CN116375816B

CN116375816B - Human papilloma virus 56 type L1 protein mutant, method for reducing degradation of recombinant protein and application

Info

Publication number: CN116375816B
Application number: CN202310019679.8A
Authority: CN
Inventors: 陈晓; 伍树明; 刘永江; 银飞; 张海江; 姜旭林; 张瑞霞; 薛俊莲; 王学红; 沈迩萃
Original assignee: Beijing Kangleweishi Biological Technology Co ltd
Current assignee: Beijing Kangleweishi Biological Technology Co ltd
Priority date: 2023-01-06
Filing date: 2023-01-06
Publication date: 2023-09-05
Anticipated expiration: 2043-01-06
Also published as: CN116375816A

Abstract

The invention relates to the field of medical biology, and discloses a human papilloma virus 56 type L1 protein mutant, a method for reducing degradation of recombinant human papilloma virus 56 type L1 protein and application thereof. The invention adopts genetic engineering technology to successfully transform 420 th R mutation of HPV56L1 amino acid sequence into T or Q, thus solving the degradation problem. Experiments show that all the mutations do not affect the expression of the corresponding mutant L1 protein, the degradation proportion of the modified VLP protein is obviously reduced, and the immunogenicity of the corresponding VLP is not affected. Therefore, the invention avoids the degradation problem of the human papilloma virus 56 type L1 protein after mutation transformation, reduces the manufacturing difficulty and improves the quality character, so that the corresponding HPV56L1-VLP obtained by recombinant expression of the transformed sequence and assembly is more suitable for being used as vaccine antigen protein for preventing the papilloma virus infection.

Description

Human papilloma virus 56 type L1 protein mutant, method for reducing degradation of recombinant protein and application

Technical Field

The invention relates to the field of medical biology, in particular to an expression method of human papillomavirus L1 protein. More particularly relates to a human papillomavirus 56 type L1 protein mutant and a method for reducing degradation of recombinant human papillomavirus 56 type L1 protein and application thereof.

Background

Human papillomaviruses (Human Papillomavirus, HPV) are a non-enveloped, double-stranded DNA virus that minimally invasively infects epithelial tissue basal lamina cells through mucous membranes and skin, causing benign or malignant proliferative lesions of epithelial tissue. Chronic persistent infection with high-risk HPV is the main causative agent of cervical cancer. More than 200 HPV subtypes are currently identified (http:// www.hpvcenter.se/html/refcalones.html). According to the 2019 summary report (global) of human papillomaviruses and related diseases thereof and the 2019 summary report (china) of human papillomaviruses and related diseases thereof issued by the World Health Organization (WHO), it is currently determined that there are mainly 13 of HPV high-risk types associated with the induction of cervical cancer: 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68.

The capsid of HPV is an orthoicosahedron composed of structural proteins L1 and L2, about 55nm in diameter. At present, eukaryotic cells, yeasts or escherichia coli are reported to be capable of effectively expressing the L1 protein, and 72L 1 pentameric proteins can self-assemble (self-assembly) to form Virus-like Particles (VLPs) without L2 participation. The VLPs can be used as antigen to induce organisms to generate specific neutralizing antibodies, so that the organisms are effectively protected from being infected by homotype viruses, which is a main strategy for developing cervical cancer prevention vaccines at present, and 4 types of marketed varieties (Cervarix, gardasil, gardasil 9, cecolin) exist in China.

HPV type 56 belongs to the Alphapapilomavir 6 branch and is one of the high-risk types. According to the 2019 summary report (global and China) of human papilloma virus and related diseases issued by WHO, the detection rate of HPV56 subtype in the global cervical cancer detection case is close to 1%, and China is close to 1.1%. None of the currently marketed vaccine varieties contains this type. HPV56L1 full-length protein contains 499 amino acids (GenBank: ALT 54864.1), and theoretical pI and molecular weight of the HPV56L1 full-length protein are respectively as follows through https:// web. Expasy. Org/computer_pi/website online prediction: 8.75 and 56059.52Da.

Thus, there is a need for research efforts to recombinantly express HPV56L1 protein and develop it into a virus-like particle (VLP) vaccine.

Disclosure of Invention

The HPV56L1 engineering bacteria based on the escherichia coli expression system show obvious degradation condition of the target protein HPV56L1 in the expression and purification process. Degradation of the type L1 protein affects the process of assembling the L1 pentamer into VLPs (the degradation proportion is large, the particle size of the assembled VLPs is small), and affects the quality of samples of the type, so that the quality level of multivalent vaccines as the vaccine overall can be affected. Degradation of the L1 protein results in reduced immunogenicity of the assembled virus-like particles, reducing their efficacy as vaccine active ingredients for the prevention of viral infections. The inventors have conducted an important focus on the problem of HPV56L1 degradation. According to comprehensive and careful mass spectrometry detection analysis researches (specific research contents comprise in-gel enzymolysis of full-length and degraded L1 protein electrophoresis bands, N/C end sequencing, amino acid coverage rate, peptide fragment abundance contrast analysis and the like), the results show that: the degradation site of HPV56L1 protein is arginine (R) at position 420. Structural simulation analysis shows that R420 is located on the surface of the L1 pentamer structure. Arginine is a hydrolysis site of trypsin, and trypsin specifically acts on peptide bonds of carboxyl terminal of basic amino acid arginine or lysine, and has strong specificity. Therefore, our study shows that HPV56L1 protein is susceptible to enzymatic cleavage at the carboxy terminus of arginine at position 420 under the action of trypsin during expression of recombinant proteins.

In order to solve the problem of degradation of L1 protein, the present inventors tried to replace arginine (R) at position 420 with an amino acid having different physicochemical and structural characteristics as follows: alanine (a), aspartic acid (N), threonine (T), aspartic acid (D), leucine (L), serine (S), phenylalanine (F), glutamine (Q), histidine (H). . The results show that: the 420 th arginine of HPV56L1 protein is replaced by threonine (T) or glutamine (Q) respectively, and the degradation of the recombinant expression protein mutants is significantly lower than that of a non-mutated wild type sequence, and the further assembly of the L1 pentamer into VLPs is not affected. Therefore, the problem of degradation of HPV56L1 protein is successfully solved by modifying arginine at 420 position of the protein, thereby completing the invention.

The invention provides a human papillomavirus type 56L1 protein mutant, which consists of SEQ ID NO:2, and the arginine at position 420 of the amino acid sequence encoded by the nucleotide sequence shown in figure 2 is replaced by threonine or glutamine.

The invention also provides the coding nucleic acid of the mutant. Preferably, the sequence based on SEQ ID NO:2 by "CGT" to ACC (R420T mutation); or the 1259-1260 bases are replaced by "AG" by "GT" (R420Q mutation).

The invention also provides an expression vector of the coding nucleic acid, preferably a prokaryotic expression vector, more preferably an escherichia coli expression vector. Further preferably, it is an inducible expression vector. More preferably, the starting vector is a pKL1 plasmid.

The invention further provides recombinant bacteria, preferably cells, more preferably E.coli, comprising said expression vector. More preferably, it is E.coli BL21 (DE 3).

The invention provides a method for preparing L1 protein of human papillomavirus 56, which comprises the steps of culturing the recombinant bacteria and separating to obtain the L1 protein of human papillomavirus 56.

Further, the method also comprises the step of purifying the human papillomavirus 56 type L1 protein, and specifically adopts a CHT chromatographic column, a G25 desalting and liquid-exchanging chromatographic column, a Source15Q anion exchange chromatographic column and a molecular sieve chromatographic column to carry out purification in sequence.

The invention further provides a preparation method of HPV51L1-VLP, which is obtained by mixing the obtained purified human papillomavirus type 56L1 protein with an assembly liquid and standing, and more specifically, the HPV51L1-VLP is obtained by mixing the HPV51L1-VLP with the assembly liquid according to the following ratio of 4: mixing the materials according to the volume ratio of 1, and standing for 1h at room temperature to finish assembly; preferably, the assembly liquid is 400-600 mM NaAc-HAc, 2.0-5.0M NaCl, 0.05-0.5% Tween 80, pH 4.7-6.0).

Experiments prove that the problem of degradation of HPV56L1 amino acid sequence is successfully solved by modifying 420-bit R mutation into T or Q by adopting a genetic engineering technology. All target proteins before and after transformation can be effectively expressed in an expression system, most of the target proteins are soluble, no obvious difference exists in expression quantity, and the fact that the mutation of 420 th R to T or Q on an HPV56L1 amino acid sequence does not affect the expression of the L1 protein after corresponding mutation. The electrophoresis result of the final stock solution prepared by the same purification process shows that: compared with the HPV51L1-VLP protein before transformation, the degradation proportion of the recombinant protein after transformation is obviously reduced, which proves that the strategy of mutating the 420 th R on the HPV51L1 amino acid sequence into T or Q successfully solves the degradation problem of the L1 protein.

The Chinese pharmacopoeia specifies: the purity of the recombinant protein should be not less than 95% and the degradation ratio should be not more than 5%. The degradation ratio of the wild type HPV51L1 protein before mutation transformation after purification is more than 15%, so that the difficulty of recombinant expression and purification of the E.coli to obtain the pharmaceutical grade HPV51L1-VLP meeting the requirements is huge, and the wild type HPV56L1 sequence is difficult to apply to vaccine products for preventing the papillomavirus infection. The mutation transformation avoids the degradation problem, reduces the manufacturing difficulty and improves the quality character, so that the sequence after the recombination expression transformation and the assembly of the corresponding HPV51L1-VLP are more suitable for being used as vaccine antigen proteins for preventing the papillomavirus infection.

Drawings

FIG. 1, plasmid restriction identification electrophoreses of pKL1-HPV56L1t and pKL1-HPV56L1 q. Wherein M is a 1kb DNA Marker;1 is pKL1-HPV56L1t NdeI+XhoI;2 is pKL1-HPV56L1t NdeI;3 is pKL1-HPV56L1t XhoI;4 is pKL1-HPV56L1q NdeI+XhoI;5 is pKL1-HPV56L1q NdeI;6 is pKL1-HPV56L1q XhoI.

FIG. 2, pan-Vial expression detection electrophoresis. Wherein M is a protein Marker;1 is XA90 pKL1-HPV56L1t without induction of a negative control; 2 is XA90 pKL1-HPV56L1t whole bacteria; 3 is XA90 pKL1-HPV56L1t supernatant; 4 is XA90 pKL1-HPV56L1t precipitate; 5 is XA90pKL1-HPV56L1q without induction of a negative control; 6 is XA90pKL1-HPV56L1q whole bacteria; 7 is XA90pKL1-HPV56L1q supernatant; 8 is XA90pKL1-HPV56L1q precipitate; 9 is XA90pKL1-HPV56L1 non-induced negative control; 10 is XA90pKL1-HPV56L1 whole bacteria; 11 is XA90pKL1-HPV56L1 supernatant; 12 is XA90pKL1-HPV56L1 precipitate; 13 is HPV56L1 positive control.

FIG. 3, SDS-PAGE electrophoresis of HPV56L1-VLP, HPV56L1t-VLP and HPV56L1q-VLP protein primordial liquid. Wherein A: HPV56L1-VLP, B: HPV56L1t-VLP, C: HPV56L1q-VLP.

FIG. 4 is a bar graph of immunogenicity detection-neutralizing antibody titer of each protein stock before and after engineering. HPV56L1-VLP is a VLP vaccine manufactured using wild-type L1 sequences; HPV56L1T-VLP is a VLP vaccine made from the L1-R420T sequence; HPV56L1Q-VLP is a VLP vaccine made of L1-R420Q sequences. AH is a negative control injected with aluminum adjuvant alone.

Detailed Description

In order to enable those skilled in the art to better understand the technical scheme of the present invention, the technical scheme of the present invention will be further described in detail below with reference to the specific embodiments.

1. Experimental materials

pKL1 is a vector constructed by the company, and the sequence of the pKL1 is shown in SEQ ID NO:1.

mutant PCR primers (sequences shown in the following Table) were synthesized by Jin Weizhi Biotechnology Inc. dNTPs, DNA polymerase, restriction endonuclease, T4 DNA ligase were purchased from NEB company. Agarose gel DNA recovery kit, plasmid miniprep kit, TOP10 competent cells, BL21 (DE 3) competent cells were purchased from Tiangen Biochemical technology Co.

Primer name	Sequence(s)
		HPV56L1qF	CCGTTACGTTCAGTCTACCGCTATCACCTGC
HPV56L1qR	GGTGATAGCGGTAGACTGAACGTAACGGTATTTGTC
		HPV56L1tF	CCGTTACGTTACCTCTACCGCTATCACCTGC
HPV56L1tR	GGTGATAGCGGTAGAGGTAACGTAACGGTATTTGTC

2. Expression vector construction and strain preparation

The synthetic primers were designed by molecular cloning, and mutant plasmids were amplified by mutation PCR with pKL1-HPV56L1 as template to replace arginine (R) at position 420 with threonine (T) and glutamine (Q), respectively. The obtained mutant plasmid is subjected to NdeI and XhoI enzyme digestion and then subjected to electrophoresis, and HPV56L1t and HPV56L1q target gene fragments are recovered by gel cutting. Next, the 2 target gene fragments were ligated with the pKL1 vector fragment recovered by electrophoresis cut with NdeI and XhoI, respectively, and the ligation products transformed TOP10 competent cells. And (5) carrying out clone culture on a transformation plate, and then carrying out sequencing to screen out positive clones. Extracting plasmid after positive cloning and expanding, further transforming expression host bacterium XA90 competent cells after the plasmid is identified by enzyme digestion, obtaining corresponding expression engineering bacterium strains XA90 pKL1-HPV56L1T (R420T) and XA90pKL1-HPV56L1Q (R420Q), and storing the strains in an ultralow temperature storage box at-80 ℃ for later use.

3. Detection of strain shake flask expression before and after mutation transformation

XA90pKL1-HPV56L1 (before transformation) and XA90 pKL1-HPV56L1T (after transformation of R420T) and XA90pKL1-HPV56L1Q (after transformation of R420Q) strains were removed from a-80℃refrigerator, 20. Mu.l of each strain was inoculated into 40ml of LB medium after thawing and subjected to overnight activation (37 ℃,220rpm,16 h), 200. Mu.l of each activated strain was transferred to 40ml of 2YT medium and cultured (30 ℃,220rpm,7 h), and finally overnight induction was started (30 ℃,220rpm,16 h) with the addition of 0.2mM IPTG final concentration. And (3) injection: a negative control without inducer was added to each strain. After the fermentation of the shake flask is finished, respectively performing ultrasonic disruption on the collected thalli, respectively taking corresponding whole bacteria, disrupting the centrifugal supernatant, disrupting the centrifugal sediment, performing SDS-PAGE electrophoresis detection (electrophoresis conditions: gel concentration 10%, 150V constant pressure 15min first, 200V constant pressure running until the front edge just runs out, coomassie brilliant blue staining, boiling water decolorizing, photographing and recording electrophoresis results), analyzing the expression condition of the corresponding target protein according to the electrophoresis results, and comparing whether the expression quantity is different before and after transformation.

1.1.1 Large shake flask fermentation of mutant protein expression Strain

XA90pKL1-HPV56L1, XA90 pKL1-HPV56L1t and XA90pKL1-HPV56L1q strains were removed from the-80℃ultra-low temperature incubator, 20. Mu.l of the strain was thawed and inoculated into 40ml of LB medium for overnight activation (37 ℃,220rpm,16 h), 4ml of the activated strain was transferred to 800ml of 2YT medium for culture (30 ℃,220rpm,7 h), and finally overnight induction was started by adding 0.2mM IPTG at a final concentration (30 ℃,220rpm,16 h). After fermentation, the thalli are collected by centrifugation at the temperature of 4 ℃ and 4500rpm for 25min, and the obtained thalli are preserved in an ultralow temperature preservation box at the temperature of-80 ℃ for standby.

1.1.2 purification of target proteins before and after modification

Taking large shake flask fermentation XA90pKL1-HPV56L1, XA90 pKL1-HPV56L1t, XA90pKL1-HPV56L1q thallus, and according to thallus (g): the ratio of the bacterial Buffer (ml) =1:4, and the bacterial Buffer (5-50 mM PB, 5-30 mM DTT, pH 8.0) with the corresponding volume is added for full resuspension. Then, the cells were crushed by a high-pressure homogenizer: the breaking pressure is 800bar, and the bacteria are circularly broken for 3 times. The bacterial suspension was centrifuged at 12000rpm at 4℃for 60min to collect the supernatant, which was diluted 2-fold for the next CHT chromatography.

CHT column (hydroxyapatite type II column, column volume CV:10ml, pressure limit: 0.3MPa or less) was equilibrated with CHT equilibration Buffer (5-50 mM PB, 5-30 mM DTT, pH 8.0) in advance. And then taking the supernatant after the dilution in the previous step, loading the supernatant until the supernatant is subjected to chromatography with good balance, and collecting the loading flow-through. After loading was completed, the Buffer (5-50 mM PB, 5-30 mM DTT, pH 7.0) was rinsed with CHT for 8 CVs to UV baseline level. After the washing is finished, the elution is started, 0-100% CHT is used for eluting Buffer (400 mM PB, 5-30 mM DTT, pH 8.0), 10 CVs are linearly eluted, each eluting component is collected by a branch pipe, and the components of the target protein are combined and collected for the next step of G25 desalting and liquid exchange.

The G25 desalting and liquid exchange chromatographic column (G25, column volume CV:70ml, pressure limiting: less than or equal to 0.3 Mpa) is fully balanced by a liquid exchange Buffer (5 mM PB, 5-30 mM DTT, pH 8.0) in advance, and then a sample is collected by the last step of CHT chromatography and is loaded to the well-balanced chromatographic column. And (3) eluting by using a liquid exchange Buffer after the sample loading is finished, and collecting the component of the target protein according to a chromatogram for the next Source15Q anion exchange chromatography.

Source15Q anion exchange chromatography column (Source 15Q, column volume CV:5ml, pressure limiting:. Ltoreq.0.3 MPa) was equilibrated well in advance with SQ-ABuffer (5 mM PB, 5-30 mM DTT, pH 8.0). And then collecting the sample by desalting and liquid exchange chromatography in the previous step G25 until the sample is well balanced, and collecting the sample to flow through. After loading was complete, 8 CVs were rinsed with SQ-ABuffer to UV baseline level. After the washing is finished, the elution is started, 10 CVs are linearly eluted by 0-20% SQ-B Buffer (5 mM PB,1M NaCl, 5-30 mM DTT, pH 8.0), and finally, the elution is performed by 100% SQ-B Buffer, all elution components are collected by a branch pipe, and the components are combined after the components of the target protein are determined by electrophoresis and used for the next molecular sieve chromatography.

The molecular sieve chromatographic column (Superdex 200, column volume CV:120ml, pressure limit: less than or equal to 0.3 Mpa) is fully balanced by a molecular sieve Buffer (5-50mM PB,130mM NaCl,1-10 mM DTT, pH 8.0) in advance, and then the sample is collected by the Source15Q chromatography in the last step and is loaded to the well-balanced chromatographic column. Eluting with molecular sieve Buffer after sample loading, and collecting the component of target protein according to chromatogram for next assembly.

Collecting target protein by molecular sieve chromatography according to the volume of L1 protein: assembled solution = 4:1, adding an assembling solution (400-600 mM NaAc-HAc, 2.0-5.0M NaCl, 0.05-0.5% Tween 80, pH 4.7-6.0) with corresponding volume, mixing uniformly, and standing at room temperature for 1h to complete the assembly. After assembly, DLS (Dynamic Light Scattering ) was performed to confirm that VLPs assembled well for the next G25 change.

The G25 desalting and liquid-exchanging chromatographic column (G25, column volume CV:40ml, pressure limiting: less than or equal to 0.3 Mpa) is fully balanced by a liquid-exchanging Buffer (20 mM NaAc-HAc, 400-600 mM NaCl, 0.001-0.1% Tween-80, pH 5.0) in advance, and then the sample assembled in the previous step is sampled to the well-balanced chromatographic column. Eluting with Buffer, collecting the component of target protein according to chromatogram, purifying to obtain final HPV56L1-VLP, HPV56L1t-VLP and HPV56L1q-VLP protein stock solution, and storing in ultralow temperature storage box at-80deg.C.

And (3) taking HPV56L1-VLP, HPV56L1t-VLP and HPV56L1q-VLP protein stock solution for electrophoresis detection, and confirming degradation conditions of L1 proteins before and after transformation. Taking each assembled sample and each protein stock solution after liquid exchange for DLS detection, and confirming the state of self-assembling the L1 protein into VLP before and after transformation. Taking each protein stock solution for in-vivo immunogenicity detection of mice (6-8 week female BALB/c mice, intramuscular injection, 1 μg protein stock solution+25 μg homemade aluminum adjuvant/1, 10-day 1 samples were collected from the eyesockets at 1-day 2 weeks, 1-day 4 weeks and 1-day 6 weeks, respectively), collecting serum for neutralizing antibody detection, and the detection method was a pseudovirus-based HPV neutralizing antibody detection method), and confirming the effect of corresponding VLP samples on immunogenicity before and after transformation.

2 experimental results

2.1 plasmid enzyme digestion identification after transformation

The modified plasmid pKL1-HPV56L1t and pKL1-HPV56L1q which are successfully constructed are taken, single digestion and double digestion are respectively carried out by NdeI and XhoI, and each sample after digestion is loaded on 1% agarose gel for electrophoresis detection, and the result is shown in figure 1.

According to the result of enzyme digestion and identification electrophoresis, the vector fragments, the target gene fragments and the plasmid sizes shown in Table 1 are combined, and the analysis shows that the modified plasmid sizes of pKL1-HPV56L1t and pKL1-HPV56L1q are consistent with the theoretical values and have higher purity, so that the modified plasmid can be used for preparing corresponding expression engineering bacteria by subsequently transforming XA90 competent cells.

TABLE 1 vector fragment, gene fragment of interest and plasmid size summary table

Gene fragment	Size (bp)
		pKL1	4299
HPV56L1t	1500
		HPV56L1q	1500
pKL1-HPV56L1t	～5800
		pKL1-HPV56L1q	～5800

2.2 detection of the expression of the Strain in the shake flask before and after transformation

Taking small shake flasks for fermentation and collection of XA90pKL1-HPV56L1, XA90 pKL1-HPV56L1t and XA90pKL1-HPV56L1q thalli respectively for ultrasonic disruption, then respectively taking corresponding whole bacteria, disrupting the supernatant from the heart, disrupting the centrifugal precipitate for SDS-PAGE electrophoresis detection, and the detection results are shown in figure 2.

And (3) electrophoresis results show that: the target proteins HPV56L1, HPV56L1T and HPV56L1Q before and after transformation can be effectively expressed in an XA90pKL1 expression system, and most of the target proteins are soluble expression, and the expression quantity is not obviously different, so that the mutation of R at 420 th position on the amino acid sequence of HPV56L1 into T or Q does not affect the expression of the L1 protein after the corresponding mutation.

2.3 SDS-PAGE electrophoresis detection of protein stock solutions before and after transformation

And (3) taking purified HPV56L1-VLP, and respectively performing SDS-PAGE electrophoresis detection on HPV56L1t-VLP and HPV56L1q-VLP protein stock solutions, wherein the detection results are shown in the figure. The purity of the PV56L1-VLP protein is: 80.83 percent of degradation ratio is: 18.10%. Purity of HPV56L1t-VLP protein is: 99.23%, degradation ratio is: 0.77%. Purity of HPV56L1q-VLP protein is: 100%, degradation ratio 0%.

And (3) electrophoresis results show that: compared with the HPV56L1-VLP protein before transformation, the degradation ratio of the HPV56L1T-VLP protein and the HPV56L1Q-VLP protein after transformation is obviously reduced, which proves that the strategy of mutating the 420 th R on the HPV56L1 amino acid sequence into T or Q successfully solves the degradation problem of the L1 protein.

2.4 VLP Assembly results before and after transformation and detection of DLS of each protein

Samples of each of the assembled HPV56L1-VLP, HPV56L1t-VLP and HPV56L1q-VLP were taken and DLS detection was performed on each of the protein stocks after the corresponding solutions, and the results are shown in Table 2.

TABLE 2 summary of DLS detection results for each protein before and after modification

The DLS detection result shows that: virus-like particles (VLPs) with diameters of 41-55nm can be obtained after the assembly of three L1 proteins before and after modification.

2.5 detection of immunogenicity of protein stock before and after transformation

The results of the detection of the titer of the neutralizing antibodies in the serum corresponding to HPV56L1-VLP, HPV56L1t-VLP, HPV56L1q-VLP protein stock solution and homemade aluminum adjuvant before and after transformation are respectively diluted and mixed in proportion, and then mice are immunized, blood is collected and the neutralizing antibodies are detected according to the experimental method, wherein the results of the detection of the titer of the neutralizing antibodies in the serum corresponding to 1-day 2-day, 1-day 4-day 6-day 1-day.

The results of the neutralizing antibody titer detection in the mouse immunization experiment show that: there was no obvious difference in the level of neutralizing antibody titer caused by the target protein before and after the transformation, indicating that the transformation of the 420 th R mutation into T or Q on the amino acid sequence of HPV56L1 did not affect the immunogenicity of the corresponding VLPs.

Claims

1. A mutant human papillomavirus type 56L1 protein, wherein the amino acid sequence of said mutant is represented by SEQ ID NO:2 with threonine or glutamine at position 420 of the amino acid sequence encoded by the nucleotide sequence shown in figure 2.

2. The mutant nucleic acid of claim 1 which encodes.

3. The coding nucleic acid of claim 2, wherein the nucleotide sequence of the coding nucleic acid is based on SEQ ID NO:2 with ACC at the 3 rd base from 1258 to 1260 of the nucleotide sequence shown in fig. 2; or the 2 nd base substitution from 1259 to 1260 is AG.

4. An expression vector comprising the nucleic acid encoding the nucleic acid of claim 2 or 3.

5. The expression vector of claim 4, which is a prokaryotic expression vector.

6. The expression vector of claim 5, which is an E.coli expression vector.

7. The expression vector of claim 6, which is an inducible expression vector.

8. The expression vector of claim 7, wherein the starting vector is a pKL1 plasmid.

9. The expression vector of claim 8, wherein the nucleotide sequence is set forth in SEQ ID NO:1.

10. Recombinant bacterium comprising the expression vector according to any one of claims 4 to 9.

11. The recombinant bacterium of claim 10, which is a prokaryotic cell.

12. The recombinant bacterium according to claim 11, which is escherichia coli.

13. The recombinant bacterium according to claim 11, which is E.coli XA90.

14. A method for preparing a human papillomavirus type 56L1 protein, comprising the steps of culturing the recombinant bacterium of any one of claims 10 to 13, and isolating the human papillomavirus type 56L1 protein.

15. The method of claim 14, further comprising the step of purifying human papillomavirus type 56L1 protein.

16. The method of claim 15, wherein the step of purifying human papillomavirus type 56L1 protein is performed sequentially using a CHT column, a G25 desalting and liquid exchange column, a Source15Q anion exchange column, and a molecular sieve column.

17. A method for producing HPV56L1-VLP, comprising mixing the purified human papillomavirus type 56L1 protein obtained according to any one of claims 14 to 16 with an assembly liquid and allowing the mixture to stand;

the assembly liquid is 400-600 mM NaAc-HAc, 2.0~5.0M NaCl,0.05~0.5% Tween 80, and the pH value is 4.7-6.0.

18. The method of claim 17, wherein the purified human papillomavirus type 56L1 protein is obtained with an assembly solution according to a ratio of 4: mixing the materials according to the volume ratio of 1, and standing the mixture at room temperature for 1h to finish assembly.