CN116396965B - Application of AHDC1 in construction of obese animal model, method and drug screening method - Google Patents

Abstract

The invention provides an application and a method of AHDC1 in constructing an obese animal model and a drug screening method, belonging to the field of gene functions and application. The invention discloses application in constructing an animal model of obesity and/or diseases related to obesity, wherein the animal model of obesity and/or diseases related to obesity is constructed by changing the expression of AHDC1 genes in an animal body and/or changing the level or activity of AHDC1 proteins.

Description

Application of AHDC1 in construction of obese animal model, method and drug screening method

Technical Field

The invention belongs to the field of gene functions and applications, and particularly relates to an application of AHDC1 in constructing an obese animal model, a method and a drug screening method.

Background

Obesity is a common causative factor of various metabolic diseases such as type 2 diabetes, cardiovascular diseases, cancers and the like, and severely threatens human health. It is counted that more than one third of the world's population suffers from overweight or obesity, and the number of patients is also continually increasing. Obesity prevention and control is a global public health problem to be solved urgently, and people are prompted to explore potential pathogenesis and intervention targets.

The diet induction model can better simulate the influence of life style and environment on obesity, but the induced obesity is closely related to the strain of mice and the composition of carbohydrates and fat in feed, so that experimental results are difficult to reproduce in different laboratories. Compared with diet-induced obesity model, the gene editing animal model has higher phenotypic stability and has greater value for researching disease mechanism and intervention method.

However, animal models with obesity symptoms have been very limited in choice for a long time. Thus, the development of new animal models for obesity has been an urgent need for studies of obesity biology, disease mechanisms and interventions.

Disclosure of Invention

Therefore, the invention aims to provide an application and a method of AHDC1 in constructing an obese animal model and a drug screening method.

For this purpose, the invention provides the following technical scheme.

In a first aspect, the invention provides the use of an AHDC1 gene in the construction of an animal model of obesity and/or obesity-related diseases.

Further, the use refers specifically to the construction of an animal model with obesity symptoms by altering the expression of the AHDC1 gene in the animal and/or altering the level or activity of the AHDC1 protein. The level of AHDC1 protein refers to the expression level of AHDC1 protein.

Further, inhibiting expression of the AHDC1 gene; and/or, reduce the level or activity of AHDC1 protein.

Further, the expression of AHDC1 gene in the animal is altered using a gene editing method, preferably comprising at least one of insertion of exogenous DNA fragments, chemical mutagenesis, physical mutagenesis, embryonic stem cell-based gene editing, and CRISPR/Cas9 technology.

Further, the animal is a mammal, preferably a mouse, more preferably a mouse; and/or the obesity-related diseases are selected from at least one of fatty liver, hyperlipidemia, diabetes, insulin resistance.

The obesity-related diseases are selected from abnormal lipid metabolism and/or abnormal glucose metabolism.

In a second aspect, the invention provides a method of constructing an animal model of obesity and/or obesity-related diseases comprising altering expression of the AHDC1 gene and/or altering the level or activity of an AHDC1 protein.

Further, the expression of the AHDC1 gene is inhibited by a gene editing method, and/or the level or activity of AHDC1 protein is reduced.

The gene editing method is at least one of inserting exogenous DNA fragments, chemical mutagenesis, physical mutagenesis, gene editing based on embryonic stem cells and CRISPR/Cas9 technology into an AHDC1 gene sequence.

Further, the CRISPR/Cas9 gene editing comprises the steps of:

s1, determining a target site of an AHDC1 gene, and designing sgRNA aiming at an AHDC16 exon;

the sgRNA sequence is as follows: sgRNA1: GAAAGGTTCAAGGGCCCCTA;

sgRNA2:GAGCTTGCTTATCGCTTGGC；

s2, jointly transferring the sgRNA and the Cas9 enzyme into fertilized eggs;

s3, transplanting the fertilized eggs into a surrogate animal body, producing F0 generation, and screening AHDC1 gene knockout heterozygote animals.

In a third aspect, the present invention also provides a method of

Use of an animal model of obesity and/or obesity-related diseases constructed according to the above method for screening for a medicament for preventing and/or treating obesity and/or obesity-related diseases, preferably at least one selected from the group consisting of fatty liver, hyperlipidemia, diabetes, insulin resistance.

In a fourth aspect, the present invention also provides a method for screening candidate drugs for preventing and/or treating obesity and/or obesity-related diseases, comprising the steps of:

the drug is applied to the animal model constructed according to the above method, and compared with the animal model without the drug, the drug which causes the improvement or cure of obesity and/or diseases related to obesity after the application is the candidate drug.

After screening for drugs for preventing and/or treating obesity and/or obesity-related diseases using animal models or AHDC1 genes having obesity and/or obesity-related diseases as action targets, further cell experiments, animal experiments, and/or clinical trials may be performed on the candidate drugs to confirm the weight-loss effect of the candidate drugs.

For example, the AHDC1 gene editing mouse may be obtained by inserting a foreign DNA fragment such as a transposon or a virus into the AHDC1 gene sequence, a chemical mutagenesis method such as ENN, a physical mutagenesis method such as X-ray, or a method based on embryonic stem cells or CRISPR/Cas9 technology, or by changing the gene sequence or changing the gene expression.

An application of AHDC1 gene as an action target in screening obesity therapeutic drugs, specifically, the application of AHDC1 gene as the action target (or action object) of the drugs is to screen the drugs to find substances capable of changing AHDC1 gene expression or AHDC1 protein activity as the obesity therapeutic drugs.

The obesity therapeutic drug can improve transcription or translation of AHDC1 genes or can improve activity of AHDC1 proteins, so that proper expression of the AHDC1 genes and activity of the AHDC1 proteins are maintained, and the purpose of treating obesity is achieved.

Candidate obesity therapeutic agents obtained by screening for AHDC1 gene as an action target include, but are not limited to: small molecule compounds, antibodies, polypeptides, nucleic acid molecules, carbohydrates, lipids, proteins or viruses.

The administration amount of the obesity therapeutic agent is a dose which properly increases transcription or translation of the AHDC1 gene, or properly increases activity of the AHDC1 protein, or can improve obesity and metabolic disorders associated with imbalance of the AHDC1 steady state, so that the expression of the AHDC1 gene or the activity of the AHDC1 protein is restored to normal level or the signal path associated with imbalance of the AHDC1 steady state is regulated.

The technical scheme of the invention has the following advantages:

1. the application of the AHDC1 gene in constructing animal models with obesity and/or diseases related to obesity, disclosed by the invention, for the first time, the correlation of AHDC1 with obesity, fatty liver, glycolipid metabolic disorder and insulin resistance is disclosed, and the expression of the AHDC1 gene or the activity of AHDC1 protein can cause obesity, fatty liver, diabetes, hyperlipidemia and/or insulin resistance.

The invention successfully constructs the mouse obesity model by adopting the method for inhibiting AHDC1 gene expression for the first time, is more similar to the human morbidity process, is an ideal model for obesity foundation and clinical application research, and can be well applied to screening medicaments for treating obesity and related metabolic diseases.

2. The obesity animal model provided by the invention can further develop into fatty liver, diabetes, hyperlipidemia and insulin resistance animal models along with the continuous increase of body weight.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

In FIGS. 1-9, +/+ represents wild-type mice, and+/-represents AHDC1 knockout heterozygous mice.

FIG. 1 is a diagram showing construction strategy of AHDC1 gene editing mice,

fig. 2 is quantitative PCR of mRNA of AHDC1 in hypothalamus, fat, heart, muscle and liver, with number average = 3 in each group of mice, wild-type mice of strain C57BL/6N were selected as controls, GAPDH as internal reference, p <0.001;

FIG. 3 is a graph showing the body size, body weight, and fat muscle ratio of mice;

a is a comparison graph of the body shape of a 19-week-old mouse, representing, from left to right, a wild-type mouse (+/+) and a heterozygote mouse (+/-) of a 19-week-old C57BL/6N strain, respectively, B being a growth curve of the body weight of the mouse from 4 weeks old to 19 weeks old; c is a fat muscle comparison graph of 4-week-old and 6-month-old mice, each group of mice has number average=8, and wild-type mice of C57BL/6N strain are selected as controls, with p <0.05; * P <0.01; * P <0.001;

FIG. 4 is a graph of liver weight and liver tissue section of mice;

a represents liver weight of 6 months of age of mice, each group of mice has number average=8, and wild type mice of a C57BL/6N strain are selected as controls, wherein p <0.01; b is an oil red staining chart of a 6 month old liver tissue slice of the mouse, and the chart is magnified in magnification: 63×;

FIG. 5 is a graph showing results of insulin resistance, fasting blood glucose, fasting triglycerides and total cholesterol in 12-week-old mice;

a is a mouse insulin resistance experimental result graph, and B is a mouse fasting blood glucose result graph; c is a graph of results of fasting blood triglycerides and total cholesterol in mice, each group of mice has a number average=8, and wild-type mice of the C57BL/6N strain are selected as controls, with p <0.05; * P <0.01; * P <0.001;

FIG. 6 is a graph showing results of fasting blood glucose, fasting blood triglycerides and total cholesterol in 4-week-old mice;

a is a fasting blood glucose result graph, B is a fasting triglyceride and total cholesterol result graph of mice, each group of mice has a number of 8, and a wild type mouse of a C57BL/6N strain is selected as a control;

fig. 7 is an energy intake profile of mice, each group of mice having a number average=8, with C57BL/6N strain wild type mice selected as controls;

FIG. 8 is a graph of energy expenditure in mice and body temperature in mice;

a is an energy consumption graph of mice, B is a body temperature graph of mice, each group of mice has a number average=8, and wild-type mice of a C57BL/6N strain are selected as a control, wherein p <0.05 and p <0.001;

FIG. 9 is a graph showing body fat content of mice after administration of guava leaf extract of test example 2; the number of each group of mice is equal=8, and wild type mice of a C57BL/6N strain which is fed with high fat are selected as controls, wherein p is less than 0.01, and p is less than 0.001;

FIG. 10 shows the results of gel electrophoresis experiments and Mulberry sequencing assays; meanwhile, mice with bands at 561bp, 425bp and 155bp are heterozygote mice; mulberry sequencing showed successful knockout of exon 6 of the AHDC1 gene.

Detailed Description

The following examples are provided for a better understanding of the present invention and are not limited to the preferred embodiments described herein, but are not intended to limit the scope of the invention, any product which is the same or similar to the present invention, whether in light of the present teachings or in combination with other prior art features, falls within the scope of the present invention.

The specific experimental procedures or conditions are not noted in the examples and may be followed by the operations or conditions of conventional experimental procedures described in the literature in this field. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.

Example 1

The present example provides a method of constructing an obese mouse model, which is a mouse from which the AHDC1 gene was knocked out. The CRISPR/Cas9 gene editing knockout gene fragment is a mature commercial technology, for example, CRISPR/Cas9 gene editing can be entrusted to the Siemens (Nanjing) biomedical technology Co., ltd. The gene knockout strategy of the mouse model is shown in fig. 1: mice were C57BL/6N strain, knocked out Gene designation AHDC1 (Gene ID:230793, MGI: 2444218), knocked out exons: exon 6.

The construction method comprises the following steps:

s1, determining a target site of an AHDC1 gene, and designing sgRNA aiming at exon 6 of the AHDC1 gene;

the AHDC1 exon sequence is shown below:

exon 1 (Exon 1, seq_1):

1 GGATGG TGAGCA GCGAAGExon 2: (exon 2, seq_2)

Exon 3: (exon 3, seq_3)

Exon 4: (exon 4, seq_4)

Exon 5: (exon 5, seq_5)

Exon 6: (exon 6, seq_6)

Exon 7 (Exon 7, seq_7):

the sgRNA sequence of exon 6 is shown below:

sgRNA1 (matching forward strand of gene, positive strand of the matching gene): GAAAGGTTCAAGGGCCCCTA (seq_8)

sgRNA2(matching forward strand of gene):GAGCTTGCTTATCGCTTGGC(Seq_9)

S2, jointly transferring sgRNA and Cas9 enzyme into fertilized eggs of a C57BL/6N mouse;

s3, transplanting the fertilized eggs into a surrogate animal body, producing F0 generation, carrying out genotype identification by adopting the method of the example 2 after weaning (breast feeding is carried out after weaning generally for 4 weeks and normal diet feeding is carried out after weaning) on the mice of the F0 generation, and screening positive F0, namely, obtaining the knockout heterozygote animal (the death of the AHDC1 homozygote embryo cannot be obtained).

Example 2 Gene identification in F0 mice

1. The device comprises: horizontal centrifuge, constant temperature drying cabinet, pipettor.

2. Reagent consumable: tris hydrochloride buffer (Trizma Hydrochloride Solution), (Sigma, T2663), proteinase K (Merck, MK 539480), polyethylene glycol octylphenyl ether (Triton X-100) (Sigma, T8787-50 mL), high purity thermostable DNA polymerase (2 XTaq Master Mix), (Dye Plus) (Vazyme, P222), agarose (Agarose) (BIOWEST AGAROSE, REGULAR), DNAMaroer (Thermo Scientific GeneRuler 100bp DNA Ladder#SM0242), tris (Tris) (Bio Basic Inc, TBO194-500 g), EDTA (Shanghai Sangon,0105-500 g), boric Acid (Boric Acid) (Shanghai Sangon,0588-500 g).

Final concentration of rat tail digestion buffer: 50mM KCl,10mM Tris-HCl (pH 9.0), 0.1% Triton X-100,0.4mg/mL proteinase K.

3. Method of

(1) DNA extraction

The mouse genomic DNA was extracted by cutting the tail, and a high purity genomic DNA was obtained using a TaKaRa MiniBEST general genomic DNA extraction kit (accession number 9765,5.0), and the specific procedure was as follows, and the materials used in the following steps were not mentioned in the consumable, and were all the materials in the DNA extraction kit.

S1, 180. Mu.L of buffer GL, 20. Mu.L of proteinase K and ribonuclease A (10. Mu.L of 2-5mm tail fragment per piece) were added to a microcentrifuge tube.

S2, culturing the centrifuge tube at 56 ℃ overnight.

S3, centrifuging at a rotating speed of 12000 r/min for 2 minutes to remove impurities.

S4, adding 200 mu L of buffer solution GB and 200 mu L of absolute ethyl alcohol, and fully mixing.

S5, placing the centrifugal column into a collecting pipe, centrifuging the sample at a speed of 12000 rpm for 2 minutes, and discarding the lower liquid.

S6, adding 500 mu L of buffer WA to the centrifugal column, centrifuging at 12000 rpm for 1 min, and discarding the lower layer liquid.

S7, adding 700 mu L of buffer WB into the centrifugal column, centrifuging at a speed of 12000 rpm for 1 min, and discarding the lower layer liquid. ( Note that: ensure that buffer WB has been pre-mixed with 100% ethanol. When buffer WB is added, the walls are rinsed to remove residual salts. )

S8, repeating the step S7 for 1 time.

S9, placing the centrifugal column in a collecting pipe, and centrifuging at a speed of 12000 rpm for 2 minutes.

S10, placing the centrifugal column into a new 1.5 ml centrifugal tube. 50-200 mu L of elution buffer is added into the centrifugal column to be placed at the center of the centrifugal column membrane for 5 minutes. ( And (3) injection: the elution rate can be increased by heating the elution buffer to 65 ℃. )

S11, eluting DNA by centrifugation at 12000 rpm for 2 minutes. ( To increase DNA yield, filtrate and/or 50-200. Mu.L of elution buffer may be added again to the center of the spin column membrane and allowed to stand for 5 minutes. Centrifuging at 12000 rpm for 2 min )

(2) And (3) PCR identification:

the heterozygous knockout mice are identified through three pairs of primers (PCR primer 1: F1/R1; PCR primer 2: F1/R2; PCR primer 3: F3/R3), gel electrophoresis experiments are carried out on the amplified products, wherein the amplified products of the PCR primer 1 are 561bp, the amplified products of the PCR primer 2 are 425bp, and the amplified products of the PCR primer 3 are 155bp. Mice with bands at 561bp, 425bp and 155bp were heterozygous mice.

Specifically, the PCR primer information and the PCR result are as follows:

PCR primer 1 (annealing temperature 60.0 ℃ C.).

Forward primer (F1): 5'-GCATCGTGGTGAATGGGTCTTC-3' (seq_10)

Reverse primer (R1): 5'-TGGTCCCAGATGAGTGAGTACATC-3' (seq_11)

PCR primer 2 (annealing temperature 60.0 ℃ C.).

Forward primer(F1):5’-GCATCGTGGTGAATGGGTCTTC-3’(Seq_10)

Reverse primer(R2):5’-TTGGGCTCTCGGAGGTAGTCAG-3’(Seq_12)

PCR primer 3 (annealing temperature 60.0 ℃ C.).

Forward primer(F3):5’-GGCCCATGAGGAGTTCAGTATGTAC-3’(Seq_13)

Reverse primer(R3):5’-TCTTGATGTGAATCCCTAAACTCTTCCT-3’(Seq_14)

The DNA extracted in the step (1) is amplified by adopting a PCR primer 1, a PCR primer 2 and a PCR primer 3 respectively, the PCR amplification processes of the three primers are the same, the Vazyme and a P222 kit are adopted, the amplification system is shown in the table 1, and the reaction conditions are shown in the table 2:

TABLE 1PCR System (primer final concentration: 10. Mu.M)

TABLE 2PCR reaction conditions

As shown in FIG. 10, the PCR experiment results showed that heterozygote mice appeared in bands at 561bp, 425bp and 155bp at the same time.

To ensure that the knockdown was determined to be exon 6, 561bp cut was recovered after PCR identification with PCR primer 1, and verified by Mulberry sequencing (Waveaway detection Co.), as shown in FIG. 10, the knockdown fragment 5017bp, which showed successful knockdown of exon 6 of the AHDC1 gene.

Example 3

A method for screening a weight-reducing drug using the obese heterozygous mouse constructed in example 1, comprising the steps of:

first, guava leaf extract is prepared by the following method: ultrasonic extracting guava leaf coarse powder 1.1kg with 3 times (volume) of ethyl acetate (ultrasonic condition 25 deg.C, 50 MHz) for 10 min/time at intervals of 10min for 7 times, and filtering. Ultrasonic extracting the residue with 5 times (volume) of ethanol (ultrasonic condition 25 deg.C, 50 MHz), 15 min/time, 10min interval, 4 times, filtering ethanol filtrate, and concentrating to obtain extract. Adding 4 times (volume) of water into the extract, dispersing to obtain suspension, centrifuging at 6000rpm/min for 15min to obtain supernatant 1; ultrasonically extracting the residue with 5 times of water for 2 times, each time 40min, combining the 2 filtrates, filtering, centrifuging at 6000rpm for 15min to obtain supernatant 2, mixing supernatant 1 and supernatant 2 to obtain medicinal liquid, adding gelatin into the medicinal liquid according to 5% of the volume of the medicinal liquid, stirring, decocting for 2 hr, filtering and concentrating the decoction, precipitating with ethanol twice, regulating ethanol content for the first time to make the ethanol mass content reach 75%, refrigerating at 4deg.C for 24 hr, filtering to obtain filtrate, adding ethanol into the filtrate for the second time to regulate ethanol content, refrigerating at 4deg.C for 48 hr, filtering, concentrating to recover ethanol until no ethanol smell, filtering, loading the filtrate onto polyamide (100-200 mesh) column, eluting with water, collecting eluate, concentrating under reduced pressure to obtain guava leaf extract 64.07g.

The guava leaf extract described above was applied to western high fat diet (Research diet, D12492) to feed obese mice and obese heterozygous mice constructed in example 1 as follows:

the obese mice and the obese heterozygote mice constructed in example 1 were fed with high fat, and were each divided into guava leaf extract groups and control groups (i.e., the initial values of the total weight of the mice in both groups were the same) according to body weight at 12 weeks of age, 8 mice per group. The guava leaf extract group was administered once daily by gavage according to 0.11g/kg body weight (equivalent to 2g/kg body weight of crude drug), and the control group was administered once daily by gavage with the same volume of physiological saline for 8 weeks. The body fat content was measured by a small animal nuclear magnetic resonance spectrometer at week 8 of administration, as shown in fig. 9, and the results showed that both obese mice had decreased body fat content, consistent with the report that guava leaf could be used as a weight-loss drug in the prior art. The obese mice constructed by the invention can be used for screening weight-losing medicines.

Test example 1

Two groups of mice were set, 3 mice per group. One group was heterozygous male mice constructed according to the method of example 1; the other group was wild type male mice of the C57BL/6N strain, all mice were fed a normal diet after 4 weeks of breast feeding to 24 weeks, and the mice were fed a normal diet all the time.

Quantitative PCR (Trizol method for mRNA extraction) of AHDC1 in mouse hypothalamus, fat, heart, muscle and liver was performed using a real-time fluorescent quantitative PCR detection kit (PowerUp SYBR Green premix, applied Biosystems, a 25742), see kit instructions for specific procedures, GAPDH is internal reference, p <0.001.

The primers used were as follows: ahdc1-F1: GTGTGAACCTGCGTCCAGTA (seq_15);

Ahdc1-R1:AAGCCCTCCACAGTCCAGAT(Seq_16)

Gapdh-F1:GTCAAGGCCGAGAATGGGAA(Seq_17)

Gapdh-R1:CTCGTGGTTCACACCCATCA(Seq_18)

the results are shown in FIG. 2, and the AHDC1 gene expression in the heterozygous mice is significantly reduced.

Test example 2

Two groups of 8 mice were set. One group was heterozygous male mice constructed according to the method of example 1, the other group was wild type male mice of the C57BL/6N strain, all mice were fed a normal diet after 4 weeks of breast feeding, and the female mice were always fed a normal diet.

1) Mouse weight test

Fasted: all mice to be tested were fasted for 4 hours;

weighing: weighing at 4-19 weeks, placing a plastic small barrel on a dynamic electronic balance, grabbing the mice, placing the mice into the weighing small barrel, and measuring the weight and recording data.

As can be seen from fig. 3A and 3B, the AHDC1 knockout heterozygote mice exhibited severe obesity symptoms. The weight of heterozygote mice and wild-type mice was measured weekly starting at 4 weeks of age, and the heterozygote mice rapidly gained weight from around 4 weeks of age compared to wild-type mice, and by 19 weeks the heterozygote weight was 29.8% heavier than the wild-type mice.

2) Mouse body composition detection

To further investigate what tissue composition increased the weight gain of heterozygous mice was due to, nuclear magnetic resonance (mcm) was used to detect body composition of mice at 4 weeks of age and 6 months of age.

The mice were placed in a holder, which was placed in a body fat rate nuclear magnetic instrument. Clicking starts to measure, the body fat rate and the muscle rate are obtained, and the ratio of the body fat rate to the muscle rate is calculated as the fat to muscle ratio. As shown in fig. 3C, the 4 week old heterozygotes were 1.9 times higher than wild-type mice, and the 6 month old heterozygote mice were 3.1 times higher than wild-type fat and muscle of the same month age. The above results fully demonstrate that AHDC1 heterozygous mice have a severely obese phenotype.

In conclusion, decreasing the expression of AHDC1 in mice resulted in the occurrence of obesity.

Test example 3

Two groups of 8 mice were set. One group was heterozygous male mice constructed according to the method of example 1, the other group was wild type male mice of the C57BL/6N strain, all mice were fed a normal diet to 6 months of age after breast feeding for 4 weeks, and the female mice were fed a normal diet all the time.

Mouse liver weight measurement

After 6 months old mice were anesthetized with chloral hydrate, the mice were fixed supine and the chest, abdomen hair of the mice were moistened with distilled water. After cutting the skin and exposing the heart and taking blood from the left apex of the heart, perfusing each organ with physiological saline, and opening the abdominal cavity to fully expose each organ. The liver of the mouse is quickly found and taken down, the taken-down liver specimen is placed on sterilized gauze, residual blood on the liver surface is wiped off, and the liver is placed in a sterile culture dish and is quickly weighed. Frozen sections of the weighed liver were stained with oil red O.

In obese patients, abnormal fat metabolism often leads to excessive accumulation of fat in the liver, thereby inducing the occurrence of fatty liver. From the results of measurement of liver weight of mice, as shown in FIG. 4A, the liver of heterozygote mice of 6 months of age was increased by 21.0% compared with that of wild-type mice of the same age. The results of the liver frozen section staining of the oil red O mice are shown in FIG. 4B, which shows that more lipid droplets accumulate in liver cells of heterozygote mice. The above results show that heterozygote mice have severe fatty liver and can be used as a fatty liver mouse model.

Test example 4

Two groups of 8 mice were set. One group was heterozygous male mice constructed according to the method of example 1, the other group was wild-type male mice of the C57BL/6N strain, all mice were fed a normal diet after 4 weeks of breast feeding to 12 weeks, and the females were fed a normal diet all the time.

Insulin resistance, fasting blood glucose, fasting triglycerides and total cholesterol were tested in 12 week old heterozygote mice and wild mice.

1) Insulin resistance test

Fasted: all mice to be tested were fasted with 12 week old mice for 4 hours;

insulin injection: the blood glucose immediately after injection of insulin, at 40min and 90min, was measured by a blood glucose meter at 0.4IU/kg of insulin to obtain FIG. 5A.

After insulin injection, the blood glucose of heterozygote mice decreased significantly slower than that of wild-type mice, indicating that heterozygote mice were insensitive to insulin and had an insulin resistant phenotype.

2) Fasting blood glucose detection

All mice to be tested are fasted for 4 hours, the fixed mice are grabbed, the tail of the rat is rapidly cut off at a position 0.1-0.2cm away from the tail end of the rat by using ophthalmic scissors, and blood drops flow out by themselves.

Blood sugar detection: the edge of the blood glucose meter test paper is lightly touched with a blood drop, the blood is immersed in the test paper, and the blood glucose meter counts down for 5 seconds to display the reading. The results are shown in FIG. 5B.

3) Fasting triglyceride detection

The mouse tail blood was collected and assayed using the well-established north triglyceride control kit (# 000220) according to the instructions. The results are shown in FIG. 5C.

4) Total cholesterol detection

The mouse blood was collected from the tip of the mouse, and examined by using the well-established north cholesterol control kit (# 000180) according to the instructions. The results are shown in FIG. 5C.

In the insulin resistance test, the fasting blood glucose of the heterozygote mice is obviously higher than that of the wild mice, and the fasting blood lipid and triglyceride of the heterozygote mice are obviously increased, so that the total cholesterol level of the heterozygote mice is obviously increased, and the abnormal glycolipid metabolism of the heterozygote mice is indicated.

Test example 5

Two groups of 8 mice were set. One group was heterozygous male mice constructed according to the method of example 1, the other group was wild-type male mice of the C57BL/6N strain, all mice were breast-fed for 4 weeks.

The 4-week-old heterozygote mice and wild mice were tested for fasting blood glucose, fasting triglycerides and total cholesterol, as shown in fig. 6A, 6B. The detection method was the same as in test example 3.

Abnormal lipid metabolism typically results in abnormal carbohydrate metabolism, which also affects lipid metabolism. Obesity, for example, increases the risk of developing insulin resistance and type 2 diabetes, and mouse skeletal muscle-specific insulin resistance also leads to excessive accumulation of fat. Test example 4 by exploring the primary phenotype of heterozygous mice, it was helpful to find the root cause of the metabolic abnormality in AHDC 1.

As is clear from test example 1, heterozygote mice developed obesity at weaning (mother mice were milk before weaning and fed with normal feed after weaning), and 4-week-old male mice developed obesity, which was manifested by significantly higher weight and fat muscle ratio than wild-type mice. Indicating that heterozygote mice develop an obese phenotype at weaning.

Unlike the obese phenotype, the 4-week-old heterozygote mice had no significant differences in fasting blood glucose and blood lipid levels compared to wild-type mice, i.e., the heterozygote mice had a phenotype that was free of abnormal glycolipid metabolism at an early stage.

Taken together, the chronological order in which obesity and glycolipid metabolism occurred confirms that obesity is the primary phenotype of heterozygous mice, suggesting that obesity in heterozygous mice results in abnormal glycolipid metabolism.

Test example 6

Two groups of 8 mice were set. One group was heterozygous male mice constructed according to the method of example 1, the other group was wild-type male mice of the C57BL/6N strain, all mice were fed a normal diet after 4 weeks of breast feeding, and the female mice were fed a normal diet at all times.

Heterozygote mice and wild-type mice were tested for energy intake, consumption and mouse body temperature.

1) Food intake of mice aged between 4 weeks and 16 weeks was detected, and food intake detection method:

fasted: all mice to be tested were fasted for 4 hours;

weighing: the mice were fed and the amount of feed recorded as initial amount on a dynamic electronic balance, and the amount of feed remaining after 3 days interval was weighed as remaining amount, feeding amount (g/day) = (initial amount-remaining amount)/3 days/cage number.

The results are shown in fig. 7, where the heterozygotes and wild-type mice have no significant difference in food intake, indicating that the energy intake of the heterozygote mice is not affected.

2) The 24 hour Energy Expenditure (EE) of 20 week old mice was measured using the metabolic cage monitoring system (oxyet, panlab, spain) and as shown in fig. 8A, the heterozygote mice showed significantly lower night energy expenditure than wild-type mice, indicating a reduced heterozygote mice energy expenditure.

3) Body temperature was measured on 12-week-old mice, and basal metabolic levels were reflected by measuring body temperature of the mice, and as shown in fig. 8B, the body temperature of heterozygote mice was significantly lower than that of wild-type mice, and basal energy consumption of heterozygote mice was lower than that of wild-type mice.

In summary, the energy intake of the heterozygote mice with the AHDC1 knockout was normal, but the basal metabolic capacity was decreased, and it was found that inhibiting the expression of AHDC1 could lead to a decrease in the energy consumption of the mice, resulting in the occurrence of obesity of the heterozygote mice, rather than an increase in the energy intake.

It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. And obvious variations or modifications thereof are contemplated as falling within the scope of the present invention.

Claims (3)

1. A method of constructing an animal model having obesity and/or obesity-related diseases, comprising inhibiting expression of an AHDC1 gene by a gene editing method that is CRISPR/Cas9 gene editing;

the CRISPR/Cas9 gene editing comprises the following steps:

s1, determining a target site of an AHDC1 gene, and designing sgRNA aiming at an AHDC16 exon;

the sgRNA sequence is as follows: sgRNA1: GAAAGGTTCAAGGGCCCCTA;

sgRNA2:GAGCTTGCTTATCGCTTGGC；

s2, jointly transferring the sgRNA and the Cas9 enzyme into fertilized eggs;

s3, transplanting the fertilized eggs into a surrogate animal body, producing F0 generation, and screening out an AHDC1 gene exon 6 knockout heterozygote animal;

the animal is a mouse;

the obesity-related diseases are at least one selected from fatty liver, hyperlipidemia, diabetes, and insulin resistance.

2. Use of an animal model with obesity and/or obesity-related diseases constructed according to the method of claim 1 for screening for a medicament for preventing and/or treating obesity and/or obesity-related diseases.

3. A method for screening candidate drugs for preventing and/or treating obesity and/or obesity-related diseases, comprising the steps of:

the drug is administered to the animal model constructed according to the method of claim 1, and compared with the animal model without the drug, the drug which causes improvement or cure of symptoms of obesity and/or obesity-related diseases after administration is a candidate drug.