CN116355867A - Loquat EjFAD2 gene, protein coded by same and application thereof - Google Patents

Abstract

The invention belongs to the field of plant molecular biology, and particularly relates to a loquat membrane lipid desaturase gene EjFAD2 and application thereof. The full length of the coding region sequence of the cDNA of the EjFAD2 gene is shown as SEQ ID No.1, and the amino acid sequence of the coded protein is shown as SEQ ID No. 2. The gene is induced to express at low temperature and is closely related to the cold resistance of loquat. The EjFAD2 gene over-expression vector is transferred into wild type Arabidopsis through an agrobacterium-mediated inflorescence dip-dyeing method. The result shows that the over-expression of EjFAD2 gene in wild type Arabidopsis thaliana can enhance the cold resistance of Arabidopsis thaliana. The gene can be used for directional breeding of cold-resistant varieties of loquat and has good application prospect.

Description

Loquat EjFAD2 gene, protein coded by same and application thereof

Technical Field

The invention belongs to the field of plant molecular biology, and particularly relates to a loquat EjFAD2 protein, and a coding gene and application thereof.

Background

Loquat (Eriobotrya japonica) is a subtropical evergreen tree of Eriobotrya genus of Rosaceae family; the fruit has the health care functions of moistening lung, relieving cough and reducing sputum, and the fruit is just in the season when ripe, so that the fruit has good economic value and market potential. The loquat is in the coldest season in one year when the loquat is fruit-bearing, and frost often causes huge economic loss of the loquat industry, so that research on the cold-resistant mechanism of the loquat to select and breed cold-resistant varieties has important value for promoting the development of the industry.

Low temperatures not only limit the geographical distribution of plants, but often result in huge economic losses in agriculture. Plants have increased cold tolerance by increasing the content of unsaturated fatty acids in the process of adapting to low temperatures to increase the fluidity of the film, which is accomplished mainly by members of the fatty acid desaturase gene (FAD) gene family. Most FAD gene expression is regulated and controlled at low temperature, more FAD2 genes are researched to belong to omega-6, and 2 nd double bond is introduced into omega-6 of mono-olefin fatty acid which is catalyzed and combined with glycerin to form diene fatty acid, which is mainly induced and expressed at low temperature; for example, FAD2 gene expression in cotton cotyledon, avocado fruit and purslane leaf is obviously up-regulated under low temperature stress. The long-term low temperature of the Arabidopsis FAD2 mutant leads to death. The cold resistance of the hybrid poplar over-expressing PtFAD2 gene and the potato plant over-expressing FAD2 gene is obviously enhanced. However, functional studies and applications of the Eriobotrya japonica EjFAD2 gene are not reported.

Disclosure of Invention

The invention aims to provide loquat EjFAD2 protein, and a coding gene and application thereof.

First, the present invention provides loquat EjFAD2 protein, which is:

1) A protein consisting of the amino acids shown in SEQ ID No. 2; or (b)

2) A protein derived from 1) which has equivalent activity and is obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID No. 2.

The invention also provides a gene for encoding the loquat EjFAD2 protein.

Wherein the gene sequence is shown as SEQ ID No. 1.

The invention also provides a vector, a host cell and engineering bacteria containing the gene. Preferably, the vector is an over-expression vector.

The invention also provides application of the gene in plant cold-resistant breeding.

In one embodiment of the invention, the EjFAD2 gene is transferred into the genome of a plant and overexpressed in the transgenic plant, enhancing the cold tolerance of the plant.

The invention also provides a construction method of the transgenic plant, which adopts an agrobacterium-mediated method to transfer the over-expression vector containing the EjFAD2 gene into a plant genome, and screens to obtain the transgenic plant.

Wherein, compared with the wild type, the transgenic plant has obviously enhanced cold resistance.

According to the invention, 1 loquat cold-resistant closely related EjFAD2 gene is cloned from loquat leaves. The real-time fluorescence quantitative PCR proves that the low-temperature induced EjFAD2 gene is expressed in a large quantity, and the expression quantity of the low-temperature induced EjFAD2 gene is higher than that of the low-temperature induced EjFAD2 gene in the loquat material with strong cold resistance. The over-expression vector of the EjFAD2 gene is constructed by utilizing a genetic engineering means, and is transferred into wild arabidopsis for over-expression, so that the cold resistance of the arabidopsis can be obviously enhanced. The invention provides a good application prospect for cold-resistant breeding of angiosperm.

Drawings

FIG. 1 is an electrophoresis photograph of the identification of the coding region sequence of the Eriobotrya japonica EjFAD2 gene. M is DL2000 DNA marker,1 is PCR product of ORF of EjFAD2 gene.

FIG. 2 is a cDNA nucleotide sequence diagram of the coding region of the Eriobotrya japonica EjFAD2 gene.

FIG. 3 is a diagram showing the amino acid sequence and domain division of the Eriobotrya japonica EjFAD2 protein.

FIG. 4 shows that the Eriobotrya japonica EjFAD2 gene is expressed in Eriobotrya japonica leaves under low temperature induction.

FIG. 5 is a PCR identification of EjFAD2 transgenic Arabidopsis plants.

FIG. 6 is a plant morphological phenotype of overexpression of EjFAD2 in Arabidopsis. The low-temperature treated wild arabidopsis thaliana wilts more severely than the transgenic plants, most leaf edges begin to be in a dipping curled state, old leaf edges begin to turn yellow, and the transgenic plants only have a small amount of tender leaf edges frosted, and part of the old leaf edges also begin to turn yellow.

Fig. 7 is electrolyte leakage and MDA content of leaf blades of arabidopsis overexpressing EjFAD2.

Detailed Description

The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Unless otherwise indicated, the examples are in accordance with conventional experimental conditions, such as the molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell DW, molecular cloning: a laboratory manual, 2001), or in accordance with the manufacturer's instructions.

EXAMPLE 1 cloning of the cDNA sequence of the Eriobotrya japonica EjFAD2 Gene

Extracting total RNA of loquat leaves, and reversely transcribing the total RNA into cDNA. The complete cDNA sequence of EjFAD2 was found by sequence alignment of transcriptome data and loquat genome, and clone primer of Oligo7 designed gene, FLEjFAD2-F:5'-ATGGGTGCCGGTGGAAATAT-3'; FLEjFAD2-R:5'-CACAGCTTTTTCTTGTACCAGAAG-3'. The gene was amplified using the Phanta Max Super-Fidelity DNA Polymerase (P505-d 1/d2/d 3) kit, the EjFAD2 gene was amplified in a system of 2X Phanta Max Buffer at 25. Mu.L, dNTP Mix (10 mM) at 1.0. Mu.L, F (10. Mu.M) at 2.0. Mu.L, R (10. Mu.M) at 2.0. Mu.L, phanta Max Super-Fidelity DNA Polymerase 1.0. Mu.L, cDNA 1.0. Mu.L, add ddH ₂ The amplification procedure was 95℃for 4min, followed by 35 cycles of 95℃for 30sec,56℃for 30sec, and 72℃for 40sec, with a total volume of 50. Mu.L O, and 10min after the end of the cycle. After the PCR amplification is completed, electrophoresis detection (figure 1) is carried out, the agarose DNA gel recovery kit is used for recovery, the concentration and the quality are measured, and the sample is stored at the temperature of minus 20 ℃.

The recovered target fragment is connected with a Vector pTOPO-Blunt Vector and then transferred into competent cells of escherichia coli, monoclonal is selected, sequencing is carried out, sequencing results are analyzed and spliced, and the full length (SEQ ID No. 1) of the cDNA sequence of the loquat EjFAD2 gene is obtained, and the sequence picture is shown in figure 2.

The full length of the cDNA sequence of the Eriobotrya japonica EjFAD2 gene was translated (SEQ ID No. 2) using BioEdit software, and the transmembrane domain and Histidine cluster conserved domain were divided according to the characteristics of the protein, which showed that the EjFAD2 protein sequence had 3 conserved Histidine clusters (histidines box: HECGH, HRRHH, HVAHH) and was also a typical membrane-bound protein, with a total of 6 transmembrane regions (FIG. 3).

EXAMPLE 2 analysis of expression level of EjFAD2 Gene of Eriobotrya japonica

Tetraploid loquat (2n=4x=68) B431 and triploid loquat B431×GZ23 (2n=3x=51) with different cold resistance are selected, and cold resistance is identified as B431×GZ23 (LT ₅₀ ＝-9.419)>B431(LT ₅₀ = -7.195), the uniformly grafted seedlings are stressed for 72 hours at the temperature of minus 3 ℃,4 biological repeats are treated each time, leaves at the same leaf position are taken, RNA is extracted, and cDNA is reversely transcribed as a template.

According to the full length of cDNA sequence of loquat EjFAD2 gene, designing real-time fluorescence quantitative primer by utilizing oligo 7.0 software, qEjFAD2-F:5'-GGATGCTGACACCCACAAGA-3' and qEjFAD2-R:5'-GGCTTTCTTGACCTCACCGA-3'. The specificity of the PCR is detected by PCR, and the real-time fluorescent quantitative PCR can be performed on the premise of ensuring the specific amplification of the PCR. The loquat actin gene is taken as an internal reference gene, and the primer is qEjacin-F: 5'-AATGGAACTGGAATGGTCAAGGC-3' and qEjacin-R: 5'-TGCCAGATCTTCTCCATGTCATCCCA-3'. Amplification was performed using a three-step procedure, with 3 biological replicates per reaction. The PCR reaction procedure was: pre-denaturation at 95℃for 1min;95℃20s,58℃20s,72℃30s,45 cycles; the dissolution profile was collected. According to the Ct value obtained, the expression level of EjFAD2 gene in triploid and tetraploid loquat under low temperature stress is calculated by using a 2-delta CT method, and the result shows that the expression level of EjFAD2 gene in triploid loquat B431X GZ23 with strongest cold resistance under low temperature induction is higher than that in tetraploid B431 (figure 4).

EXAMPLE 3 construction of plant transgenic vector pFGC5941-EjFAD2 of Eriobotrya japonica EjFAD2 Gene

PCR amplification is adopted, and enzyme cutting sites are introduced at two ends of CDS region of loquat EjFAD2 gene. The cDNA of the total RNA reverse transcription of the loquat leaf is used as a template, and EjFAD2-F is used as a template: 5' -GGCGCGCCATGGGTGCCGGTGGAAATAT-3' (introduction of AscI cleavage site) and EjFAD2-R:5' -CGGGATCCTCACAGCTTTTTCTTGTACCAGA AG-3' (BamHI cleavage site was introduced) as primers and PCR amplification was performed using Phanta Max Super-Fidelity DNA Polymerase. PCR reaction procedure: 95 ℃ for 4min; 35 cycles were performed at 95℃for 30s,56℃for 30s, and 72℃for 40 s; and at 72℃for 10min. After the reaction, the PCR product was subjected to 1% agarose gel electrophoresis and recovered using an agarose gel DNA recovery kit. The recovered PCR product is connected with pTOPO-Blunt vector, transferred into competent cells of escherichia coli, and subjected to sample transfer and sequencing after monoclonal selection. According to the vector sequence, primers are designed at the junction of the vector and the target fragment for sequencing, plasmids are extracted, and plasmids of a transgenic vector pFGC5941 are extracted at the same time. Double-enzyme digestion of pTOPO-Blunt-EjFAD2 recombinant plasmid and pFGC5941 vector are respectively carried out by using AscI and BamHI restriction enzymes, and after the double-enzyme digestion of EjFAD2 gene and pFGC5941 are connected by using T4 DNA ligase, the mixture is transferred into competent cells of escherichia coli to obtain plant transgenic expression vectors pFGC5941-EjFAD2. And (3) carrying out sample feeding and sequencing on the obtained expression vector, designing a primer at the joint of the vector and the target fragment according to the vector sequence, sequencing by bidirectional sequencing, and carrying out sequencing result to obtain the sequence of the vector sequence and the sequence of the FAD2 gene, so as to prove that the EjFAD2 gene is successfully connected with the pFGC5941 vector.

EXAMPLE 4 transfer of the transgenic expression vector pFGC5941-EjFAD2 into wild type Arabidopsis thaliana

Taking 2 mu g of pFGC5941-EjFAD2 plasmid, adding 100 mu L of agrobacteria competent cells, sucking and beating, and mixing uniformly; ice-bath for 30min, transferring into liquid nitrogen, rapidly freezing for 1min, water-bathing at 37deg.C for 5min, ice-bathing for 10min, adding 800 μl of LB liquid medium, and shaking at 28deg.C at 250rpm for 5h; transferring the bacterial liquid into LB (50 mL LB+50. Mu.g/mL Kan+50. Mu.g/mL Rif) solid selective medium, uniformly coating, and inversely culturing at 28 ℃ for 48 hours; selecting a monoclonal, and inoculating the monoclonal into 10mL of liquid LB culture medium (containing 10 mug/mL Kan+10 mug/mL Rif); the culture was shaken overnight at 28℃and 200rpm to OD=0.8. 2mL of the bacterial liquid was taken to 100mL of LB liquid medium (50. Mu.g/mL Kan and 50. Mu.g/mL Rif) and cultured until OD600 = 0.7-0.8, the bacterial liquid was transferred to 250 mL centrifuge tubes (sterilized), centrifuged at room temperature and 5000rpm for 5min, the supernatant was removed, 2mL of infection buffer (0.5% Silwet L-77,5% sucrose, 1/2MS medium) was added to each tube, and the bacterial cells were gently suspended, and 48mL of infection buffer (100 mL of infection buffer: 5g sucrose, 50. Mu.L Silwet L-77,1/2MS medium) was further added.

Placing Arabidopsis seeds on wet filter paper, placing at 4deg.C for 48 hr, sowing into nutrient soil, and culturing under the conditions of temperature 22 deg.C, humidity 75%, and darkness for 14 hr/10 hr; watering the arabidopsis plants thoroughly the day before the transgenic; shearing off the horns on the Arabidopsis plants before dip-dyeing, and immersing inflorescences in pFGC5941-EjFAD2 Agrobacterium dip-dyeing liquid for about 60s for dip-dyeing conversion; covering a black sealing film, keeping the high-temperature and high-humidity environment in the film, and after dark culture for 2 days, uncovering the film and putting the film back into the normal environment for continuous growth. The method is used for infecting 3-4 times with the interval time of 7d.

EXAMPLE 5 transgenic Arabidopsis screening and phenotypic characterization of the Eriobotrya japonica EjFAD2 Gene

EjFAD2 transgenic Arabidopsis mature seeds were harvested. Placing the seeds in a 37 ℃ oven for about 7 days, and placing the seeds in a 4 ℃ refrigerator for vernalization. Sowing seeds on peatmoss, spraying 20mg/L glufosinate (carrier pFGC5941 resistant to glufosinate) once every three days when the seedlings grow for about ten days, spraying 3-4 times in total, and managing the surviving seedlings according to the conventional water and fertilizer until the seedlings bloom and seed.

EjFAD2 transgenic Arabidopsis DNA is extracted, wild Arabidopsis DNA is used as a control, and PCR identification is carried out on survival seedlings according to 35S promoter design identification primers (35S-F: TGAGACTTTTCAACAAAGGATAATT,35S-R: TGTCCTC TCCAAATGAAATGAAC) on a pFGC5941 vector, and meanwhile, PCR identification is carried out by using clone primers of a target gene, so that positive seedlings are screened. PCR amplification procedure: 95 ℃ for 4min; 25 cycles were performed at 95℃for 30s,56℃for 30s, and 72℃for 40 s; and at 72℃for 10min. After the reaction was completed, 1% agarose gel electrophoresis was performed, and detection was performed in a gel imaging system (fig. 5), and the result showed that 10 arabidopsis plants were obtained in total, 9 of which were positive plants.

Planting wild Arabidopsis thaliana (Wt) and T3 generation homozygous transgenic plants in turfy soil, culturing, wherein each 3 plants is a basin, each basin is a biological repetition, 3 biological repetitions are added, the culturing temperature is about 23+ -0.5 ℃, the humidity is about 60%, and the light quantum flux density (PPFD) of illumination is 50+ -5 mu mol.m ^-2 ·s ^-1 Photoperiod was 14/10 (day/light) and incubated for 6 weeks until rosette leaves were formed. Wild type plants and transgenic plants growing for about 6 weeks are placed in a low-temperature treatment box, the temperature reduction speed is 1 ℃/h until the temperature reaches 0 ℃, the plants are cultivated for 96 hours under weak light, the phenotype of the plants is observed after the treatment is finished, and the relative conductivities of leaves for 0 hours and 96 hours and the MDA content are measured. The result shows that the wilting state of the wild arabidopsis thaliana treated at low temperature is more serious than that of the transgenic plant, most leaf edges begin to be in a dipping and curling state, most old leaf edges are yellow, and the transgenic plant has little tender leaf edges frostbitten, and part of the old leaf edges are yellow; after 6d of growth recovery at 23 ℃, both wild type and transgenic plants survived, but most of the leaf edges of the wild type plants turned yellow, a small portion of the plants pulled out the reproductive branches, and part of the leaf edges of the transgenic plants turned yellow, and the plants pulled out the reproductive branches, so that the growth recovery was faster (fig. 6). Under low temperature stress, electrolyte permeation is an important indicator for assessing the extent of damage to cytoplasmic membranes, and MDA reflects the extent of peroxidation of the membrane. The test result shows that the heterologous over-expression of EjFAD2 obviously reduces the electrolyte leakage and MDA content of arabidopsis leaves (figure 7), and the heterologous over-expression of EjFAD2 in arabidopsis can enhance the cold resistance of arabidopsis.

While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Claims (10)

1. Loquat EjFAD2 protein, which is:

1) A protein consisting of the amino acids shown in SEQ ID No. 2; or (b)

2) A protein derived from 1) which has equivalent activity and is obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID No. 2.

2. A gene encoding the loquats EjFAD2 protein of claim 1.

3. The gene of claim 2, wherein the sequence is set forth in SEQ ID No. 1.

4. A vector comprising the gene of claim 2 or 3.

5. A host cell comprising the vector of claim 4.

6. An engineered bacterium comprising the gene of claim 2 or 3.

7. Use of the gene according to claim 2 or 3 in cold tolerant breeding of plants.

8. The use according to claim 7, wherein the gene according to claim 2 or 3 is transferred into the genome of a plant and overexpressed in the transgenic plant, enhancing the cold tolerance of the plant.

9. A method for constructing a transgenic plant, which is characterized in that an agrobacterium-mediated method is adopted to transfer an over-expression vector containing the gene as set forth in claim 2 or 3 into a plant genome, and the transgenic plant is obtained by screening.

10. The method of claim 9, wherein the transgenic plant has significantly increased cold tolerance compared to wild type.

Images