CN116102627B

CN116102627B - Expression of human papilloma virus HPV35L1 protein and viroid particle and preparation method thereof

Info

Publication number: CN116102627B
Application number: CN202211702926.6A
Authority: CN
Inventors: 伍树明; 刘永江; 陈晓; 高文双; 王学红; 张海江; 沈迩萃; 薛俊莲; 张尧; 陈丹; 银飞; 王建英
Original assignee: Beijing Kangleweishi Biological Technology Co ltd
Current assignee: Beijing Kangleweishi Biological Technology Co ltd
Priority date: 2022-12-28
Filing date: 2022-12-28
Publication date: 2023-10-24
Anticipated expiration: 2042-12-28
Also published as: CN116102627A

Abstract

The invention relates to the field of medical biology, in particular to expression of human papilloma virus L1 protein and viroid-like particles and a preparation method thereof. Truncating the amino acid sequence of HPV35 type L1 protein, carrying out codon optimization on the truncated protein coding nucleotide sequence to obtain an optimized coding nucleotide sequence, and finally matching with an unlabeled expression vector containing a specific SD sequence to realize unlabeled expression purification. The invention can obtain higher protein expression quantity in a prokaryotic expression system such as an escherichia coli expression system and obtain VLP with more uniform quality through the improvement.

Description

Expression of human papilloma virus HPV35L1 protein and viroid particle and preparation method thereof

Technical Field

The invention relates to the field of medical biology, in particular to expression of human papilloma virus L1 protein and viroid-like particles and a preparation method thereof. More particularly relates to the construction and expression of human papillomavirus HPV35L1 protein VLP (virus-like particle).

Background

Human papillomavirus (human papilloma virus, HPV) is a non-enveloped, closed-loop, double-stranded DNA virus belonging to the subfamily polyomaviridae of papovaviridae, which mainly invades the epithelial mucosal tissue of the human body, thereby inducing various benign and malignant proliferative lesions. Over 200 types of HPV have been identified at present, HPV infection has obvious tissue specificity, different types of HPV have different tropisms to skin and mucous membrane, different papillary lesions can be induced, about 30 types of HPV are associated with genital tract infection, and about 20 types of HPV are associated with tumors.

HPV can be broadly divided into two categories, depending on the benign or malignant nature of the HPV-induced lesions: 1) High risk types (e.g., HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV35, etc.): high-risk HPV is closely related to human multiple tissue malignancies, mainly causing severe atypical hyperplasia and invasive carcinoma; 2) Low risk types (e.g., HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV72, HPV81, etc.): low-risk HPV can cause benign proliferative diseases of epidermal cells, such as condyloma acuminatum and condyloma plana. HPV is mainly composed of viral envelope and genomic DNA. The genome is about 7900bp long, and 8 viral protein coding genes exist. Among them, 6 proteins encoded by ORFs are expressed in the early stages of viral replication, called early proteins; the 2 ORF-encoded proteins are expressed in the late stages of viral replication, termed late stage proteins. Late proteins include major coat protein L1 and minor coat protein L2, and are involved in the formation of viral coat. The HPV viral coat protein can be self-assembled, and in the patent literature, a yeast expression system or an insect expression system or an L1 protein expressed independently in a mammalian cell expression system or an L1 protein and an L2 protein are co-expressed to form a virus-like particle (VLP), and after immunization with VLP produced by an exogenous expression system, a neutralizing antibody can be induced in vivo, so that a good immune protection effect is obtained. However, the use of eukaryotic expression systems for direct expression of assembled VLPs in vivo is not very uniform in the nature of VLP production and the cost of eukaryotic expression systems is high and is not conducive to industrialization.

At present, aiming at HPV type 35, reports are made in CN202110442669.6, wherein an HPV35L1 protein is produced by using a Hansenula polymorpha expression system, the Hansenula polymorpha expression system is a eukaryotic expression system, VLP is directly assembled in vivo, and whether a qualified standard protein can be normally expressed in an escherichia coli prokaryotic expression system is not suggested in the patent, and the escherichia coli prokaryotic expression system does not have the functions of post-translational modification and the like of the Hansenula polymorpha expression system, so that the expression of HPV35L1 in the prokaryotic expression system is difficult to a certain extent. Thus, there is a need to address the problem of difficulties in expressing HPV35L1 protein within prokaryotic expression systems to obtain more uniform VLPs and lower costs for industrial applications.

Disclosure of Invention

The inventor aims at expressing HPV35L1 protein in a prokaryotic expression system based on the cost of vaccine finished products, and solves the problem that the HPV35L1 protein is difficult to express in the prokaryotic expression system. The method is realized by the following improvement: truncating the amino acid sequence of HPV35 type L1 protein, carrying out codon optimization on the truncated protein coding nucleotide sequence to obtain an optimized coding nucleotide sequence, and finally matching with a label-free expression vector containing a specific SD sequence to realize efficient expression and purification.

Firstly, the amino acid sequence (shown as SEQ ID NO: 3) of HPV35L1 protein is subjected to N/C end truncation treatment, so as to obtain better protein expression rate. The N-terminal truncation is no more than 10 amino acids, preferably 4 amino acids. The C-terminal truncation is not more than 30 amino acids, preferably 28 amino acids, and the specific truncated amino acids are set forth in SEQ ID NO:1. after N/C-terminal truncation treatment, the protein and VLP of higher quality are expressed and obtained on the unlabeled expression vector.

Wherein SEQ ID NO:1 as follows:

1 MSNEATVYLP PVSVSKVVST DEYVTRTNIY YHAGSSRLLA VGHPYYAIKK

51 QDSNKIAVPK VSGLQYRVFR VKLPDPNKFG FPDTSFYDPA SQRLVWACTG

101 VEVGRGQPLG VGISGHPLLN KLDDTENSNK YVGNSGTDNR ECISMDYKQT

151 QLCLIGCRPP IGEHWGKGTP CNANQVKAGE CPPLELLNTV LQDGDMVDTG

201 FGAMDFTTLQ ANKSDVPLDI CSSICKYPDY LKMVSEPYGD MLFFYLRREQ

251 MFVRHLFNRA GTVGETVPAD LYIKGTTGTL PSTSYFPTPS GSMVTSDAQI

301 FNKPYWLQRA QGHNNGICWS NQLFVTVVDT TRSTNMSVCS AVSTSDSTYK

351 NDNFKEYLRH GEEYDLQFIF QLCKITLTAD VMTYIHSMNP SILEDWNFGL

401 TPPPSGTLED TYRYVTSQAV TCQKPSAPKP KDDPLKNYTF WEVDLKEKFS

451 ADLDQFPLGR KFLLQAGLKA。

secondly, in order to efficiently express HPV35L1 protein using the escherichia coli system, the inventors have identified the sequence according to SEQ ID NO:1, and codon optimization of the nucleotide sequence is performed on an escherichia coli system. The optimization principle comprises the following steps: a) Selecting codons with highest or higher use frequency according to a use frequency table of the escherichia coli genetic code; b) The usual restriction enzyme recognition sites are eliminated. The optimized nucleotide sequence is obtained through the principle and multiple screening, and the optimized nucleotide sequence is shown as SEQ ID NO:2, and further provides expression cassettes, expression vectors and recombinant host cells containing said coding nucleic acids. Preferably, it is E.coli.

Finally, the invention provides a label-free expression vector of a specific SD sequence. For the expression vector, the vector pGEX for expressing the fusion protein is characterized in that a 26kDa glutathione S-transferase Gene (GST) is connected to the vector, and compared with other fusion vectors, the vector has the characteristics of mild purification condition, simple steps, no addition of denaturing agents and capability of maximally maintaining the spatial conformation and immunogenicity of the purified protein; the GST fusion protein tag has good application value, but the GST fusion protein tag coded by the vector pGEX can increase the potential safety hazard of medicinal protein products. In contrast, the GST tag of the vector is removed, and the SD sequence capable of efficiently expressing the HPV35 type L1 protein is replaced, so that a novel expression vector suitable for the HPV35L1 protein is formed. Among them, the SD sequence is preferably AGGAGATATA (5 'to 3').

The invention also provides a method for preparing the HPV35 type L1 VLP, which is characterized by comprising the following steps: according to the step of HPV35 type L1 protein obtained by the method, the pH and salt concentration of a buffer solution in which the HPV35 type L1 protein is positioned are regulated, so that the HPV35 type L1 protein is self-assembled to form VLP.

Preferably, the buffer includes, but is not limited to, tris buffer, phosphate buffer, acetate buffer, HEPES buffer, MOPS buffer, citric acid buffer, histidine buffer, boric acid buffer, preferably phosphate buffer;

the pH of the buffer is 4.75-5.25, the salt concentration is 2.0-4.0M, preferably pH4.75, pH5.0, pH5.25; wherein the salt concentration is between 2.0 and 4.0M, preferably 2.0M,2.5M,3.0M,3.5M,4.0M;

the invention can obtain higher protein expression in a prokaryotic, such as escherichia coli expression system and obtain VLPs with more uniform quality through the improvement.

Drawings

FIG. 1 XA90 pKL1-HPV35L1 vial expression electrophoresis detection results. Wherein M is marker; XA90pKL1 negative control; XA90 pKL1-HPV35L1-1 whole bacteria; XA90 pKL1-HPV35L1-1 supernatant; XA90 pKL1-HPV35L1-1 precipitate; 5.HPV18L1;6.XA90 pKL1-HPV35L1-2 whole bacteria; XA90 pKL1-HPV35L1-2 supernatant; XA90 pKL1-HPV35L1-2 precipitate.

FIG. 2 shows the result of HPV35L1 pentamer electrophoresis detection obtained by purification. Wherein M is marker; hpv35l1 pentamer.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Embodiment one: construction of a Label-free expression vector containing specific SD sequences

1. NdeI cleavage site was introduced into pGEX-6P-2 plasmid by mutation PCR:

the PCR primer names and sequences were as follows:

forward primer: 6p1-Ndeimut-F (5 'to 3'):

ATTTCA CACAGG AAACAG TACATA TGTCCC CTATAC TAGGTT ATTGGA AAATTA AG；

reverse primer: 6p1-NdeIMut-R sequence (5 'to 3'):

ATAACC TAGTAT AGGGGA CATATG TACTGT TTCCTG TGTGAA ATTGTT ATCC。

the PCR reaction system is as follows: 5 Xphusion HF buffer 10. Mu.L, ddH ₂ O30.5. Mu.L, 10mM dNTP 2. Mu.L, 6 PNE-SDm-F1. Mu.L, 6 PNE-SDm-R1. Mu.L, pGEX-6P-2 (20-fold dilution) 5. Mu.L, phusion HF Enzyme 0.5.5. Mu.L.

PCR reaction program setting: 3min at 95 ℃;95℃1min,55℃1min,72℃10 min; cycling for 20 times; 15min at 72 ℃.

The PCR product was digested with DpnI and transformed into DH 5. Alpha. Host bacteria, and cultured overnight to obtain a monoclonal colony. And (3) performing amplification culture on the monoclonal colony, sequencing a vector sequence in the monoclonal colony by a professional gene sequencing company, selecting a clone with a correct sequencing result, and performing cloning amplification and plasmid extraction on the clone to obtain a vector successfully introduced into NdeI restriction enzyme sites.

2. Designing mutation PCR primer for replacing SD sequence, and replacing SD sequence of original carrier by PCR method

Primer information is as follows:

6PNE-SDm-F(5'to3')：CAATTTCACACAGGAGATATACATATGTCCCCTATACTAGG

6PNE-SDm-R(5'to3')：GTATAGGGGACATATGTATATCTCCTGTGTGAAATTGTTATCC

the PCR reaction system is as follows: 10. Mu.L of 5 Xphusion HF buffer，ddH ₂ O30.5. Mu.L, 10mM dNTP 2. Mu.L, 6 PNE-SDm-F1. Mu.L, 6 PNE-SDm-R1. Mu.L, 5. Mu.L of plasmid obtained in step 1.1, phusion HF Enzyme 0.5.5. Mu.L.

PCR reaction program setting: 3min at 95 ℃;95 ℃ for 1min,55 ℃ for 1min and 72 ℃ for 10 min; cycling for 20 times; 15min at 72 ℃.

The PCR product was digested with DpnI and transformed into E.coli DH 5. Alpha. And cultured overnight to obtain monoclonal colonies. And (3) performing amplification culture on the monoclonal colony, sequencing the vector sequence in the monoclonal colony by a professional gene sequencing company, selecting a clone with a correct sequencing result, and performing cloning and propagation on the clone and extracting plasmids from the clone to obtain the vector with the SD sequence replaced successfully. The SD sequence after substitution was AGGAGATATA (5 'to 3').

3. Vector was digested with NdeI and BamHI to remove GST gene

The enzyme digestion system is as follows: cutsmart buffer 3. Mu.l, ddH ₂ O3. Mu.l, 1.2. Mu.l of the obtained vector, ndeI 2. Mu.l, bamHI 2. Mu.l.

Enzyme cutting at 37 ℃ for 2 hours; 0.8% agarose gel electrophoresis, 120V,1h; and (3) cutting gel to obtain a carrier fragment with GST genes removed, corresponding to the electrophoresis band, and preserving at 4 ℃.

The carrier fragment was recovered by using an agarose gel recovery kit, and 3. Mu.l of the obtained carrier fragment was subjected to electrophoresis detection and recovery. Then the double enzyme cutting product is used for filling the sticky end by DNA polymerase I, and the reaction system is as follows: 10 XT 4 DNA ligase buffer 2.5. Mu.l, ddH ₂ O1.8. Mu.l, gel recovered enzyme-cleaved vector fragment 20. Mu.l, 10mM dNTP 0.2. Mu.l, DNA polymerase I0.5. Mu.l, reacted at 25℃for 15min, EDTA (final concentration of EDTA 10 mM) was added and heated at 75℃for 20min to terminate the reaction.

And (3) carrying out religation cyclization on the carrier subjected to enzyme digestion and end-complemented, wherein a connection system is as follows: 2. Mu.l of T4 DNA ligase buffer, 16. Mu.l of linear blunt end vector fragment, 2. Mu.l of T4 DNA ligase, and 4h at 16 ℃.

The ligation product was digested and transformed into E.coli DH 5. Alpha. And cultured overnight to obtain monoclonal colonies. And (3) performing amplification culture on the monoclonal colony, sequencing a vector sequence in the monoclonal colony by a professional gene sequencing company, selecting a clone with a correct sequencing result, performing cloning amplification and plasmid extraction on the clone, and obtaining a vector for successfully replacing the SD sequence and removing the GST gene.

PCR amplified plasmid, reintroduced NdeI and BamHI cleavage sites

The PCR primers were as follows:

6PNE-SDm-noG-F (5'to3')：CAGGAGATATACATATGGGATCCCCGGAATTCCCG

6PNE-SDm-noG-R (5'to3')：GAATTCCGGGGATCCCATATGTATATCTCCTGTGTG

the PCR reaction system is as follows: 10. Mu.L of 5 Xphusion HF buffer, 30.5. Mu.L of ddH2O, 2. Mu.L of 10mM dNTP, 6 PNE-SDm-noG-F1. Mu.L, 6 PNE-SDm-noG-R1. Mu.L, 5. Mu.L of template plasmid, phusion HF Enzyme 0.5.5. Mu.L.

The PCR product was digested with DpnI and transformed into E.coli DH 5. Alpha. And cultured overnight to obtain monoclonal colonies. The monoclonal colony is subjected to amplification culture, then the vector sequence in the monoclonal colony is sequenced by a professional gene sequencing company, clones with correct sequencing results are selected, then the clones are amplified and plasmids are extracted from the clones, the SD sequence is successfully replaced, GST genes are removed, and NdeI and BamHI vectors are reintroduced. Thus, the vector pKL1 was constructed.

Embodiment two: construction of expression vector containing codon optimized HPV35L1 Gene

The truncated sequence of human papillomavirus type 35 coat protein L1 (HPV 35L 1) gene is synthesized artificially, the sequence is shown as SEQ ID No.2 (the coded amino acid sequence is shown as SEQ ID NO.1, the N end of the truncated sequence is truncated by 4 amino acids and the C end of the truncated sequence is truncated by 28 amino acids relative to the wild type amino acid sequence shown as SEQ ID NO. 3), the DNA fragment of HPV35L1 is amplified by PCR, the L1 gene PCR fragment containing NdeI and Xho1 cleavage sites and the recombinant vector are respectively subjected to NdeI/Xho1 double cleavage, and then the recovered gene fragment and pKL1 containing the corresponding cohesive end are subjected to ligation reaction by using T4 DNA ligase, and the temperature is 10-15 h. The connection system is as follows: 6 μl of pKL1 vector fragment, HPV35L1 gene fragment2. Mu.l, 1. Mu.l of T4 DNA ligase buffer. Conversion of ligation products to ligation products after ligation reactionsE. coli Screening of recombinants was performed in DH 5. Alpha. And (3) performing amplification culture on the screened monoclonal colony, extracting plasmids, and then performing sequencing verification to obtain a recombinant expression vector pKL1-HPV35L1.

Embodiment III: expression of HPV35L1 protein

The recombinant vector pKL1-HPV35L1 with correct sequencing result in the second example is transformed into E.coli XA90 host cell, and is used as engineering bacteria for expressing recombinant protein to express HPV L1 protein. 0.05% of the inoculum size was inoculated into LB medium (Amp+) and cultured at 37℃and 220rpm for 16 hours for activation. Inoculating the activated bacterial liquid into a 2YT culture medium according to the inoculum size of 0.5%, culturing at 30 ℃ for 7h at 220rpm, adding IPTG with the final concentration of 0.2mM, performing induction culture at 30 ℃ for 16h at 220rpm, ending fermentation, and centrifugally collecting bacterial bodies for expression amount detection and purification experiments. From the result of SDS-PAGE, the protein after technical scheme improvement is soluble and efficiently expressed, the molecular weight of HPV35L1 protein is about 52.49 kDa, and the specific result is shown in FIG. 1.

As can be seen in FIG. 1, XA90pKL1 is a negative control. The test sample lanes showed a distinct expression band at a position corresponding to the theoretical molecular weight size of the protein of interest (about 52.49 kDa) compared to the negative control. The "-1" and "-2" after the sample names represent parallel 1 and parallel 2. The darkest color and the thickest band in the figure are the target protein bands. The expression level of the target protein unit cell is about 0.4mg/g wet cell.

Embodiment four: HPV35L1 protein VLP purification and assembly

Taking a proper amount of thalli according to the mass volume ratio of 1:10, fully re-suspending the bacterial cells by using a bacteria breaking buffer (20 mM PB,20 mM DTT,pH8.0), and then crushing the bacterial cells by using a high-pressure homogenizer under the following conditions: 800 bar,3 times. The cell disruption solution was then centrifuged at high speed (4 ℃,12000 rpm,60 min) to collect the supernatant. The supernatant was further precipitated by ammonium sulfate with a saturation of 30%, and the precipitate was collected by centrifugation (4 ℃,12000 rpm,60 min) at a mass to volume ratio of 1:10, and re-centrifuging (at 4 ℃ C., 12000 rpm,60 min) after fully re-dissolving with a re-dissolving buffer (20 mM PB,20 mM DTT,pH8.0), and collecting the supernatant to obtain a crude pure solution. The crude pure solution is firstly loaded to carry out Superdex200 molecular sieve chromatography, and the molecular sieve buffer solution (20 mM PB,20 mM DTT,pH8.0) collects the components of the L1 target protein according to the peak position. And then loading the molecular sieve collected sample to perform Source15Q anion exchange chromatography (SQ low-salt buffer solution: 5 mM PB,10 mM DTT,pH8.0,SQ high-salt buffer solution: 5 mM PB,1M NaCl,10 mM DTT,pH8.0), and linearly eluting and collecting components of the L1 target protein by 10 column volumes through 0-20% high-salt buffer solution, wherein the components are the purified L1 protein. The mass of the L1 pentamer was determined by Dynamic Light Scattering (DLS). Finally, the pH and salt concentration of the buffer solution in which the L1 protein is positioned are adjusted to self-assemble to form VLPs, and the preparation of the VLPs is completed. Finally, the quality of VLPs was determined by DLS.

TABLE 1 DLS detection results before and after HPV35L1 protein Assembly

As can be seen from the table, HPV35L1 has a good pentameric state of PdI.ltoreq.0.1. Particle size of VLP: 45 The particle size of nm is less than or equal to 75 nm, the PdI is less than or equal to 0.1, and the VLPs with good assembly and formation states can be effectively assembled.

Fifth embodiment: long-term stability investigation

The HPV35L1 protein VLP prepared in example 4 above was taken and examined for long-term stability data at-70 ℃ as follows.

It can be seen that after long-term examination for 9 months, the appearance, pH value, VLP average particle size and dispersion coefficient, purity, in vitro potency and the like of the antigen protein have no obvious change, and the antigen protein is quite stable (equivalent to a control in 0 month).

Claims

1. A truncated HPV35 type L1 protein is characterized in that the amino acid sequence of the truncated HPV35 type L1 protein is shown in SEQ ID NO. 1.

2. A nucleic acid encoding the truncated HPV type 35L1 protein of claim 1.

3. The nucleic acid of claim 2, wherein the nucleotide sequence is set forth in SEQ ID No. 2.

4. A nucleic acid consisting of an SD sequence and a nucleic acid according to claim 2 or 3, the nucleotide sequence of said SD sequence being 5 '-AGGAGGAATTA-3'.

5. An expression cassette or expression vector comprising the nucleic acid of claim 4.

6. The expression cassette or expression vector of claim 5, which is a prokaryotic expression vector.

7. The expression cassette or expression vector of claim 6, wherein the GST tag sequence is removed based on the vector pGEX and the nucleic acid of claim 4 is integrated.

8. A recombinant host cell comprising the expression cassette or expression vector of any one of claims 5 to 7.

9. The recombinant host cell of claim 8, which is e.

10. A method of expressing the truncated HPV type 35L1 protein of claim 1, wherein the recombinant host cell of claim 8 or 9 is cultured to produce HPV type 35L1 protein, and the purification step.

11. The method of claim 10, wherein the purifying step is: taking thalli of the recombinant host cells, fully re-suspending the thalli by using a bacteria breaking buffer solution, then crushing the thalli at high pressure by using a high-pressure homogenizer, and centrifugally collecting supernatant; the supernatant is further precipitated by ammonium sulfate, the final saturation of ammonium sulfate is 30%, and the supernatant is centrifugally collected again after precipitation and redissolution to obtain crude pure liquid;

loading the crude pure solution to perform Superdex200 molecular sieve chromatography, and collecting the components of the L1 target protein according to the peak position of the L1 target protein;

and then loading a molecular sieve collected sample to perform Source15Q anion exchange chromatography, and collecting components of the L1 target protein by NaCl linear elution to obtain HPV35 type L1 protein.

12. A method for preparing HPV type 35L1 protein VLPs, comprising the steps of: the process of HPV type 35L1 protein obtained according to claim 10 or 11, wherein the pH of the buffer is adjusted to between 4.75 and 5.25 and the salt concentration is between 2.0 and 4.0M to self-assemble the HPV type 35L1 protein VLP.

13. The method of claim 12, wherein the buffer is selected from Tris buffer, phosphate buffer, acetate buffer, HEPES buffer, MOPS buffer, citrate buffer, histidine buffer, borate buffer.

14. The method of claim 13, wherein the buffer has a pH of 4.75, pH5.0, pH5.25; the salt concentration was 2.0M,2.5M,3.0M,3.5M and 4.0M.

15. The method of claim 14, further comprising the step of purifying the resulting HPV type 35L1 protein VLPs.