protein from sOMV preparations of B213 (Wt), B213/PagL-KI, B213/BP2329-KO and B213/OmpA-D124N.

FIG. 7: lpxA mutant increased OMV production. A 50ml culture volume was centrifuged at 3000rpm for 30 minutes to separate the ssomv from the biomass. The supernatant containing sOMVs was sterile filtered by a Nalgene vacuum system and treated by an Ultracentrifugation (UC) step at 125000Xg for 90 minutes at 4 ℃. Finally, the sOMV pellet was resuspended in 2.5ml of terminal buffer (0.01M Tris+3% sucrose, pH 7.4). The precipitated biomass of the culture after the centrifugation step is further processed into eOMV. The pellet of the harvest was resuspended in 9ml 0.1M Tris buffer pH8.6 containing 0.1M EDTA and incubated at room temperature for 30 min while stirring to extract eOMVs. After incubation time, the suspension was transferred to a UC tube and the cells were separated from eOMV by centrifugation at 23500×g for 15 minutes at 4 ℃. The supernatant containing eOMV was sterile filtered through a Nalgene vacuum system and the eOMV was precipitated again by centrifuging UC at 125000×g for 90 minutes at 4 ℃. Finally, the eOMV pellet was resuspended in 2.5ml of terminal buffer. Total protein concentration of sOMV and eOMV fractions was analyzed by Peterson, DNA concentration by PicoGreen, protein pattern by SDS-PAGE, protein composition by MS and OMV size by DLS. Yields are shown as OMV particles per volume.

FIG. 8: protective immunity increases after Prn is retained on the OMV outer membrane. Mice were immunized with OMVs on day 0 and day 14 and challenged with bordetella pertussis on day 28. A) Lung colonization. Lung colonisation was analysed on day 35. Regression analysis of lung colonization after infection of mice with 16, 4 or 1 μg OMV-WT (grey line) and 16, 4 or 1 μg OMV-Prn93 (black line) were immunized (sc) twice. Lung colonization after immunization with Prn-OMV was significantly reduced 4.0 (2.4-6.3) fold compared to WT-OMV (a). B) anti-Prn antibody response. The addition of 3 μg of purified Prn to omv-WT at a 1 Human Dose (HD) increased the anti-Prn antibody response 10-fold compared to omv-WT alone, but retaining the same amount of Prn in the outer membrane of omv-Prn at 1HD increased the anti-Prn antibody response 100-fold.

Examples

1. Strain history

Bordetella pertussis B1917 (b.p.b 1917) is a clinical isolate from a patient in the three year old netherlands suffering from tussive cough (Mooi, f.r., et al, bordetella pertussis strains with increased toxin production associated with pertussis resurgence. Emerg information Dis 2009.15 (8): p.1206-13). In order to adapt B.p.B1917 to genetic engineering using the reverse selectable suicide vector pSS1129 (Stibitz, S, supra), a mutant strain (Strep) resistant to streptomycin was isolated ^R ). This mutant was subsequently used to isolate a nalidixic acid resistant mutant (Nal ^R ) And this clone was used as a starting material for the construction of the following strain.

2. Strain construction

2.1 Strain construction overview

Using genetic engineering, several mutations were introduced in the b.p.b1917 genome;

ompa-D124N: amino acid change D124N in outer membrane protein a (OmpA).

prn-D738N: amino acid change D738N in pertactin (Prn).

3.LpxA ^Pa : lpxA was replaced with its homolog from Pseudomonas aeruginosa.

PtxA-R43K-E163G: amino acid changes R43K and E163G in pertussis toxin subunit 1 (PtxA).

5. Deletion of the dermonecrotic toxin (Dnt) coding sequence.

A detailed overview of the mutations is given in table 2.

Table 2: B.p.B1917 (Strep) ^R ，Nal ^R ) Summary of the mutations introduced in (a)

¹ Coordinates are based on the b.p.b1917 genomic sequence (GenBank accession number: CP 009751). Nucleotide mutations are shown as "original nucleotide-coordinates in CP 009751-new nucleotide", e.g. 'g3,092,8238a' indicating a change of guanidine residue to adenine residue at position 3,092,828.

² Amino acid changes are shown as "original amino acid-residue number-new amino acid", using IUPAC single letter code.

2.2 genetic engineering of B.p.B1917 Using the reverse selectable suicide vector pSS1129

All mutations were introduced into bordetella pertussis B1917 (Strep) using the reverse selectable suicide vector ps 1129 (stibatz, S, supra) ^R ，Nal ^R ) Is defined in the genome of the cell line. The construct (and the primers required for its construction) was first designed using a computer using SnapGene (GSL Biotech, chicago, USA). The construct OmpA-D124N, prn-D738N, ptxA-R43K-E163G and DeltaDnt was created by overlap extension PCR (Horton, R.M., et al, engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene,1989.77 (1): p.61-8), for which primers were ordered in Eurofins MWG (Ebersberg, germany). By computer design of construct LpxA ^Pa Then synthesized by GenScript (nanjin, china) and cloned into pUC 57. Details of specific PCR and cloning procedures are described in the following paragraphs separately for each construct.

All constructs were finally cloned into suicide vector pSS1129 and then transformed into e.c.sm10. The pSS1129 plasmid with the construct can be transferred from E.c.SM10 to B.p.B1917 by conjugation (Strep) ^R ，Nal ^R ) This resulted in uptake of the linear plasmid by b.p.b1917. This may lead to homologous recombination in the b.p.b1917 genome and uptake of the complete plasmid due to homology between the plasmid and the construct on the b.p.b1917 genome. Cells that have integrated the plasmid into their genome can be selected because they are resistant to ampicillin/gentamicin and sensitive to streptomycin (only the genome recombinants survive because pSS1129 cannot replicate as a plasmid in b.p.b1917). After genomic uptake of the plasmid, the cell contains both a construct designed to introduce a genomic change in a gene and a wild-type version of the gene.

Successful first cross-clones were plated on streptomycin, so that spontaneous streptomycin resistant clones could be obtained. These clones are typically the result of a crossover between the introduced construct and the wild-type version of the targeted gene.

If the second recombination occurs on the other side of the mutation introduced by the first recombination, the recombinants carry the mutated version of the gene. Successful incorporation of the desired mutation in the second cross clone was verified by PCR. The detailed cloning procedure of OmpA is summarized below. Other mutations described in table 2 were generated using similar standard molecular biology techniques known in the art. The mutations were introduced into strain B213 and strain B1917.

2.2.1 OmpA-introduced amino acid substitution D124N

Several amino acids in OmpA were substituted and the effect of these mutations on OMV formation was investigated. The R139A and R139L substitutions in bordetella pertussis OmpA appeared to be fatal (data not shown). Furthermore, a complete knockout of OmpA or a knockout of one of OmpA homologs BP2019 and BP3342 would result in a mortality.

The D124N substitution was found to surprisingly result in viable cells and increased OMV formation. Notably, the same substitution at the corresponding position in homolog BP2019 (D50N) produced living cells, but did not have any effect on OMV production, whereas the substitution at the corresponding position in homolog BP3342 (D100N) appeared to be fatal.

Creation of mutagenesis construct introducing point mutations by overlap extension PCR resulted in amino acid change D124N in OmpA (Horton, r.m., et al, supra). Genomic DNA of p.B1917 was used as template, PCR Ia was performed using primer pair B1917-OmpA-Fw/OmpA-D124N-Rv and PCR Ib was performed using primer pair OmpA-D124N-Fw/B1917-OmpA-Rv (see Table 3 for primer sequences). In contrast to the B.p.B1917 genome, the primers OmpA-D124N-Fw and OmpA-D124N-Rv contain point mutations, approximately half of each primer. Thus, both PCR products Ia and Ib contain the same mismatches as the B.p.B1917 genome. A mixture of PCR products Ia and Ib was used as a template for PCR II, using primer pair B1917-OmpA-Fw/B1917-OmpA-Rv. The resulting amplicon was a copy of region 3,092,271-3,093,392 (GenBank CP 009751), except for the mutation g3,092,8238 a that resulted in amino acid change D124N in OmpA.

The PCR II amplicon was ligated into a linear pGEM-T Easy vector (Promega) using TA cloning, yielding pGEM-T easy+PCR II. After amplification in E.c.JM109, the plasmid was digested with EcoRI and the 1007bp band was purified and then ligated into EcoRI-digested pSS 1129. The resulting pSS1129+OmpA-D124N was then transformed in E.c.SM10 cells and the successful transformants were stored as glycerol stocks.

Plasmid pSS1129+OmpA-D124N was moved from E.c.SM10 to B.p.B1917 Nal by ligation ^R 、Strep ^R . Mutations were then incorporated into the b.p. genome using a two-step antibiotic selection procedure. Two successful second cross clones identified by sequencing were stored as glycerol stocks.

Table 3: primers for OmpA-D124N overlap extension PCR and sequencing

Primer name	Sequence (5')>3’)	For use in	SEQ ID NO:
				B1917-OmpA-Fw	ggtcaatgcaacggtctagg	Overlap extension PCR (PCRs Ia and II)	13
OmpA-D124N-Rv	gccgatcgagttcgtgtggccaac	Overlap extension PCR (PCR Ia)	14
				OmpA-D124N-Fw	ttggccacacgaactcgatcgg	Overlap extension PCR (PCR Ib)	15
B1917-OmpA-Rv	atgctctccgacaggatg	Overlap extension PCR (PCRs Ib and II)	16
				OmpA-seq-Fw	cgtatgtaaggatgaacc	Sequencing	17
OmpA-seq-Rv2	tgttcgagcatttccatg	Sequencing	18

Bold: codon changes compared to the b.p.b1917 genome.

Bold and underlined: nucleotide changes compared to the b.p.b1917 genome.

2.3 analysis of the secretion of sOMV by Bordetella pertussis and mutants

Bordetella pertussis and mutants were screened for their growth performance and sOMV secretion properties. Optical density (590 m) and pH were measured at specific time points (T) to identify growth performance and ssomv secretion of the various B213 and B1917 mutants compared to the corresponding wild type. Various assays were used to quantify and identify sOMVs secreted into the supernatant by bordetella pertussis and mutants. Based on lipid content, the sOMV concentration was quantified by the N- (3-triethylammonium propyl) -4- (6- (4- (diethylamino) phenyl) hexanetrienyl) pyridine dibromide (FM 4-64) assay. The second method was used for the sOMV quantification, i.e. the biquinolinecarboxylic acid (BCA) assay, whereas the size of sOMV was measured by Dynamic Light Scattering (DLS). The LPS concentration of sOMV was determined by the phenol sulfuric acid method. Finally, the various proteins within secreted sOMVs were determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

2.3.1. Bordetella pertussis and inoculation and culture of mutant strains

Visible amounts of bacteria collected by sterile swabs grown in BG agar plates supplemented with 300 μg/ml streptomycin were used for preculture inoculation. The preculture can also be inoculated by means of seed batches (seeds) prepared previously. This preculture was then used to inoculate the Main Culture (MC). Bordetella pertussis and mutants were grown in THIJS medium supplemented with 1% THIJS supplement. Precultures are always grown in 50ml medium in 125ml PBF (flat bottom flask), while main cultures are grown in 50ml (125 ml PBF), 100ml (250 ml baffled flask) or 200ml (500 ml PBF). Unless otherwise indicated, bacterial cultures were grown at 35℃and 200 rpm.

Standard laboratory conditions (stress free treatment)

Bacterial cultures were grown under standard conditions in THIJS medium supplemented with 1% THIJS supplement. The cultures were grown at 35℃and 200rpm without any form of stress. The MC was inoculated with the preculture resulting in an OD of 0.05 unless otherwise indicated.

-stress treatment

Since stress is known to be an important factor that may affect the growth and sOMV secretion properties of a variety of bacterial species, bacterial cultures of Bordetella pertussis and mutants were subjected to stress treatment to examine the effect of stress on growth and sOMV secretion properties. Stress treatments included temperature fluctuations and hypoxia, and results were obtained by collecting samples for OD (590 nm) and pH measurements, as well as samples for subsequent ssomv quantification. Samples for sOMV quantification during growth were sterile filtered through a 0.22. Mu.M filter. As a control for stress treatment, identical bacterial cultures of the corresponding strains were grown in parallel under standard laboratory conditions. The OD and pH values of these control cultures were measured only at the beginning and end of the growth period of about 30 hours, just as sterile-filtered supernatant samples were collected for subsequent ssomv quantification.

2.3.2. Collection of differently processed samples

Samples were also collected between growth phases at the beginning and end of the culture and in the case of growth curve performance. The sOMV concentrations of these samples were compared to each other and to the concentrations of the actually isolated sOMVs to determine the representatives of the different treated samples to actually secreted sOMVs of B.pertussis and mutant strains. The moments at which the various samples are collected during the process are shown in fig. 1. Samples were stored at 4 ℃ prior to use in the ssomv quantification and identification experiments.

Sterile filtered supernatant at 0.22. Mu.M

At the beginning and end of the growth phase, samples were collected from the bacterial cultures and filtered through a 0.22 μm filter (Millex-GV syringe filter) to remove cells. In the case of OD (590 nm) measurements, growth characteristics were identified in conjunction with screening for sOMV secretion properties during growth, 0.22 μm sterile filtered samples were collected every 2 to 3 hours. Samples were stored at 4 ℃ prior to the ssomv quantification experiments to ensure stability of the current ssomv.

Centrifugation in combination with 0.22. Mu.M sterile filtration

At the end of the growth phase, the bacterial culture was centrifuged at 1000 Xg for 30 minutes, followed by 0.22. Mu.M

Rapid-Flow ^TM A250 ml sterile filter unit was used for sterile filtration. Samples were stored at 4 ℃ prior to the ssomv quantification experiments to ensure stability of the current ssomv.

-isolated and purified sOMV

At the end of the growth phase, secreted sOMVs were isolated (section 2.3.4). Samples were stored at 4 ℃ prior to the ssomv quantification experiments to ensure stability of the current ssomv.

2.3.3. Measurement of growth Properties of bordetella pertussis and mutant strains

Bordetella pertussis and mutants were screened for growth characteristics by OD (590 nm) measurement. In addition, the pH was also determined. These measurements were performed at specific time points to identify their growth properties over time. The pH is monitored as it can affect the growth rate and can introduce stress. Bacteria were cultured in 50ml or 200ml of medium. Cultures are inoculated by preculture or seed lot.

sOMV isolation

Unless otherwise indicated, MC (200 ml) of the bordetella pertussis strain were grown under standard laboratory conditions. Bacterial cultures were harvested after about 30 hours to isolate the sOMVs. Figure 1 shows a schematic overview of the separation scheme. The mass of the culture was recorded and the product obtained after the sOMV isolation step was used to calculate the sOMV concentration of the original bacterial culture. Cultures were centrifuged at 1000×g at 20 ℃ for 30 min. The obtained precipitate was discarded, and the supernatant was then passed through 0.22 μm

Rapid-Flow ^TM A250 ml sterile filter unit was used for sterile filtration. Will be>A100 kilodalton (kDa) fragment was passed through the hollow fiber mPES +.>

The filtration module was concentrated to about 50ml. The concentrated product was made up to equal weight with Tris buffer consisting of 0.1M Tris, ph8.6, and then Ultracentrifuged (UC) at 125.000 x g at 4 ℃ for 90 min. The resulting pellet, which was assumed to contain sOMVs, was resuspended in a terminal buffer consisting of 0.01M Tris, pH 7.4. The sOMV preparation was stored at 4℃to ensure stability of the sOMV preparation for subsequent use in sOMV quantification experiments.

2.3.5. Lipid concentration as determined by the FM4-64 assay

FM4-64 is a dye that emits a fluorescent signal upon incorporation into the lipid environment, so that the concentration of the membrane contents can be determined to determine sOMV concentration, as described in the art. The membrane content in the supernatant was assumed to be the result of production of sOMVs by bordetella pertussis and the mutant strain. Standard curves were drawn using OMV stock solutions (B1917 WT). The stock solution contained a known concentration of detergent-stimulated OMVs (based on protein content) derived from the bordetella pertussis B1917 wild-type strain. The stock solution was diluted in THIJS medium to generate a standard curve ranging between 0.31 μg/ml and 10 μg/ml. THIJS medium and milliQ or PBS were included as negative controls. 50 μl of standard, control and sample were added in triplicate to a black 96-well microtiter plate (Greiner 655209, black flat bottom). FM4-64 dye was prepared by diluting FM4-64 (250. Mu.M) in MilliQ to a final concentration of 5. Mu.M. Mu.l of the prepared FM4-64 dye was added to each well and the fluorescent signal was measured immediately at 645nm and excited at 485nm (protocol: FM4-64 Synaptored 485 645). The concentration of sOMV (μg/ml) was calculated by equation using a standard curve.

2.3.6. Protein concentration as determined by BCA assay

Pierce BCA protein assay (Thermo Scientific) is a colorimetric assay that is commonly used to determine total protein concentration, as well as in supernatants. The protein content in the sample is assumed to be the result of the production of sOMVs by bordetella pertussis and the mutant strain. This assay uses a reduction reaction of copper (cu+2) to cu+1, which is the result of a biuret reaction of proteins in alkaline medium. Cu+1 was detected by BCA-containing reagent. Two BCA molecules bind to one cu+1 molecule, resulting in a change in color from pale blue to purple. The standard curve was prepared with Bovine Serum Albumin (BSA) ranging from 25. Mu.g/ml to 500. Mu.g/ml. Absorbance was measured at 562 nm. The actual concentration of protein was calculated using a standard curve equation.

2.3.7. Determination of LPS concentration by phenol sulfuric acid method

LPS is known as a natural adjuvant, which enhances the cellular immune response by stimulating B cell development, but also triggers T cells to produce interferon gamma (IFN- γ) and tumor necrosis factor TNF. Lipid a is the main component of LPS and acts as an adjuvant. Although LPS can have a stimulatory effect on the immune system, too high a concentration of LPS can also cause toxicity. The usual KDO assay for determining LPS concentration is not applicable to bordetella pertussis LPS, since bordetella pertussis LPS contains only a single KDO molecule. The phenol sulfuric acid method is used as an alternative to the LPS assay. This colorimetric method was used to measure the carbohydrate concentration within the sOMVs, which is believed to be related to LPS concentration in the art. To determine the concentration of LPS within sOMVs, standards were prepared from LPS isolated from Neisseria meningitidis Lpxl1 mutant at a known concentration of 0.39mg/ml and serial dilutions were prepared at concentrations ranging between 0.003mg/ml and 0.39 mg/ml. Mu.l of the isolated sOMV preparation and 50. Mu.l of standard were added to the minitube in duplicate. 150 μl sulfuric acid was added followed by 30 μl of 5% phenol. Subsequently, the tube was heated at 90℃for 5 minutes and then cooled at room temperature for 5 minutes. 200 μl was transferred to a flat bottom 96-well plate and OD was measured at 490 nm. The concentration of LPS in ssomv was calculated using standard curve equation.

2.3.8. Dynamic light scattering

The size (d/nm) of the isolated sOMVs was determined by DLS. Mu.l of sOMV preparation was added to the cuvette and placed in Zen 3600 of Zetasizer Nano Series from Malvern, inc. equipped with a 633nm red laser. The size was measured at 25 ℃.

2.3.9. Various proteins as determined by SDS-PAGE

SDS-page was performed to examine various proteins in the isolated sOMVs, and 10. Mu. l Lane Marker Reducing sample buffer (5X) (Thermo scientific) containing 3M Tris HCl, 5% SDS, 50% glycerol, 100mM Dithiothreitol (DTT) and a proprietary pink tracer dye was added to 40. Mu.l of the sample. The mixed sample was heated at 100deg.C for 10 minutes, then 10-15 μl was loaded into wells of NuPAGE Novex 4-12% Bis-Tris gel and run at constant 200 volts using 1% (2- (N-morpholino) ethanesulfonic acid (MES) buffer for 35 minutes, including

Sharp pre-stained protein standard was used as a marker. The gel was stained with coomassie blue (Imperial protein dye, thermo Scientific) for 2 hours and then destained in milliQ until coomassie blue background disappeared. The gel is scanned and the contrast adjusted to create a clearly visible band.

2.3.10. Statistics

Analysis of variance (ANOVA) was used to determine significant differences between different samples compared to the control. If a set of samples is compared to the overall control, the Tukeys test is used, while if significant differences are checked between all individual samples, the Dunnett test is used. If a comparison is made between only two samples, a non-paired T-test is applied. Only when P <0.05, the mutants were considered to have significant differences compared to the control or differently collected samples.

3. Results

Analysis of sOMV-producing Properties of the newly created bordetella pertussis B1917 mutant and the previously created bordetella pertussis B213LPS mutant

3.1sOMV concentration

The sOMV concentration of the isolated sOMV preparation was determined by FM4-64 assay and corrected for concentration coefficients to calculate the sOMV concentration of the original bacterial culture (FIG. 2). Compared to B1917 (Wt) (0.02. Mu.g/L.+ -. 0.10), B1917/OmpA-D124N did show an increase in sOMV secretion (315.21. Mu.g/L.+ -. 12.23), P <0.0001. (fig. 3 and data not shown). A significant increase in B1917/OmpA-D124N/BP2019-D50N (178.48. Mu.g/L.+ -. 6.98) was also observed, P <0.0001, compared to B1917 (Wt) (2.88. Mu.g/L.+ -. 0.11). No increase in sOMV concentration was observed in the isolated sOMV preparation of B1917/BP2019-D50N (FIG. 3).

3.2 sOMV secretion Properties during growth of B213/PagL-KI and B213/BP2329-KO compared to B213 (Wt) and B213/OmpA-D124N

The sOMV concentration was determined in sterile filtered supernatant samples collected during growth characterization. Several mutants were tested. Mutant B213-PagL-KI expresses the PagL gene. PagL is a lipid A-modifying enzyme that deacylates lipid A. Mutant B213/B2329-KO knocked out BP2329 glycosyltransferase, resulting in shortened oligosaccharides. Compared to B213 (Wt), B213/OmpA-D124N showed a significant increase in sOMV concentration, p <0.01 (FIG. 4). A reduction in sOMV secretion of B213/PagL-KI and B213/BP2329-KO was observed compared to B213 (Wt), p <0.01 and p <0.001, respectively.

3.3 identification of sOMV secretion properties of bordetella pertussis and mutants based on protein content.

In addition to identifying sOMV secretion based on lipid determination by FM4-64, a second method was applied. BCA assays were performed to quantify the protein content in isolated ssomv preparations obtained from bacterial cultures of the newly created bordetella pertussis mutants (B1917/BP 2019-D50N and B1917/OmpA-D124N/BP 2019-D50N) and the pre-created B213 LPS mutants (B213/PagL-KI and B213/BP 2329-KO) relative to the corresponding wild-type and OmpA-D124N mutants. For comparison of the results, the same isolated sOMV preparation as used previously during the FM4-64 assay was used.

3.3.1. Protein content of purified B1917/BP2019-D50N and B1917/OmpA-D124N secreted sOMVs compared to B1917 (Wt) and B1917/OmpA-D124N

The same trend was observed in protein content, as was determined by FM4-64 assay, as was observed previously for lipid content based ssomv concentrations (fig. 2). Protein content of isolated sOMV preparation of B1917/OmpA-D124N/BP2019-D50N (439.16. Mu.g/L.+ -. 21.28), increased protein content compared to corresponding B1917 (Wt) (217.07. Mu.g/L.+ -. 27.6), P <0.0001. A significant increase in B1917/OmpA-D124N (826.56. Mu.g/L.+ -. 15.45), a 6.4-fold increase and P <0.0001, was observed compared to B1917 (Wt).

3.3.2 protein content of purified sOMVs secreted by B213/PagL-KI and B213/Bp2329-KO compared to B213 (Wt) and B213/OmpA-D124N

Even the bordetella pertussis B1917 strain, the same trend was observed for protein content in the isolated ssomv formulation as shown previously for FM4-64 (fig. 4 and 5). A significant increase in protein content was observed for B213/OmpA-D124N (181.97. Mu.g/L.+ -. 6.7) compared to B213 (Wt) (155.99. Mu.g/L.+ -. 4.59). A reduction in protein content of both B213/PagL-KI (120.51. Mu.g/L.+ -. 5.48) and B213/Bp2329-KO (80.83. Mu.g/L.+ -. 4.55) was observed compared to B213 (Wt), this reduction in protein content being significant, P <0.01 and P <0.001, respectively.

3.4 identification of LPS content of sOMVs secreted by bordetella pertussis and mutants based on total carbohydrate concentration

LPS is a natural adjuvant that enhances the immune response by stimulating the production of IFN-gamma and TNF by T cells. The LPS concentration was determined to better understand the toxicity of the sOMVs secreted by the newly created bordetella pertussis mutant and the previously created B213LPS mutant (B213/PagL-KI and B213/BP 2329-KO). Both B213/PagL-KI and B213/BP2329-KO contain LPS-modified mutations, which may lead to increased sOMV production by accumulation of LPS-related structures in the periplasm, resulting in increased LPS concentration in secreted sOMVs. The LPS concentration of sOMV was determined using the phenol sulfuric acid method. The same isolated sOMV preparation as previously used for FM4-64 and BCA was used for LPS assay.

In order to be able to make a reliable comparison between the LPS concentration of the sOMVs secreted by the bordetella pertussis and the mutant strain, the LPS concentration was normalized to 25 μg protein. These protein concentrations were previously determined by BCA. An increase in LPS concentration was observed for strain B213 compared to strain B1917. The LPS concentrations of B213/BP2329-KO (0.66 mg/25. Mu.g protein.+ -. 0.02) and B213/PagL-KI (0.41 mg/25. Mu.g protein.+ -. 0.01) were significantly increased compared to B213 (Wt) (0.325 mg/25. Mu.g protein.+ -. 0.005). No significant increase was observed for B213/OmpA-D124N (0.272 mg/25. Mu.g protein.+ -. 0.005) (FIG. 6). For the B1917 mutants B1917/OmpA-D124N and B1917/OmpA-D124N/BP2019-D50N, there was no significant difference in sOMVs from the isolation procedure compared to B1917 (Wt) (data not shown).

Increased sOMV and eOMV production in OmpA mutant and LpxA mutant

Heterologous LpxA acyltransferase activity was introduced into bordetella pertussis to reduce LPS endotoxicity. Surprisingly, we observed that the introduction of heterologous acyltransferase activity increased OMV production (figure 7). OMV production by sOMV and eOMV is significantly increased after heterologous LpxA expression compared to wild type.

3.6 protective immunity enhancement after Prn remains on OMV outer membrane

The enhanced immunogenicity of membrane-bound prn93 was confirmed by comparing the mixture of OMV-prn93 and OMV-WT with purified prn69 (fig. 8). OMV-Prn93 contained about 3 μg Prn per human dose (50 μg), similar to acP (acellular pertussis vaccine). Comparison of specific anti-Prn antibody responses showed that OMV-Prn93 induced 10-fold higher anti-Prn antibody titres compared to 3 μg purified Prn69 of mixed OMV-WT. The protection against intranasal challenge following immunization of mice with OMV-WT or OMV-Prn was 4-fold better than OMV-Prn.

Claims

1. A polypeptide comprising a sequence having at least 50% sequence identity to SEQ ID No. 1 and comprising a mutation in an OmpA-like domain, wherein preferably the mutation is located at a position corresponding to any of positions 110-140 of SEQ ID No. 1, and wherein the polypeptide comprising the mutation increases OMV production when expressed in Bordetella (Bordetella) compared to an otherwise identical polypeptide not comprising the mutation.

2. The polypeptide according to claim 1, wherein said mutation is a mutation of a single amino acid residue.

3. Polypeptide according to claim 1 or 2, wherein the mutation is a substitution of an amino acid residue, preferably a substitution at position 124 corresponding to SEQ ID No. 1, preferably a D124N substitution.

4. A polynucleotide encoding a polypeptide as defined in any one of claims 1 to 3, preferably wherein said polynucleotide has at least 50% sequence identity to SEQ ID No. 4.

5. A bordetella bacterium comprising a genomic modification in a gene encoding a polypeptide having at least 50% sequence identity to SEQ ID No. 1, wherein preferably the modification is located in the open reading frame of the gene, and wherein preferably the modification increases OMV (outer membrane vesicle) production of bordetella compared to the same bacterium not comprising the modification.

6. The bordetella bacterium according to claim 5, wherein the genomic modification results in expression of a polypeptide as defined in any one of claims 1 to 3 and/or wherein the genomic modification is in a gene comprising a sequence having at least 50% sequence identity to SEQ ID No. 2.

7. The bordetella bacterium according to claim 5 or 6, wherein the bordetella bacterium is at least one of bordetella pertussis (b.pertussis), bordetella parapertussis (b.parapertussis) and bordetella bronchiseptica (b.bronchitica).

8. The bordetella bacterium according to any one of claims 5 to 7, wherein the bacterium further comprises a mutation in at least one of:

i) An endogenous gene encoding LpxA;

ii) an endogenous gene encoding pertactin.

9. The bordetella bacterium according to any one of claims 5 to 8, wherein the bacterium further comprises a mutation in at least one of:

i) An endogenous gene encoding Ptx; and

ii) an endogenous gene encoding DNT.

10. A bordetella OMV obtainable from a bordetella bacterium as defined in any one of claims 5 to 9, wherein the bordetella OMV preferably comprises a polypeptide as defined in any one of claims 1 to 3.

11. A method of generating OMVs, wherein the method comprises the steps of:

i) Culturing a population of bordetella bacteria as defined in any one of claims 5 to 9 under conditions conducive to OMV production; and

ii) optionally, recovering the OMV.

12. A composition comprising at least one of:

i) A bordetella bacterium as defined in any one of claims 5 to 9, wherein preferably the bacterium is an inactivated bacterium; and

ii) an OMV as defined in claim 10,

wherein preferably the composition is a pharmaceutical composition.

13. A composition according to claim 12 for use as a medicament.

14. A composition according to claim 12 for use in the treatment or prevention of bordetella infection, preferably bordetella pertussis infection.

15. Composition according to claim 12 or composition for said use according to claim 13 or 14, wherein said composition is a cell-free vaccine or a cellular vaccine, and wherein said composition preferably further comprises at least one non-bordetella antigen.