CN116356054A

CN116356054A - Kit for detecting common pathogenic microorganisms and drug resistance genes and detection method

Info

Publication number: CN116356054A
Application number: CN202310206252.9A
Authority: CN
Inventors: 张盼; 郭文浒; 刘华勇; 陈浩; 杨洁; 刘斌
Original assignee: Fuzhou Aojixin Biotechnology Co ltd
Current assignee: Fuzhou Aojixin Biotechnology Co ltd
Priority date: 2023-03-06
Filing date: 2023-03-06
Publication date: 2023-06-30

Abstract

The invention relates to the technical field of biology, in particular to a kit for detecting common pathogenic microorganisms and drug resistance genes and a detection method. The kit comprises a reverse transcription system, a first round of amplification system, a second round of amplification system, a positive quality control product and a negative quality control product, wherein the first round of amplification system comprises a primer library, the Tm value of primers in the primer library is kept at 60+/-5 ℃, the length of amplicons is 100-200 bp, the length of the primers is 15-25, the GC content is 40-65%, and RNA base modification and 3 '-end Spacer C3 modification are carried out at the 3' -end of the primers. The kit carries out RNA base modification and 3 '-end Spacer C3 modification on the 3' -end of the primer, avoids the formation of a dimer between the primers, and realizes the co-determination of DNA and RNA.

Description

Kit for detecting common pathogenic microorganisms and drug resistance genes and detection method

Technical Field

The invention relates to the technical field of biology, in particular to a kit for detecting common pathogenic microorganisms and drug resistance genes and a detection method.

Background

Pathogenic microorganism detection is a difficult problem in infection diagnosis, and infection symptoms caused by different microorganisms are often very similar and difficult to distinguish. For most pathogens, the culture is a gold standard for detecting microorganisms, the time consumption for separating and culturing is long, the sensitivity is limited, and the culture method is very high or even impossible for some microorganisms, so that the current situation of difficult diagnosis occurs. Traditional immunological means and molecular biological methods can only detect a single or a few common pathogens, and the limitation is that the prediction of pathogens from patients often depends on clinicians, and the empirical prediction is at a certain risk of misdiagnosis.

In recent years, the development of metagenomic next-generation sequencing (mNGS) detection can detect pathogens in a sample without preference, and can detect all bacteria, fungi, viruses, parasites and other special pathogens in the sample at one time without prejudgment, so that the kit is particularly suitable for detecting clinical critical infection. For example, the Chinese patent publication No. CN113337639B discloses a method for detecting novel COVID-19 coronavirus based on mNGS and application thereof, wherein the method improves the reverse transcription efficiency of novel coronavirus RNA, reduces the problem of aerosol pollution and simultaneously improves the enrichment capability of different variant virus nucleic acid sequences by designing and preparing a multiplex genome specific reverse transcription primer group of the novel COVID-19 coronavirus.

However, with the development of technology, the limitations of metagenome are gradually revealed: (1) because of the characteristics of a biological sample with extremely high occupancy rate and low microorganism content of a human host of mNGS, the real available sequencing data is often less than 10 percent, even most samples are less than 1 percent, the technical characteristic of low sensitivity is caused, and a large amount of background microorganisms are easily brought out to interfere with an interpretation result; (2) the mNGS product has high detection cost and high requirements on experimental technicians, so that the detection price is high, the single detection cost of 3000-5000 yuan is high, the audience of the product is small, and even the product is a product only facing critical patients; (3) the process is complex, and the error risk is high; the detection period is long, and the feedback of the detection result is slow; (4) the low sensitivity leads to the characteristics of fragmentation and randomization for capturing pathogen information, can not obtain stable and reliable monitoring information, can not monitor drug resistance genes, virulence factors and virus mutation, can not distinguish and type pathogens with high homology, and is an important limitation of classical metagenome detection. (5) The mNGS product is limited by technology, DNA and RNA flows are difficult to combine for detection, and the detection of the shunt leads to increased cost and increased detection burden of patients.

The targeted capture sequencing (Targeted capture sequencing, tNGS) can be compatible with the mNGS technology, has the characteristic of no preference for rapid detection of multiple clinical pathogens, can design a corresponding common pathogen detection list according to the disease characteristics, reduces the detection cost, improves the detection sensitivity, can genotype pathogens at the seed level, and can detect drug-resistant genes. the tNGS technology can be used as a supplement to clinical mNGS products, is used for detecting clinically unknown pathogens, and can also be used for monitoring medication prognosis.

There are two common technical routes for targeted capture sequencing, one is probe capture and one is super multiplex PCR. The probe capturing method can detect more covered pathogens and gene mutation types, and the pathogen gene coverage is better, but the hybridization capturing time is long, the steps are complicated, and the cost is high. The multiplex PCR method has the advantages of simple operation, short time, high sensitivity, simple requirement on instruments and equipment and suitability for clinical pathogen detection. However, the difficulty in the development of multiplex PCR products is (1) how to design specific amplification primers for a wide range of pathogens, which can differentiate between different genus or species of pathogens, and cover as much as possible the inter-species type differences; (2) How to reduce abnormal structures such as dimer, hairpin structure and the like formed among hundreds, thousands or tens of thousands of primers in the same PCR reaction tube as much as possible; (3) How to adjust the amplification efficiency difference among the primers to make the amplification efficiency among the primers as uniform as possible; (4) How to flexibly adjust the primer combination in the panel according to the needs, and the method is suitable for optimizing the performance of the product.

Disclosure of Invention

In order to overcome the defects of the prior art, the technical problem to be solved by the invention is to provide a kit and a detection method for detecting common pathogenic microorganisms and drug resistance genes, wherein the method is wide in coverage, quick in timeliness, high in sensitivity and strong in specificity, and the method aims at non-diagnosis.

In order to solve the technical problems, the invention adopts the following technical scheme: the kit for detecting common pathogenic microorganisms and drug-resistant genes comprises a reverse transcription system, a first round of amplification system, a second round of amplification system, a positive quality control product and a negative quality control product, wherein the first round of amplification system comprises a primer library, the Tm value of primers in the primer library is kept at 60+/-5 ℃, the length of amplicons is 100-200 bp, the length of the primers is 15-25, the GC content is 40-65%, and RNA base modification and 3 '-end Spacer C3 modification are carried out at the 3' -end of the primers.

The other technical scheme of the invention is as follows: the detection method for detecting common pathogenic microorganisms and drug-resistant genes comprises the following steps:

s1: performing nuclear DNA/RNA nucleic acid co-extraction on a sample to be detected;

s2: reverse transcription;

s2: sequentially carrying out multi-targeting PCR (polymerase chain reaction) amplification by using the kit, sorting fragments, amplifying by adding a joint and purifying again to obtain a library;

s3: sequencing and data analysis are carried out on the library after quality inspection, and data quality control results and pathogen detection results are output.

The invention has the beneficial effects that: the invention develops a rapid enrichment detection method and a detection kit for clinically common 218 pathogenic microorganisms and 15 drug resistance genes based on a super-multiplex PCR technology and a high-throughput sequencing technology. The kit covers 218 pathogens, including 98 bacteria, 26 fungi, 18 DNA viruses and 35 RNA viruses, and 16 special pathogens. The detection of 15 important drug-resistant genes common in clinic is also covered. And meanwhile, the pathogen detection is satisfied, and meanwhile, the drug-resistant genes are subjected to typing detection. The method can be suitable for detecting common clinical pathogenic microorganisms such as respiratory tract infection, blood flow infection, central nervous infection and the like and drug resistance genes.

Aiming at the characteristics of pathogenic microorganisms such as bacteria, fungi, DNA viruses, RNA viruses and the like and the characteristics of multiple types of samples from different sources (alveolar lavage fluid, sputum, blood, cerebrospinal fluid and the like) and different types of pathogens (bacteria, fungi, DNA viruses, RNA viruses and the like), the invention develops a DNA and RNA co-extraction method, and DNA and RNA in the sample can be enriched simultaneously by one-time nucleic acid extraction; the pathogen detection at the DNA and RNA layers can be covered at one time, and the suspected pathogen in the sample can be detected to the greatest extent with the least sample and the lowest cost.

When the kit provided by the invention is used for detection, the related multiplex PCR method is simple to operate, short in time, high in sensitivity, and simple in requirements on instruments and equipment, and is very suitable for the requirements of clinical pathogen detection.

However, the difficulty in the development of multiplex PCR products is (1) how to design specific amplification primers for a wide range of pathogens, which can differentiate between different genus or species of pathogens, and cover as much as possible the inter-species type differences; (2) How to reduce abnormal structures such as dimer, hairpin structure and the like formed among hundreds, thousands or tens of thousands of primers in the same PCR reaction tube as much as possible; (3) How to adjust the amplification efficiency difference among the primers to make the amplification efficiency among the primers as uniform as possible; (4) How to flexibly adjust the primer combination in the panel according to the needs, and the method is suitable for optimizing the performance of the product.

Aiming at the difficulties, the invention carries out RNA base modification and 3 'end Spacer C3 modification on the 3' end of the primer, so as to avoid the formation of dimer between the primers; the Tm value of the primer is kept uniform (60 ℃ +/-5 ℃), the length of the amplicon is 100-200 bp, the length of the primer is 15-25, the GC content is 40-65, and the formation of dimers, hairpin structures and the like between the upstream primer and the downstream primer is avoided as much as possible; and then, the primer input amount and the primer input proportion are optimized to improve the uniformity of amplification efficiency among primers, and the library member system is optimized to realize detection of common pathogenic microorganisms and drug resistance genes.

Drawings

FIG. 1 is a summary of the common pathogenic microorganisms and drug-resistant genes detectable by the present invention;

FIG. 2 is a flow chart showing a method for detecting common pathogenic microorganisms and drug resistance genes according to a second embodiment of the present invention;

FIG. 3 is a diagram showing the quality inspection results of library fragments of the second embodiment of the present invention for detecting common pathogenic microorganisms and drug-resistant genes.

Detailed Description

In order to describe the technical contents, the achieved objects and effects of the present invention in detail, the following description will be made with reference to the embodiments in conjunction with the accompanying drawings.

The most critical concept of the invention is as follows: RNA base modification and 3 'end Spacer C3 modification are carried out on the 3' end of the primer, so that dimer formation between the primers is avoided, and DNA and RNA co-measurement is realized.

The invention relates to a kit for detecting common pathogenic microorganisms and drug-resistant genes, which comprises a reverse transcription system, a first round of amplification system, a second round of amplification system, a positive quality control product and a negative quality control product, wherein the first round of amplification system comprises a primer library, the Tm value of primers in the primer library is kept at 60+/-5 ℃, the length of amplicons is 100-200 bp, the length of the primers is 15-25, the GC content is 40-65%, and the 3 '-end of each primer is subjected to RNA base modification and 3' -end Spacer C3 modification.

From the above description, it is known that the 3' -end of the primer is modified with RNA base and modified with 3' -end Spacer C3, and the RNA base is sheared off only when the primer modified with RNA base is completely matched with the template, so that the 3' -end of the primer is released from Spacer C3 closure for extension and amplification. When the primer is not completely matched with the template, the dimer formed between the primers cannot be amplified by normal PCR, so that the signal amplification of the primer dimer and the influence on target PCR amplification are improved and reduced. Illustratively, the modified target primer structure is shown below.

SSQDB-F：5’-GCTGACAGAACGACATGGCTACGATCCGACTTTACGGC ATTGGCATCA/rG/GTCTA-3’-Spacer C3

SSQDB-R：5’-TTGTCTTCCTAAGACCGCTTGGCCTCCGACTTCTCGTC CCGGTGCTT/rC/AGGAG-3’-Spacer C3

Note that: in the primer sequence/rN/, "N" is RNA base.

When designing the primer of the target pathogen, all database information of target pathogen nucleic acid in NCBI is downloaded through software for comparison, and then specific primers are designed aiming at conserved regions of different pathogens. The Tm value of the primers designed according to different types at the level of seeds or subspecies or variety is kept uniform (60 ℃ +/-5 ℃), the length of the amplicons is 100-200 bp, the length of the primers is 15-25, the GC content is 40-65, and the formation of dimers, hairpin structures and the like between the upstream and downstream primers is avoided as much as possible. After the design of the primers for Panel (Gene combination) is completed, each primer is compared in a database to ensure the specificity of the primer, then the primers in the Panel are compared by software, and the condition that a dimer is formed among the primers is analyzed, so that the primers capable of forming the dimer are removed. And then, verifying through enterprise standard sample and clinical sample, further removing the primer which is easy to form dimer and the primer with low amplification efficiency, and further screening out the final primer panel combination. Aiming at the optimized panel, the primer can be supplemented and removed at any time according to the requirements of customers and the detection performance of products, the effect of the original primer panel is not greatly influenced, and the primer panel can be flexibly adjusted with low cost in a period of time to form a specific detection product.

The primer library of the present invention covers 218 pathogens, including 98 bacteria, 26 fungi, 18 DNA viruses and 35 RNA viruses, and 16 specific pathogens. The detection of 15 important drug-resistant genes common in clinic is also covered. The detailed pathogen and drug resistance genes are shown in FIG. 1. When 218 pathogens and 15 important drug resistance gene primer libraries were designed using the above primer design scheme, all of them could be detected simultaneously.

Further, the dimer content of the pool was < 10%.

Further, the reverse transcription system includes a reverse transcription buffer, a reverse transcriptase, a random primer hexamer, and a nucleic acid template.

Further, the volume ratio of reverse transcription buffer, reverse transcriptase, random primer hexamer, and nucleic acid template is 5:0.5:0.5:1:3.

Further, the first round amplification system also included multiplex PCR amplification premix, RNaseH2, internal controls, and H2O.

Further, the multiplex PCR amplification premix comprises a DNA polymerase, mgCl ₂ KCl, dNTPs, DMSO and BSA.

Further, the second round of amplification system includes universal adaptor primers, tagged adaptor primers, and a PCR amplification premix.

Referring to fig. 2, another technical scheme of the present invention is as follows: the detection method for detecting common pathogenic microorganisms and drug-resistant genes is characterized by comprising the following steps:

s2: reverse transcription;

As can be seen from the above description, the present invention has developed a method for co-extracting DNA and RNA for the characteristics of multiple types of pathogenic microorganisms including bacteria, fungi, DNA viruses, RNA viruses, etc., and for different types of source samples (alveolar lavage fluid, sputum, blood, cerebrospinal fluid, etc.), the present invention can simultaneously enrich DNA and RNA in a sample by one nucleic acid extraction; the pathogen detection at the DNA and RNA layers can be covered at one time, and the suspected pathogen in the sample can be detected to the greatest extent with the least sample and the lowest cost.

The method is established by a Hua Dazhi sequencing platform methodology, and the primer structure is modified according to the joint structure of a mainstream high-throughput sequencing platform (illuminea, hua Dazhi) on the market. The detection of pathogens is completed through two rounds of PCR, the primer structure of the first round of PCR is that the 5' end of a target specific primer is connected with a section of universal sequence of a sequencing platform joint, and the second round of PCR primer is that based on the sequencing platform and provided with index sequences, is used for forming a complete library structure, and meanwhile, different samples are distinguished by index. The first and second rounds of primer structure were as follows:

first round primer structure example:

note that: in the primer sequence/rN/, "N" is RNA base.

Second round primer structure example:

universal Primer (Universal adapter Primer): 5'-Phos-GAACGACATGGCTACGAT CCGACT-3'

Index Primer (tag adapter Primer): 5'-TGTGAGCCAAGGAGTTGXXXXXX XXXXTTGTCTTCCTAAGACCGCTTGG-3'

Note that: the "X" in the primer sequence is the Index sequence.

Further, the concentration of DNA after S1 extraction is not less than 0.1 ng/. Mu.L.

Further, the number of PCR cycles in the multiplex targeted PCR amplification is 20 to 35, and the number of amplification cycles in the multiplex targeted PCR amplification is 9 to 17.

From the above description, it is understood that the PCR amplification efficiency can be improved by the optimal number of PCR cycles.

Further, the specific steps of fragment sorting are as follows: and adding magnetic beads into the amplified product for incubation, and then taking the supernatant, adding the magnetic beads again for purification to obtain a fragment purification product.

From the above description, the primer dimer is removed by carrying out fragment sorting on the first round of PCR products, so that the purity of the target amplified products is improved, the yield and purity of the targets of the second round of PCR products are further improved, the quality of sequencing data can be improved, the pathogen detection sensitivity is improved, the sequencing data volume waste is reduced, and the detection cost is reduced.

Further, the total amount of the mixed library is 190-210 ng, and the volume of the mixed library is 46-50 mu L.

Further, the volume ratio of the template DNA to the entire amplification system of S2 is 2:5.

from the above description, it is understood that uniformity of amplification efficiency among primers can be improved by optimizing the amount of primer input.

Partial primer effect is described in example one

The first embodiment of the invention is as follows: the components of the kit for detecting common pathogenic microorganisms and drug resistance genes are shown in table 1. The PCR amplification premix is KAPA2G Fast Multiplex Mix mixed system, and RNaseH2 is RNase H2 enzyme of NEB.

TABLE 1

Note that: the reagent components in Table 1 are all commercial conventional reagents except for primer libraries and positive quality control products.

TABLE 2

Note that: table 2 provides primers that are specific amplified sequences, with the addition of sequence GCTGACAGAACGACATGGCTACGATCCGACTT (universal adaptor) at the 5' end during synthesis; rC/stands for ribonucleotide modified cytosine,/rA/stands for ribonucleotide modified adenine,/rG/stands for ribonucleotide modified guanine,/rT/stands for ribonucleotide modified thymine, and the 3' end is modified with a Spacer C3.

The Tm value of the primer in the primer library is kept at 60+/-2 ℃, the length of the amplicon is 100-200 bp, the length of the primer is 15-25, the GC content is 40-65%, the post six positions of the 3 '-end of the primer comprise a ribonucleic acid modified base site and a 3' -end Spacer C3 modification, the primer sequence is required to be highly specific and highly conserved, the phenomenon of complementary pairing dimer connection between the primers cannot occur, and the dimer content of the primer library is less than 10%.

TABLE 3 Table 3

Note that: table 3 provides primers that are specific amplified sequences, with the addition of sequence GCTGACAGAACGACATGGCTACGATCCGACTT (universal adaptor) at the 5' end during synthesis; rC/stands for ribonucleotide modified cytosine,/rA/stands for ribonucleotide modified adenine,/rG/stands for ribonucleotide modified guanine,/rT/stands for ribonucleotide modified thymine, and the 3' end is modified with a Spacer C3.

Referring to fig. 2, a second embodiment of the present invention is as follows: a detection method for detecting common pathogenic microorganisms and drug-resistant genes (part of reagents are selected from the first embodiment) comprises the following steps:

s1: clinical samples were randomly selected and sample information is shown in table 4.

TABLE 4 Table 4

Sample numbering	Sample type
		Sample
1	Alveolar lavage fluid
		Sample
2	Cerebrospinal fluid
		Sample
3	Blood
		Sample
4	Alveolar lavage fluid
		Sample
5	Blood
		Sample 6	Sputum (sputum)
Sample 7	Alveolar lavage fluid
		Sample
8	Alveolar lavageLiquid and its preparation method
		Sample
9	Sputum (sputum)

The samples were subjected to DNA/RNA nucleic acid co-extraction and quantification using commercial DNA and RNA co-extraction kits. The concentration of the extracted nucleic acid is measured by using a Qubit fluorescence quantitative instrument or an equivalent functional instrument, and the concentration of DNA is more than or equal to 0.1 ng/. Mu.L, otherwise, the extracted nucleic acid is regarded as unqualified.

S2: and (5) uniformly mixing the extracted total nucleic acid by vibration, and then performing reverse transcription. And calculating the preparation of the total volume of the reaction liquid according to the number of samples to be detected (one each for constructing a negative and positive quality control product is needed in each database construction) according to a formula N=the sample quantity to be detected+2. The formulation of the reverse transcription system is shown in Table 5, and the reverse transcription reaction procedure is shown in Table 6.

TABLE 5

Reaction system	Single dose (mu L)
		2X reverse transcription buffer	5
Reverse transcriptase	0.5
		Rnase inhibitors	0.5
Random primer hexamer	1
		Nucleic acid templates	3

TABLE 6

Temperature (temperature)	Time
		25℃	5min
55℃	45min
		85℃	2min
4℃	∞

S3: the reaction system configuration is carried out according to Table 7, reverse transcription products are added, fully and uniformly mixed, and multiplex targeting PCR amplification is carried out on a PCR instrument, so that the first round of PCR amplification is completed, and amplification products are obtained. The amplification reaction procedure is shown in Table 8.

TABLE 7

Reagent name	Dosage (uL)
		Multiplex PCR amplification premix	25
RNaseH2	1
		Primer library in example one	10
Internal reference	1
		Reverse transcription product	10
H ₂ O	3

TABLE 8

S3: sorting the amplified product to obtain a fragment purified product;

the fragment sorting steps are as follows:

the DNA purified Beckmann Ampure XP magnetic beads are equilibrated for 30min at room temperature in advance and are vortexed and mixed evenly before use.

b. 35. Mu.L (0.7X) of the resuspended magnetic beads were added to the reaction system obtained in the previous step.

c. Vortex mixing, instantaneous separation, and incubating for 5min at room temperature.

d. The tube was transferred to a magnet rack at room temperature. After the solution was clarified, the supernatant was pipetted into 15 μl (0.3X) of resuspended magnetic beads.

e. Vortex mixing, instantaneous separation, and incubating for 5min at room temperature.

f. The tube was transferred to a magnet rack at room temperature. After the solution was clear, the supernatant was discarded.

g. The tube was charged with 200 μl of freshly prepared 80% ethanol on a magnet rack.

h. The tube was rotated for two weeks and the supernatant discarded.

i. Repeating the steps g and h for one time. Residual ethanol was removed by suction with a small gun head.

h. And (5) airing at normal temperature until the surface of the magnetic bead is matte.

i. 20. Mu.L of de-ribotide water was added.

j. Vortex mixing, instantaneous separation, and incubating for 5min at room temperature.

k. Transferring the tube to a magnetic frame, clarifying the solution, and collecting the supernatant for later use.

S4: the reaction system configuration was performed according to Table 9, and the supernatant collected after the fragment sorting was added, and mixed well, and then the adaptor-added amplification was performed on the PCR apparatus, thereby completing the second round of PCR amplification. The procedure of the amplification reaction is shown in Table 10.

TABLE 9

Reagent(s)	Single dose (mu L)
		PCR amplification premix	25
Universal adaptor primers	1
		Tag linker primers	1
The product was purified in the last step	10
		NF H ₂ O	12

Table 10

S5: purifying the S4 product to obtain a library; the purification steps are as follows:

the DNA purification magnetic beads are equilibrated for 30min at room temperature in advance, and are uniformly mixed by vortex before use.

b. 50 μl (1X) of resuspended Beckmann Ampure XP magnetic beads were added to the reaction system obtained in the previous step.

d. The tube was transferred to a magnet rack at room temperature. After the solution was clear, the supernatant was discarded.

e. The tube was charged with 300 μl of freshly prepared 80% ethanol on a magnet rack.

f. The tube was rotated for two weeks and the supernatant discarded.

g. Repeating e.to f. Residual ethanol was removed by suction with a small gun head.

h. And drying at normal temperature until the surface of the magnetic bead is matt.

i. 30. Mu.L of de-ribotide water was added.

k. The tube was transferred to a magnetic rack and the supernatant was collected, i.e. the library was captured, after the solution was clarified.

S6: the library fragments were quality controlled using Aglient 2100 and the quality control results are shown in FIG. 3.

S7: the tNGS library was constructed using the nucleic acid extracted in S1 using a commercial DNA library construction kit (Novain DNA library construction kit, cat# NDM 503) according to the instructions.

S8: high throughput sequencing, sequencing steps were as follows:

a. the pooling and DNB preparation was performed according to the instructions of the MGISEQ-200 sequencing kit and high throughput sequencing was run. the tNGS library was loaded at 1M/sample and the mNGS library was loaded at 20M/sample.

b. Sequencing data of the tNGS library and the mNGS library are analyzed by using a bioinformatics analysis flow, and a pathogenic microorganism detection result is obtained. Samples with tNGS library below 20k were judged as failed, the library was re-loaded, and samples with mNGS library below 20M were judged as failed.

Embodiment III: the clinical samples were tested and evaluated using conventional mNGS detection with the tNGS pathogenic microorganisms of the present invention.

Clinical samples of alveolar lavage fluid 4 examples and alveolar lavage fluid 4 examples were randomly selected. Cerebrospinal fluid 2 cases and whole blood 2 cases. The test of the first and second examples was used to construct a tNGS library, and the mNGS method was performed using a commercially available mNGS library-constructing kit (Nuo-uzan, cat# TDM 503), followed by high-throughput sequencing of 30M samples, and a data amount of less than 20M was considered to be unacceptable, and the library was re-established. The test results are shown in Table 11.

TABLE 11

As can be seen from Table 11, the present invention has excellent enrichment effect on detection of various types of samples, and the detection sensitivity is higher than mNGS.

The fourth embodiment of the invention is as follows:

the fourth embodiment differs from the second embodiment in that the method for extracting nucleic acid is different, and the specific steps are as follows:

a. a2 mL polishing tube containing polishing beads was used, and 500. Mu.L of the pretreated specimen, 15. Mu.L of

pretreatment enzyme

1 and 12. Mu.L of pretreatment enzyme 2 were sequentially added. Shaking and mixing for 2min. Mixing, placing on a breaker, vibrating at maximum rotation speed for 10min (tissue sample can be increased for 5-10min according to breaking effect), and centrifuging instantaneously.

b. Taking a 1.5mL centrifuge tube, sequentially adding 300 mu L of treatment fluid, 150 mu L of tissue digestion fluid GHA, 150 mu L of lysate GHH-A and 30 mu LBuffer ST which are sucked out from a grinding tube, shaking and mixing uniformly, then adding 20 mu L of proteinase K, vortex and mixing uniformly, carrying out instantaneous centrifugation, standing at room temperature for 10min, and carrying out instantaneous centrifugation.

c. Sequentially adding 350 mu L of isopropanol and 15 mu L of magnetic bead GHE into the centrifuge tube in the previous step, vortex mixing uniformly, and then placing the mixture on a reverse mixing instrument for mixing uniformly for 10min; if the magnetic beads are large and cannot be mixed uniformly, 10 mu L of magnetic beads can be added for continuous mixing.

d. And (5) carrying out instantaneous centrifugation, placing the mixture on a magnetic rack until the solution is clear, and discarding the supernatant.

e. 750 μl Buffer GDF (ensuring that absolute ethanol has been added) was added, and shaking was performed thoroughly to keep the beads in a homogenized state for 2min.

f. And (5) carrying out instantaneous centrifugation, placing the mixture on a magnetic rack until the solution is clear, and discarding the supernatant.

g. 750 μl Buffer GDF (ensuring that absolute ethanol has been added) was added, and shaking was performed thoroughly to keep the beads in a homogenized state for 2min.

h. And (5) carrying out instantaneous centrifugation, placing the mixture on a magnetic rack until the solution is clear, and discarding the supernatant.

i. 750 μl Buffer PWG (ensuring that absolute ethanol has been added) was added, and shaking was performed thoroughly to keep the beads in a homogenized state for 2min.

j. And (5) carrying out instantaneous centrifugation, placing the mixture on a magnetic rack until the solution is clear, and discarding the supernatant.

k. 750 μl Buffer PWG (ensuring that absolute ethanol has been added) was added, and shaking was performed thoroughly to keep the beads in a homogenized state for 2min.

And I, instantaneous centrifugation, placing the mixture in a magnetic rack until the solution is clear, and discarding the supernatant.

m. instantaneous centrifugation, placing on a magnetic rack, sucking residual liquid by using a 10 mu L liquid transfer device, uncovering and drying the magnetic beads at 50 ℃ until the surfaces of the magnetic beads have no water mark luster.

And n, adding 50 mu L of RNase-Free ddH2O, mixing by vortex at the temperature of 56 ℃ for 1000rpm for 5min, observing whether the magnetic beads are in a uniform mixing state every minute, and if the magnetic beads are at the bottom, flicking the bottom of the tube, and immediately returning after rapid uniform mixing.

In summary, the invention develops a method for co-extracting DNA and RNA aiming at the characteristics of pathogenic microorganisms such as bacteria, fungi, DNA viruses, RNA viruses and the like and different types of pathogens (bacteria, fungi, DNA viruses, RNA viruses and the like) in different source sample types (alveolar lavage fluid, sputum, blood, cerebrospinal fluid and the like), and can simultaneously enrich DNA and RNA in a sample by one-time nucleic acid extraction; the pathogen detection at the DNA and RNA layers can be covered at one time, and the suspected pathogen in the sample can be detected to the greatest extent with the least sample and the lowest cost.

In the invention, the 3' end of the primer is modified by RNA base and the 3' end is modified by Spacer C3, and the RNA base can be sheared off under the action of RNase H2 only when the primer modified by the RNA base is completely matched with the template, so that the 3' end of the primer is released from Spacer C3 closure for extension and amplification. When the primer is not completely matched with the template, the dimer formed between the primers cannot be amplified by normal PCR, so that the signal amplification of the primer dimer and the influence on target PCR amplification are improved and reduced.

The detection method of the invention improves the uniformity of amplification efficiency among primers by optimizing the input amount and the input proportion of the primers, and optimizes the library construction system. The PCR amplification efficiency is improved by optimizing a PCR amplification system, PCR reaction conditions, PCR cycle number and the like.

The foregoing description is only illustrative of the present invention and is not intended to limit the scope of the invention, and all equivalent changes made by the specification and drawings of the present invention, or direct or indirect application in the relevant art, are included in the scope of the present invention.

Claims

1. The kit for detecting common pathogenic microorganisms and drug-resistant genes is characterized by comprising a reverse transcription system, a first round of amplification system, a second round of amplification system, a positive quality control product and a negative quality control product, wherein the first round of amplification system comprises a primer library, the Tm value of primers in the primer library is kept at 60+/-5 ℃, the length of amplicons is 100-200 bp, the length of the primers is 15-25, the GC content is 40-65%, and the 3 '-end of the primers is subjected to RNA base modification and 3' -end Spacer C3 modification.

2. The kit for detecting common pathogenic microorganisms and drug resistance genes according to claim 1, wherein the dimer content of the primer library is less than 10%.

3. The kit for detecting a common pathogenic microorganism and a drug-resistance gene according to claim 1, wherein the reverse transcription system comprises a reverse transcription buffer, a reverse transcriptase, a random primer hexamer, and a nucleic acid template.

4. The kit for detecting a common pathogenic microorganism and a drug-resistant gene according to claim 3, wherein the volume ratio of the reverse transcription buffer, reverse transcriptase, random primer hexamer and nucleic acid template is 5:0.5:0.5:1:3.

5. The kit for detecting a common pathogenic microorganism and a drug resistance gene according to claim 1, wherein the first round of amplification system further comprises multiplex PCR amplification premix, RNaseH2, internal reference, and H ₂ O。

6. The kit for detecting a common pathogenic microorganism and a drug resistance gene according to claim 5, wherein the multiplex PCR amplification premix comprises a DNA polymerase, mgCl ₂ KCl, dNTPs, DMSO and BSA.

7. The kit for detecting a common pathogenic microorganism and a drug resistance gene according to claim 1, wherein the second round of amplification system comprises a universal adapter primer, a tag adapter primer and a PCR amplification premix.

8. The detection method for detecting common pathogenic microorganisms and drug-resistant genes is characterized by comprising the following steps:

s2: reverse transcription;

s2: sequentially performing multiplex-targeting PCR amplification, fragment sorting, adaptor amplification and repurification to obtain a library by using the kit according to any one of claims 1 to 7;

9. The method for detecting common pathogenic microorganisms and drug-resistant genes according to claim 8, wherein the concentration of the DNA after S1 extraction is not less than 0.1 ng/. Mu.L.

10. The method for detecting common pathogenic microorganisms and drug-resistant genes according to claim 8, wherein the fragment sorting comprises the specific steps of: and adding magnetic beads into the amplified product for incubation, and then taking the supernatant, adding the magnetic beads again for purification to obtain a fragment purification product.