CN116411113A

CN116411113A - Transgenic component detection method based on CRISPR Cas enzyme gene editing technology

Info

Publication number: CN116411113A
Application number: CN202211644474.0A
Authority: CN
Inventors: 赵辉; 杨小亮; 段志强; 李峰; 郭安平
Original assignee: Sanya Research Institute Chinese Academy Of Tropical Agricultural Sciences; Shandong Shunfeng Biotechnology Co Ltd
Current assignee: Sanya Research Institute Chinese Academy Of Tropical Agricultural Sciences; Shandong Shunfeng Biotechnology Co Ltd
Priority date: 2021-04-09
Filing date: 2021-04-09
Publication date: 2023-07-11
Also published as: CN113817857A

Abstract

The invention relates to a transgene component detection method based on CRISPR Cas enzyme gene editing technology. The reaction system comprises the following components in parts by volume: 2 parts of 10xNE buffer 2.1 (50 mM sodium chloride, 10mM Tris-HCl, 10mM magnesium chloride, 100ug/ml bovine serum albumin, pH7.9/25 ℃), 1 part of 1uM leader sequence, 1 part of 1uM Lba cas12a, 1 part of RNase inhibitor, 1 part of RPA isothermal amplification product of transgenic plant DNA extract or plasmid lysate of transgenic plant, 1 part of reaction marker, and 13 parts of water. The invention provides a new technology and a method for detecting the nucleic acid of the transgenic plant, which can certainly promote the application research of the gene editing detection technology in the detection of the plant nucleic acid, and has important practical significance.

Description

Transgenic component detection method based on CRISPR Cas enzyme gene editing technology

Technical Field

The invention relates to the technical field of gene editing, in particular to a transgenic component detection method based on a CRISPR Cas enzyme gene editing technology.

Background

The advent of the DNA detection technology detect based on Cas12a (CRISPR DNA endonuclease) and the shrlock RNA detection technology based on Cas13a (CRISPR RNA endonuclease) in 2017-2019 opens up the way of using gene editing technology on a nucleic acid basis as a high-throughput, rapid, accurate, sensitive and easy-to-use detection technology, which is based on high-efficiency nucleic acid detection, and compared with the traditional monoclonal antibody protein detection technology, the gene editing detection technology enables efficient and rapid supervision of various plant viruses and transgenic plants with incomparable advantages. Currently, cas13 a-based in vitro nucleic acid detection techniques have been primarily employed in medicine and plant detection, exhibiting high sensitivity, accuracy; in vitro nucleic acid detection techniques based on Cas12a have been primarily used in medicine, but have not been applied to plant gene detection; neither CRISPR DNA endonuclease nor CRISPR RNA endonuclease has been reported for use in plant transgenic component detection. The CRISPR DNA endonuclease report detection technology has higher stability because the detection object is a DNA sequence, and is easier to be connected with the traditional detection technologies such as PCR, isothermal amplification and the like in plant gene detection.

Disclosure of Invention

In order to fully utilize the advantages of the CRISPR DNA endonuclease detection technology and fill the blank of the in-vitro nucleic acid detection technology based on Cas12a in plant gene detection, the invention utilizes Cas12a enzyme to detect the DNA component of transgenic plants and provides a novel technology and method for detecting the transgenic plants.

Specifically, the invention provides a transgenic component detection method based on CRISPR Cas enzyme gene editing technology, which comprises the following steps:

step S1: extracting plant DNA by a CTAB method;

step S2: preparing RPA isothermal amplification primers of DNA;

step S3: the reaction system was constructed as follows: each reaction system comprises the following components in parts by volume: 2 parts of 10xNE buffer 2.1, 1 part of 1uM guide and folding sequence, 1 part of 1uM Lba cas12a, 1 part of RNase inhibitor, 1 part of RPA isothermal amplification product of transgenic plant DNA extract, 1 part of reaction marker and 13 parts of water;

step S4: detection of plant transgenic components by techniques including, but not limited to, enzyme-labeled instrument, quantitative PCR instrument, or strip chromogenic techniques; the method is used for detecting the HPT gene of the plant transgenic component, and the primers are as follows:

primer name	Primer sequences
		RPA-HPT2-F	GTCTGCTGCTCCATACAAGCCAACCACGG
RPA-HPT2-R	CTGGCAAACTGTGATGGACGACACCGTCAG

The guide and folding sequences are as follows: wherein, the guidance sequence is thickened;

guide and folding sequence names	Sequence(s)
		LbCas12a-HPT2	5-UAAUUUCUACUAAGUGUAGAUGGCUCCAACAAUGUCCUGACGGA-3
LbCas12a-HPT1	5-UAAUUUCUACUAAGUGUAGAUAGCUUCGAUGUAGGAGGGCGUGG-3

The guide and folding sequence is subjected to thio modification, and the thio modification conditions are as follows:

wherein, the step S2 includes the following steps:

step S21: the following components are mixed in parts by volume: 2.2-2.5 parts of first primer, 2.2-2.5 parts of second primer, 29-20 parts of Primer Free Rehydration buffer, 2 parts of DNA extracted in the step S1 and 11-12 parts of water;

step S22: uniformly mixing the components in the step S21, and performing instantaneous centrifugation;

step S23: adding the obtained mixed solution into TwistAmp Basic reaction, and uniformly mixing;

step S24: 2.5 parts by volume of 280mM MgOAc were added and mixed

Step S25: reacting for 20 minutes at 38-40 ℃;

step S26: preserving at-20 ℃ for standby.

Wherein, the reaction marker detected by the enzyme label instrument is selected from S2 or S4, and the marking method comprises the following steps: single-stranded DNA molecules containing TAT base sequences and respectively provided with FAM and BHQ1 groups at two ends, wherein S2 is 5`6-FAM-TTAT-3 'BHQ1, and S4 is 5`6-FAM-TAT-3' BHQ1;

the reaction marker detected by the test strip is selected from S3, and the marking method comprises the following steps: single-stranded DNA molecule 5`6-FAM-TAT-Biotin-3' containing TAT base sequences and having FAM and Biotin groups at both ends;

the reaction marker detected by the quantitative PCR instrument is selected from S5, and the marking method comprises the following steps: single-stranded DNA molecule 5`6-FAM-TTATT-3' BHQ1 containing TAT base sequences and having FAM and Biotin groups at both ends.

The method for detecting the transgenic component based on the CRISPR Cas enzyme gene editing technology provides a new technology and a new method for detecting the nucleic acid of transgenic plants, and the method can certainly promote the application research of the gene editing detection technology on the detection of plant nucleic acid, thereby having important practical significance.

Drawings

Fig. 1: the Cas12a fluorescence detection system compares the detection efficiency of the transgenic plant hygromycin gene aiming at the shearing sites HPT1 and HPT2 and the marking methods S2 and S4;

fig. 2: the Cas12a fluorescence detection system aims at a reaction intensity difference graph of the detection efficiency of the shearing sites HPT1 and HPT2 and the marking methods S2 and S4 on the transgenic plant hygromycin gene at different times;

fig. 3: the Cas12a fluorescence detection system detects the result of a transgenic plant CaMV35S promoter;

fig. 4: detecting a reaction intensity difference graph of a positive plant expression vector and a CaMV35S promoter of a DNA amplification product at different times by a Cas12a fluorescence detection system;

fig. 5: the Cas12a fluorescence detection system detects the Bar gene component result of the transgenic plant;

fig. 6: detecting a reaction intensity difference graph of Bar genes of positive plant expression vectors and DNA amplification products at different times by a Cas12a fluorescence detection system;

fig. 7: the Cas12a fluorescence detection system detects the HPT gene component result of the transgenic plant;

fig. 8: detecting a reaction intensity difference graph of the HPT gene of the positive plant expression vector and the DNA amplification product at different times by a Cas12a fluorescence detection system;

fig. 9: detecting the result of the NPTII gene component of the transgenic plant by a Cas12a fluorescence detection system;

fig. 10: detecting a reaction intensity difference graph of NPT II genes of positive plant expression vectors and DNA amplification products at different times by a Cas12a fluorescence detection system;

fig. 11: comparison results of the efficiency of detecting hygromycin genes by the Cas12a fluorescence detection system through thio modification and methylation modification;

fig. 12: the Cas12a fluorescence detection system detects the color development condition of a test strip of a transgenic plant CaMV35S promoter;

fig. 13: the Cas12a fluorescence detection system detects the color development condition of a test strip of the Bar gene of the transgenic plant;

fig. 14: the Cas12a fluorescence detection system detects the color development condition of a test strip of the HPT gene of the transgenic plant;

fig. 15: the Cas12a fluorescence detection system detects the color development condition of a test strip of the NPTII gene of the transgenic plant;

fig. 16: and the Cas12a fluorescence detection system detects the fluorescence quantitative PCR instrument detection results of the transgenic plant CaMV35S promoter, bar gene, HPT gene and NPT II gene.

Detailed Description

In order to further understand the technical scheme and beneficial effects of the present invention, the technical scheme and beneficial effects thereof will be described in detail with reference to the accompanying drawings.

The invention aims to provide a high-efficiency RPA isothermal amplification primer and a high-efficiency detection site corresponding to the Cas12a enzyme for the Cas12a enzyme gene editing detection technology of plant materials containing plant transgenic components such as a CaMV35S promoter, hygromycin genes, bar genes, NPT II genes and the like, and a new detection system is established for detecting the plant transgenic components by utilizing an enzyme-labeling instrument, a quantitative PCR instrument, a test strip color development technology and the like.

1. Construction of the reaction System

In order to achieve the above purpose, the technical scheme of the invention is as follows: providing an RPA isothermal amplification primer and a reaction system of plant materials containing plant transgenic components such as CaMV35S promoter, HPT gene, bar gene, NPTII gene and the like, and corresponding to an amplified section Cas12a enzyme efficient detection site and a reaction system, wherein the sequence information of the RPA isothermal amplification primer and the efficient detection site respectively has nucleotide sequences shown in a sequence table 1 and a sequence table 2.

Table 1: isothermal amplification primer for target gene

Table 2: the targeting and folding sequence of the LbCAs12a crRNA-Target is bolded and is a targeting sequence.

Guide and folding sequence names	Sequence(s)
		LbCas12a-HPT2	5-UAAUUUCUACUAAGUGUAGAUGGCUCCAACAAUGUCCUGACGGA-3
LbCas12a-HPT1	5-UAAUUUCUACUAAGUGUAGAUAGCUUCGAUGUAGGAGGGCGUGG-3
		LbCas12a-Bar	5-UAAUUUCUACUAAGUGUAGAUUggcagcUggacUUcagccUgcc-3
LbCas12a-35s	5-UAAUUUCUACUAAGUGUAGAUcUUUaUcgcaaUgaUggcaUUUg-3
		LbCas12a-NPTII	5’-UAAUUUCUACUAAGUGUAGAUGCUUGGUGGUCGAAUGGGCAGGU-3’

The specific reaction method is as follows:

1. plasmid is extracted by an alkaline lysis method, and plant DNA is extracted by a CTAB method.

2. And designing RPA isothermal amplification primers before and after target detection sites of genes such as CaMV35S promoter, HPT, bar gene, NPTII and the like, wherein the primer pair is shown in the table I.

RPA method (TwisAmpTM Basic Kit TwistDx kit):

(1) Add to a 1.5ml centrifuge tube

(2) Mixing, and instantly centrifuging;

(3) Adding the mixed solution into TwistAmp Basic reaction, and mixing

(4) Add 2.5. Mu.l of 280mM MgOAc and mix well

(5)39℃，20min

(6) Preserving at-20deg.C for further testing

3. Enzyme detection reaction system [ EnGen Lba Cas12a (Cpf 1) (BioLabs) enzyme reaction system ]:

add to a 20. Mu.l centrifuge tube

The reaction systems for enzyme-labeled instrument detection, quantitative PCR instrument detection and test strip detection are different in the selection of the reaction marker and the labeling method, and are described in detail below.

4. Detection method and result analysis

(1) Enzyme-labeled instrument detection

The reaction was carried out for 1 hour using a multifunctional microplate detector, synergy H1 manufacturer BioTek Instruments, inc., at 37 ℃ with a temperature bath, and fluorescence values were measured every 5 minutes.

The detection statistical method comprises the following steps: taking the fluorescence value of each reaction at 0min as a ratio, calculating the ratio of the fluorescence values of the reactions at intervals of 5min, designing 3 repetitions of the reaction, drawing a detection reaction curve by Excel software, and analyzing the difference significance by a Duncan new complex polar difference method by a DPS data analysis system.

Wherein, the reaction marker is selected from S2 or S4, and the marking method comprises the following steps: single-stranded DNA molecules containing TAT base sequences with FAM and BHQ1 groups at two ends respectively, wherein S2 is 5`6-FAM-TTAT-3 'BHQ1, and S4 is 5`6-FAM-TAT-3' BHQ1.

(2) Test strip detection

The test strip detection reaction system is subjected to incubation at 37 ℃ for 5, 15 and 30min, 5 μl of the reaction solution is taken and diluted with 100 μl of purified water for test strip color development (the product of Shunfeng gene editing company), and the color development condition of the test strip is observed after 3 min.

Wherein, the reaction marker is selected from S3, marking method: single-stranded DNA molecule 5`6-FAM-TAT-Biotin-3 containing TAT base sequences and having FAM and Biotin groups at both ends, respectively.

(3) Quantitative PCR instrument detection

Fluorescent PCR instrument fluorescence was taken every 1 minute using the ABI Quantum studio6 FAM channel. Wherein, the reaction marker is selected from S5, marking method: single-stranded DNA molecule 5`6-FAM-TTATT-3' BHQ1 containing TAT base sequences and having FAM and Biotin groups at both ends.

2. Detection method of enzyme-labeled instrument

1. Selection of reactive markers

In this embodiment, the effect of the different reporting sequences and the different labeling methods S2 and S4 on the detection efficiency of the microplate reader is verified.

Taking hygromycin positive rice DNA amplification products as detection objects, 2 different shearing sites (HPT 1, HPT 2) of hygromycin and 2 report reaction markers (S2, S4) form 4 detection reaction combinations, wherein the detection reaction combinations are respectively as follows: from the detection results, it can be seen (fig. 1) that, under Cas12a fluorescence detection system, different detection report sequence labeling methods have a greater influence on the detection reaction intensity, and the S4 labeling method is superior to the S2 labeling method, and particularly has a significant advantage on the efficient cleavage site, and the S4 labeling method.

In fig. 1, four curves from top to bottom represent the average results of the following combinations, respectively: hpt2+s4 positive, hpt1+s4 positive, hpt1+s2 positive, and hpt2+s2 positive; the lower four curves represent the mean results of HPT2+S4 negative, HPT1+S4 negative, HPT1+S2 negative and HPT2+S2 negative.

The difference significance was analyzed for the intensity of the positive detection reaction at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60min for different combinations. Analysis results showed (fig. 2, table 3) that after 5min of reaction, the reaction of the S4 marker (hpt1+s4, hpt2+s4) was already significantly higher than the reaction of S2 (hpt1+s2, hpt2+s2), the reaction at the hpt2 tangent point was significantly higher than the HPT1 tangent point for the reaction of S4, and the difference between HPT1 and HPT2 tangent points was not significant for the reaction of S2; when the reaction is carried out for 10min, the HPT2+S4 reaction is obviously higher than HPT1+S4, is extremely obviously higher than HPT1+S2 and HPT2+S2, the difference between HPT1+S2 and HPT2+S2 is not obvious, and the difference between HPT1+S4 and HPT2+S2 is not obvious; at 15 and 20min, the HPT2+S4 reactions were all significantly higher than the other reactions, HPT1+S4 was significantly higher than HPT1+S2, and the HPT1+S2 and HPT2+S2 differences were not significant; after 25min of reaction, the HPT2+S4 reactions were all significantly higher than the other reactions, with insignificant differences between HPT1+S4, HPT1+S2 and HPT2+S2. From the overall level of detection reaction, HPT2+S4 is the highest in detection level, HPT2 is a more efficient detection site than HPT1, S4 is a more efficient detection reporter reaction labeling method than S2, and S4 has a greater advantage in detection of efficient cleavage sites.

In fig. 2, the histogram of each time point corresponds to the experimental results of hpt1+s2, hpt1+s4, hpt2+s2, hpt2+s4, respectively, from left to right.

Therefore, in sections 2-5 below, the reaction system selects the S4 detection report reaction labeling method when the transgenes are detected by enzyme-labeled instrument editing.

Table 3.Cas12a fluorescence detection system System shows the differential analysis data of the reaction intensity of the detection of the hygromycin positive rice DNA amplification products at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60min, with the combination of different cleavage sites (HPT-1 and HPT-2) with different reporter sequence labeling methods (S2 and S4).

Note that: the data are analyzed by Duncan's new complex polar method, a, B, C represent the significant differences between the reaction systems, A, B, C represent the very significant differences between the reaction systems.

2. Editing detection of transgenic plant CaMV35S promoter enzyme-labeled instrument

The non-transgenic corn and papaya DNA are used as negative control, a plant expression vector with a CaMV35S promoter is used as positive control, and corn 5% positive DNA, corn 100% positive DNA, corn positive DNA isothermal amplification, papaya 5% positive DNA, papaya 100% positive DNA and papaya positive DNA isothermal amplification products are used as detection targets to carry out detection experiments. From the detection results, it is clear that only the positive plant expression vector, corn positive DNA isothermal amplification and papaya positive DNA isothermal amplification products can generate detectable fluorescence report reaction within the detection time under Cas12afluorescence detection system, and no detectable fluorescence report reaction can be directly caused by water, blank, negative, corn 5% positive DNA, corn 100% positive DNA, papaya 5% positive DNA and papaya 100% positive DNA (fig. 3). Wherein, 5% and 100% respectively represent the mass content of positive samples in the test samples, and the same is true hereinafter.

Specifically, in fig. 3, the abscissa represents the detection time (min), the ordinate represents the fluorescence ratio, the upper three curves represent the detection curves of the isothermal amplification product of papaya DNA, the isothermal amplification product of corn DNA, and the plant expression vector (i.e., positive plasmid) having the CaMV35S promoter, respectively, from top to bottom, the remaining seven curves represent the detection values of corn 5% positive DNA, corn 100% positive DNA, papaya 5% positive DNA, papaya 100% positive DNA, negative control, blank control, and water control, respectively, and the remaining seven curves do not appear in the entire detection period.

Respectively carrying out difference significance analysis on positive plant expression vectors, corn positive DNA isothermal amplification and papaya positive DNA isothermal amplification products which can cause detection reaction at 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 and 60min, wherein analysis results show that no significant difference exists between the three products when the reaction is carried out for 5min (figure 4 and table 4); the papaya isothermal amplification products sequentially show 10% of significant difference and extremely significant difference in the reaction for 10 and 15 min; after 20min of reaction, the isothermal amplification products show extremely remarkable differences compared with the plasmids, and the isothermal amplification products react more strongly than the plasmids; during 20 and 25min of reaction, 3 reactions showed very significant differences, reaction strengths: papaya positive isothermal amplification product > corn positive isothermal amplification product > positive plant expression vector; when the reactions are carried out for 30, 35 and 40 minutes, compared with the corn positive isothermal amplification product, the difference significance is reduced, and the difference is sequentially 5 percent of significance difference, 10 percent of significance difference and insignificant difference; after 40min of reaction, the reaction strength of the isothermal amplification products is not significantly different.

In fig. 4, the histogram at each time point corresponds to: positive plant expression vector, corn positive isothermal amplification product and papaya positive isothermal amplification product.

The experimental results show that: the plasmid extracted by the alkaline lysis method can directly cause detection reaction, the plant DNA extracted by the CTAB method can not cause detection reaction, but the target amplification product of the plant DNA can cause detection reaction; the intensity of detection reaction caused by the amplified products is significantly higher than that of the plasmid detection reaction from the total reaction, and some variation difference of reaction intensity exists between the amplified products, but the variation is not significant after 40 minutes of reaction with the extension of the reaction time.

TABLE 4 analysis of the data of the differential reaction intensity analysis between positive plant expression vectors and positive DNA amplification products of maize and papaya at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60min for the CaMV35S promoter component Cas12a fluorescence detection system System detection

3. Editing detection of Bar gene locus enzyme-labeled instrument of transgenic plant

The non-transgenic corn, soybean and rice DNA are used as negative control, a plant expression vector with Bar gene is used as positive control, isothermal amplification of corn 100% positive DNA and corn positive DNA, isothermal amplification products of soybean 100% positive DNA and soybean positive DNA, isothermal amplification products of rice 100% positive DNA and rice positive DNA are used as detection targets, and detection experiments are carried out. From the detection results, only the positive plant expression vector, corn, soybean and rice positive DNA isothermal amplification products can generate a detectable fluorescence report reaction in a short time under Cas12afluorescence detection system, and none of water, blank, negative, corn 100% positive DNA, soybean 100% positive DNA and rice 100% positive DNA can directly cause a detectable fluorescence report reaction (fig. 5).

Specifically, in fig. 5, the abscissa represents the detection time (min), the ordinate represents the fluorescence ratio, the upper four curves represent the detection curves of the isothermal amplification product of corn DNA, the isothermal amplification product of rice DNA, the isothermal amplification product of soybean DNA, and the plant expression vector with Bar gene (i.e., positive plasmid) from top to bottom, respectively, the remaining six curves represent the 100% positive DNA of corn, the 100% positive DNA of rice, the 100% positive DNA of soybean, the negative control, the blank control, and the water control, respectively, and no detection value appears in the remaining four curves in the whole detection period.

The positive plant expression vectors, corn, rice and soybean positive DNA isothermal amplification products capable of causing detection reactions are respectively subjected to difference significance analysis at 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 and 60min, and analysis results show that 4 reactions are not very significant different before 50min of reaction (FIG. 6 and Table 5); only the difference of the reaction intensity between the corn positive isothermal amplification products and the positive plasmids is very remarkable in the reaction for 55 and 60 minutes, but the difference of the reaction intensity between the rice positive isothermal amplification products and the soybean positive isothermal amplification products and the plasmid is not remarkable, and the reaction intensity between the isothermal amplification products is slightly different but the difference is not remarkable (figure 6).

In fig. 6, the histogram at each time point corresponds to: positive plant expression vector, corn positive isothermal amplification product, soybean positive isothermal amplification product and rice positive isothermal amplification product.

The experimental results show that: the plasmid extracted by the alkaline lysis method can directly cause detection reaction, the plant DNA extracted by the CTAB method can not cause detection reaction, however, the target amplification product of plant DNA can cause detection reaction; the detection reaction caused by the amplified product was slightly stronger than that of the plasmid from the overall reaction, but there was no significant and very significant difference.

TABLE 5 Bar Gene component Cas12a fluorescence detection system System detection of the reaction Strength differential analysis data between positive plant expression vectors and corn, soybean, rice positive DNA amplification products at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60min

/>

/>

/>

4. Editing detection of HPT gene locus enzyme-labeled instrument of transgenic plant

The non-transgenic rice and green bristlegrass DNA are used as negative control, a plant expression vector with HPT gene is used as positive control, and 100% positive DNA of rice, isothermal amplification products of positive DNA of rice, 100% positive DNA of green bristlegrass and isothermal amplification products of positive DNA of green bristlegrass are used as detection targets to carry out detection experiments. From the detection results, it is known that only the positive plant expression vector, the rice positive DNA isothermal amplification and the green bristlegrass positive DNA isothermal amplification products can generate a detectable fluorescence report reaction within the detection time under Cas12a fluorescence detection system, and no detectable fluorescence report reaction can be directly caused by water, blank, negative, rice 100% positive DNA and green bristlegrass 100% positive DNA (fig. 7).

Specifically, in fig. 7, the abscissa represents the detection time (min), the ordinate represents the fluorescence ratio, the upper three curves represent the isothermal amplification product of rice DNA, the isothermal amplification product of green bristlegrass positive DNA, and the plant expression vector (i.e., positive plasmid) from top to bottom, the remaining five curves represent 100% positive DNA of rice, 100% positive DNA of green bristlegrass, negative control, blank control, and water control, respectively, and no detection value appears in the remaining five curves in the whole detection period.

The positive plant expression vector, the rice positive DNA isothermal amplification and the green bristlegrass positive DNA isothermal amplification products which can cause detection reaction are respectively subjected to difference significance analysis at 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 and 60min, and analysis results show that (fig. 8 and table 6) the three are extremely different when the reaction is carried out for 5min, the reaction intensity of the products of isothermal amplification in the detection time range (60 min) is always extremely higher than that of positive plasmids, the rice amplification products are extremely higher than the green bristlegrass amplification products before the reaction is carried out for 20min, no significance difference exists after 25min, and the whole reaction intensity is as follows: the isothermal amplification product of rice > the isothermal amplification product of green bristlegrass > the positive plant expression vector.

In fig. 8, the histogram at each time point corresponds to: positive plant expression vector, green bristlegrass positive isothermal amplification product and rice positive isothermal amplification product.

The experimental results show that: the plasmid extracted by the alkaline lysis method can directly cause detection reaction, the plant DNA extracted by the CTAB method can not cause detection reaction, but the target amplification product of the plant DNA can cause detection reaction; the detection reaction intensity caused by the amplified products is significantly larger than that of the plasmid from the total reaction, and some variation difference of the reaction intensity exists between the amplified products, but the variation is not significant after 20 minutes of reaction with the extension of the reaction time.

TABLE 6 analysis of the reaction Strength differential analysis data (HPT 2 cut-points) between positive plant expression vectors and Rice, setaria viridis positive DNA amplification products at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60min for the HPT Gene component Cas12a fluorescence detection system System detection

/>

/>

5. Editing detection of transgenic plant NPTII gene locus enzyme-labeled instrument

The non-transgenic corn and papaya DNA are used as negative control, a plant expression vector with NPTII gene is used as positive control, and 100% positive DNA of corn, isothermal amplification products of corn positive DNA, 100% positive DNA of papaya and isothermal amplification products of papaya positive DNA are used as detection targets to carry out detection experiments. From the detection results, it is clear that only the positive plant expression vector, corn positive DNA isothermal amplification and papaya positive DNA isothermal amplification products can generate detectable fluorescence report reaction within the detection time under Cas12a fluorescence detection system, and no detectable fluorescence report reaction can be directly caused by water, blank, negative, corn 100% positive DNA and papaya 100% positive DNA (fig. 9).

Specifically, in fig. 9, the abscissa represents the detection time (min), the ordinate represents the fluorescence ratio, the upper three curves represent the isothermal amplification product of corn DNA, the isothermal amplification product of papaya positive DNA, and the plant expression vector (i.e., positive plasmid) from top to bottom, respectively, the remaining five curves represent 100% positive DNA of corn, 100% positive DNA of papaya, negative control, blank control, and water control, respectively, and no detection value appears in the remaining five curves throughout the detection period.

The positive plant expression vector, the corn positive DNA isothermal amplification and the papaya positive DNA isothermal amplification products which can cause detection reaction are respectively subjected to difference significance analysis at 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 and 60min, and analysis results show that the differences among the three are not large, the corn positive amplification products and the papaya positive amplification products are extremely remarkably higher than the positive plasmid at the time of only 50min in the detection time range (60 min), and the differences among the other three are not remarkable. Overall reaction intensity: corn isothermal amplification product > papaya isothermal amplification product > positive plant expression vector.

In fig. 10, the histogram at each time point corresponds to: corn positive isothermal amplification product, papaya positive isothermal amplification product and positive plant expression vector.

The experimental results show that: the plasmid extracted by the alkaline lysis method can directly cause detection reaction, the plant DNA extracted by the CTAB method can not cause detection reaction, but the target amplification product of the plant DNA can cause detection reaction; the detection reaction intensity caused by the amplified products is slightly higher than that caused by the detection reaction with the plasmid from the total reaction, but the difference is not obvious, and some variation difference of the reaction intensity exists between the amplified products, but the reaction difference is not obvious along with the extension of the reaction time.

TABLE 7 analysis data of the difference in reaction intensity between positive plant expression vectors and corn and papaya positive DNA amplification products at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60min for NPTII Gene component Cas12a fluorescence detection system System detection

/>

/>

6. Effect of guide and folding sequence modification on detection reactions

Since crRNA and sgRNA are both RNA, the stability in vitro is not strong, and in order to improve the stability of the detection reaction, studies have attempted to methylate and thio-modify the detected crRNA-Target RNA sequence (table 8), and experimental results indicate that: the methylation-modified composite structure failed to work properly, and the thiomodification did not have a large difference in detection efficiency in the primary detection compared to the unmodified one (fig. 11).

Specifically, in FIG. 11, the upper two curves represent the unmodified crRNA-Target RNA sequence and the thio-modified crRNA-Target RNA sequence, and the lower curve represents the methylated crRNA-Target RNA sequence.

Table 8.Cas12a fluorescence detection system System details of the use of thio-modified or methylation-modified crRNA-Target sequences

The thio-modified crRNA-Target RNA and the unmodified crRNA-Target RNA sequences for detection are stored at 4 ℃, and are respectively detected after 1, 2, 3, 5, 7, 9, 11, 13, 15, 17, 19, 23 and 30d, the reaction time is 60min, and the experimental results show that: the reaction strengths of the 1-9d thio modification and the non-modification are not significantly different, the reaction strengths of the 11-30d thio modification and the non-modification are significantly different, and the reaction strengths are larger than those of the non-modification, which indicates that the thio modification has better promotion effect on improving the stability of editing detection.

Table 9.Cas12a fluorescence detection system system analyzes data using differences in detected reaction intensity between thio modified sgRNAs and

unmodified sgRNAs

1, 2, 3, 5, 7, 9, 11, 13, 15, 17, 19, 23, 30 d.

3. Test paper strip color development detection method

As described above, the test strip was used to detect the reaction system, after incubation at 37℃for 5, 15 and 30min, 5. Mu.l of the reaction solution was diluted with 100. Mu.l of purified water for the test strip color development (product of Shunfeng Gene editing Co.) and after 3min, the test strip color development was observed.

The test paper is selected from a flow-through immunochromatography test paper, and a loading region, a Gold-NP anti-FITC antibody region body region, a strepavidin band (i.e. a control band) and an anti-antibody band (i.e. a detection band) are sequentially arranged on the flow-through immunochromatography test paper. The S sequence in the reaction system is combined with the antibody through a Gold-NP anti-FITC antibody region body region, the control band is combined with biotin at the 3 end of the S sequence for color development, FAM at the 5 end of the cut S sequence in the positive sample continues to ascend and is combined with the anti-antibody, the detection band is developed, the S sequence in the negative sample is intercepted in the control band, and the detection band is not developed.

In FIG. 12, negative controls are represented from left to right, respectively, and the isothermal amplification products of the transgenic plant DNA having the CaMV35S promoter develop for 5 minutes, 15 minutes and 30 minutes.

In FIG. 13, negative controls are represented from left to right, respectively, and the isothermal amplification products of the DNA of the transgenic plants having the Bar gene are developed for 5 minutes, 15 minutes and 30 minutes.

In FIG. 14, negative controls are represented from left to right, respectively, and the isothermal amplification products of the transgenic plant DNA having the HPT gene develop for 5 minutes, 15 minutes and 30 minutes.

In FIG. 15, negative controls are represented from left to right, respectively, and the isothermal amplification products of the transgenic plant DNA having NPTII gene develop for 5 minutes, 15 minutes and 30 minutes.

In the invention, the sample corresponding to fluorescent color development is a DNA isothermal amplification product.

4. PCR quantitative detection method

Fluorescence was taken every 1 minute using the ABI quantsudio 6 FAM channel as described above.

Wherein, the reaction marker is selected from S5, marking method: 5`6-FAM-TTATT-3' BHQ1.

The results are shown in FIG. 16: consistent with the result of the enzyme labelling instrument, the crRNA target activity of the selected transgenic original is very high.

From our research results, cas12a fluorescence detection system editing system can successfully realize the detection of plant DNA in vitro, but conventionally extracted plant DNA is difficult to directly cause the detection reaction of transgenic components, and isothermal amplification or PCR process is required to be added before the detection reaction. The main factors influencing the efficiency of the detection system are as follows: amplification reaction system, enzyme stability and activity, editing site selection, and the like. Different editing site efficiencies are greatly different, a high-efficiency detection system is established, a plurality of shearing sites are required to be designed, and a specific detection reaction is established by selecting the high-efficiency shearing sites; the detection report sequence marking method also has influence on detection reaction, for example, the S4 (5`6-FAM-TAT-3 '-BHQ1) marking method is superior to the S2 (5`6-FAM-TAT-3' -BHQ1) marking method, and has extremely remarkable advantages particularly for the marking method of the high-efficiency cutting site S4; the stability of the guide sequence RNA also obviously influences the stability of the reaction, the crRNA-Target RNA sequence is subjected to methylation and thio modification, the methylation modified composite structure cannot work normally, the thio modification has no great difference in detection efficiency compared with the non-modified composite structure in the primary detection, but the thio modification reaction is obviously higher than the non-modified detection reaction in less than 2 weeks along with the extension of the preservation time of the crRNA-Target RNA sequence in a refrigerator at 4 ℃, so that the stability and the detection capability of the detection reaction can be enhanced after the thio modification of the guide sequence RNA. The research provides a new technology and a new method for detecting the nucleic acid of the transgenic plant, and the application research of the gene editing detection technology on the detection of the plant nucleic acid is certainly promoted, so that the method has important practical significance.

In the present invention, the CaMV35S promoter means a cauliflower mosaic virus 35S promoter; the HPT gene is hygromycin gene; the Bar gene refers to a bialaphos resistance gene; the NPT ii gene is a neomycin phosphotransferase gene.

In the present invention, CTAB means cetyltrimethylammonium bromide.

In the present invention, primer Free Rehydration buffer refers to an RPA primer-free rehydration buffer, which is a commercially available buffer.

In the present invention, twistAmp Basic reaction is a commercially available centrifuge tube containing lyophilized powder, and is a common substance for constructing an isothermal amplification reaction system by those skilled in the art.

In the present invention, the term Lba Cas12a refers to Cas12a endonuclease.

In the present invention, the marking methods "S2, S4, S3 and S5" are not particularly referred to, and are simply abbreviated as corresponding marking methods.

Although the present invention has been described with reference to the above preferred embodiments, it should be understood that the present invention is not limited to the above embodiments, and that various changes and modifications can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

Claims

1. The transgenic component detection method based on the CRISPR Cas enzyme gene editing technology is characterized by comprising the following steps of:

step S1: extracting plant DNA by a CTAB method;

step S2: preparing RPA isothermal amplification primers of DNA;

step S3: the reaction system was constructed as follows: each reaction system comprises the following components in parts by volume: 2 parts of 10xNE buffer 2.1, 1 part of 1uM guide and folding sequence, 1 part of 1uMLba cas12a, 1 part of RNase inhibitor, 1 part of RPA isothermal amplification product of transgenic plant DNA extract, 1 part of reaction marker and 13 parts of water;

2. the method for detecting a transgenic component based on CRISPR Cas enzyme gene editing technology according to claim 1, wherein the step S2 comprises the steps of:

step S21: the following components are mixed in parts by volume: 2.2-2.5 parts of first primer, 2.2-2.5 parts of second primer, 29-20 parts of Primer Free Rehydrationbuffer, 2 parts of DNA extracted in the step S1 and 11-12 parts of water;

step S24: 2.5 parts by volume of 280mM MgOAc were added and mixed

Step S25: reacting for 20 minutes at 38-40 ℃;

step S26: preserving at-20 ℃ for standby.

3. The method for detecting a transgenic component based on CRISPR Cas enzyme gene editing technology according to claim 1, characterized by:

the reaction marker detected by the enzyme label instrument is selected from S2 or S4, and the marking method comprises the following steps: single-stranded DNA molecules containing TAT base sequences and respectively provided with FAM and BHQ1 groups at two ends, wherein S2 is 5`6-FAM-TTAT-3 'BHQ1, and S4 is 5`6-FAM-TAT-3' BHQ1;