CN116334137A

CN116334137A - Snake venom element signal peptide for improving secretion expression quantity of recombinant antibody, product and application thereof

Info

Publication number: CN116334137A
Application number: CN202310388213.5A
Authority: CN
Inventors: 李科; 闫亚平; 郝文斌; 党嘉萌; 范雪; 黄秀丽
Original assignee: Shaanxi Mybiotech Co ltd
Current assignee: Shaanxi Mybiotech Co ltd
Priority date: 2023-04-12
Filing date: 2023-04-12
Publication date: 2023-06-27

Abstract

The invention discloses a snake venom signal peptide for improving secretion expression quantity of a recombinant antibody, a product and application thereof, belonging to the technical field of genetic engineering antibodies, wherein the signal peptide comprises the snake venom signal peptide and a novel signal peptide obtained by mutating the same, and the original signal peptide carried by the recombinant antibody is replaced by the signal peptide of the invention through PCR; compared with the signal peptide of the antibody and other signal peptides commonly used for antibody secretion expression, the signal peptide has the advantages that the antibody expression level is obviously improved, the production cost of the target antibody is reduced, and the signal peptide has a great application prospect in the biomedical field with great antibody demand.

Description

Snake venom element signal peptide for improving secretion expression quantity of recombinant antibody, product and application thereof

Technical Field

The invention belongs to the technical field of genetically engineered antibodies, and particularly relates to a snake venom signal peptide for improving secretion expression quantity of a recombinant antibody, a product and application thereof.

Background

The recombinant antibody, also called as genetic engineering antibody, is obtained by transforming and recombining the corresponding gene sequence of the antibody according to the need by using a DNA recombination technology, constructing the recombinant antibody on a plasmid, and then transfecting/transforming the constructed plasmid into a proper host cell for expression by using a protein exogenous expression technology. The recombinant antibody realizes antibody humanization, well solves the human rejection reaction caused by animal-derived antibodies, has been widely applied to biomedical research, diagnosis and treatment of diseases at present, and has large demand. Recombinant antibodies are successfully expressed in a variety of systems, of which mammalian cells are the most well established and most widely used expression systems. The mammalian cell expression system can be used for the expression of various recombinant antibodies, so that the current production of the therapeutic monoclonal antibodies basically adopts the mammalian cell expression system, but the method has the defects of relatively low expression yield, high production cost and the like. Therefore, optimizing the expression of antibodies to achieve the goal of increasing the expression level of antibodies and reducing the production cost plays a vital role in meeting the increasing demand for antibodies in the future.

In the production of proteins (e.g., antibodies), the level of expression is affected by a number of factors, whether secretion is effective or not being a critical factor, and most secreted proteins initiate secretory expression via the classical endoplasmic reticulum golgi pathway via signal peptides. The signal peptide is a special amino acid sequence at the N end of the secretory protein, consists of about 30 amino acids, has a great influence on the transmembrane secretion efficiency of the protein, has the effect of guiding the precursor peptide into the rough endoplasmic reticulum and secreting out of cells through a secretion pathway, and can locate the protein on a cell membrane or reach the outside of the cell through the transmembrane. The signal peptide sequence generally does not have significant amino acid sequence conservation and generally consists of an N domain with a positive charge, an H domain rich in hydrophobic amino acids, and a C domain with a negative charge. Therefore, the signal peptide plays an important role in secretion of the recombinant antibody, in actual production of the antibody, the problems that the antibody protein of the constructed vector is not secreted or the secretion amount is low are frequently encountered, when the gene sequence of the recombinant antibody is provided with a section of self signal peptide sequence for secretion, if the reconstructed expression vector cannot or is low in efficiency to obtain the high-expression secretion target antibody by utilizing the signal peptide sequence of the antibody, the signal peptide of the high-expression protein can be rescreened to replace the original signal peptide or optimize the original signal peptide, and the secretion efficiency of the recombinant antibody is improved to improve the expression amount of the target antibody. When the recombinant antibody does not have an autoantibody signal peptide, the recombinant antibody can be used for enhancing the expression level of the target antibody by adding a proper signal peptide sequence to guide the secretion of the antibody.

At present, it has been reported that the secretory expression amount of the protein can be remarkably improved after the signal peptide is replaced, so that the addition or replacement of the appropriate signal peptide to the gene of the target antibody is a method for effectively improving the secretory yield of the target protein, can improve the secretory efficiency, simplify the downstream purification process, and has positive effects on the stability and activity of the antibody. Therefore, the screening and optimization of the signal peptide have important significance for improving the secretory expression quantity of the antibody and reducing the production cost.

At present, no report has been made on the ability of a snake venom signal peptide to increase the secretory expression of recombinant antibodies or recombinant proteins.

Disclosure of Invention

The invention aims to provide a snake venom signal peptide for improving secretion expression quantity of recombinant antibodies, and a product and application thereof.

In order to achieve the above purpose, the invention is realized by adopting the following technical scheme:

the invention discloses application of a snake venom element signal peptide in improving secretion expression quantity of a recombinant antibody, wherein the snake venom element signal peptide comprises a snake venom signal peptide and a mutation signal peptide thereof, and the snake venom element signal peptide and the mutation signal peptide thereof can guide secretion expression of the recombinant antibody.

Preferably, the snake venom signal peptide is a bungarotoxin signal peptide, the amino acid sequence of which is shown as SEQ ID NO.2, the nucleotide sequence for encoding which is shown as SEQ ID NO.6, and other nucleotide sequences capable of encoding which are included.

Further preferably, the mutant signal peptide based on the bungarotoxin signal peptide is obtained by mutating the 3 rd amino acid and the 13 th amino acid of the bungarotoxin signal peptide, and the amino acid sequence of the mutant signal peptide is shown as SEQ ID NO. 1.

Further, the 3 rd amino acid T and the 13 th amino acid I of the bungarotoxin signal peptide are mutated into amino acid L, and the nucleotide sequence for encoding the bungarotoxin signal peptide is shown as SEQ ID NO.5 and further comprises other nucleotide sequences capable of encoding the bungarotoxin signal peptide.

Preferably, a snake venom signal peptide is used to replace the original signal peptide of the antibody itself, so as to increase the secretory expression amount of the target antibody.

Further preferably, the application may be that when the recombinant antibody is not secreted or secreted poorly, that is, when the native signal peptide of itself cannot be utilized or is utilized inefficiently to obtain a highly expressed secretion target antibody, the secretion expression amount of the target antibody is increased by substituting the signal peptide of the present invention for the original signal peptide of the antibody itself.

Preferably, a snake venom signal peptide is added to a recombinant antibody which does not contain a signal peptide, and is used for guiding secretion of the antibody to increase secretion expression of the target antibody.

Preferably, the recombinant antibodies that do not contain a signal peptide are obtained by degenerate primer preparation.

The invention also discloses a snake venom signal peptide for improving the secretion expression quantity of the recombinant antibody, which is obtained by mutating the bungarotoxin signal peptide, and the amino acid sequence of the snake venom signal peptide is shown as SEQ ID NO. 1.

Preferably, the recombinant antibody is a monoclonal antibody, a bispecific antibody, a single chain antibody, a chimeric antibody, fab, fv, scFv, sdAb, a minibody or a nanobody.

The invention also discloses a recombinant expression vector, which comprises a nucleic acid molecule for encoding the snake venom signal peptide for improving the secretion expression quantity of the recombinant antibody, wherein the nucleic acid molecule is connected to the front end of polynucleotide for encoding the target antibody and then connected to the expression vector during construction;

the expression vectors include pcDNA3.1, pIRES, pTT3, pCEP4 and pATX1.

The invention also provides a method for constructing the recombinant expression vector, which comprises the following steps:

1) Synthesizing a nucleotide sequence of an antibody to be expressed on a carrier, and respectively designing primers according to the signal peptide and the nucleotide sequence of the antibody to be expressed;

2) Taking a recombinant vector inserted with an antibody to be expressed as a template, and carrying out PCR amplification by using a corresponding primer;

3) Demethylating the PCR product with Dpn1 endonuclease to remove the original template plasmid;

4) Carrying out agarose gel electrophoresis on the PCR product to successfully amplify the band; cutting and recycling glue; adding the recovered product into T4 polynucleotide kinase for treatment; and adding T4 ligase to obtain the recombinant expression vector containing the signal peptide-linked antibody to be expressed.

Preferably, the PCR amplification system is 50. Mu.L, comprising: 10ng of template, 2 mu L of primer F, 2 mu L of primer R, fast Pfu DNA Polymerase mu L, 25 mu L of 2 XFast Pfu buffer, 4 mu L of 2.5mM dNTP and the balance of nuclease-free water;

preferably, the PCR amplification procedures are all: pre-denaturation at 98 ℃ for 5min; denaturation at 98℃for 30s, annealing at 58℃for 30s, extension at 72℃for 4min for 30s, denaturation to 25 cycles; extending at 72 ℃ for 5min; preserving at 4 ℃.

The invention also discloses a host cell comprising the recombinant expression vector, wherein the host cell comprises HEK293, CHO, BHK and SP2/0.

The invention also provides a production method of the recombinant antibody, which comprises the following steps: culturing the host cell, transfecting the recombinant expression vector into the cell, and isolating the recombinant antibody from the culture.

The cells may be HEK293 (human embryonic kidney cells), CHO (Chinese hamster ovary cells), BHK (baby hamster kidney cells), SP2/0 (mouse myeloma cells), or the like.

Compared with the prior art, the invention has the following beneficial effects:

the invention discloses a related application of a snake venom signal peptide for improving the secretion expression quantity of a recombinant antibody, and the related signal peptide comprises the snake venom signal peptide and a new signal peptide obtained by mutating the snake venom signal peptide, wherein the original signal peptide carried by the recombinant antibody is replaced by the signal peptide of the invention through PCR, and compared with the original signal peptide of the recombinant antibody, the signal peptide guides the recombinant antibody to be secreted more efficiently; compared with the signal peptide of the antibody and other signal peptides commonly used for antibody secretion expression, the signal peptide has the advantages that the antibody expression level is obviously improved, the production cost of the target antibody is reduced, and the signal peptide has a great application prospect in the biomedical field with great antibody demand.

Drawings

FIG. 1 shows the secretory expression amounts of recombinant antibodies 1A9, TIML-1A9, abgtx-1A9, HSA-1A9 and IL2-1A9 by ELISA;

FIG. 2 is a graph of immunofluorescent staining results of recombinant antibodies 1A9, TIML-1A9, abgtx-1A9 on cell slide overexpressing CHI3L1 and control pcDNA3.1 cell slide;

FIG. 3 is a graph showing secretory expression amounts of recombinant antibodies 1A9, TIML-1A9, abgtx-1A9, HSA-1A9, and IL2-1A9 using WB in the present invention; wherein, (a) is a gapdh internal reference result diagram, and (b) is a target protein result diagram;

FIG. 4 shows the secretory expression amounts of recombinant antibodies 6D9, TIML-6D9, abgtx-6D9, HSA-6D9 and IL2-6D9 by ELISA;

FIG. 5 is a graph of immunofluorescent staining results of recombinant antibodies 6D9, TIML-6D9, abgtx-6D9 on cell slide overexpressing CHI3L1 and control pcDNA3.1 cell slide;

FIG. 6 is a graph showing secretory expression amounts of recombinant antibodies 6D9, TIML-6D9, abgtx-6D9, HSA-6D9 and IL2-6D9 according to WB validation of the present invention; wherein (a) is gapdh reference result (b) is target protein result graph;

FIG. 7 shows the secretory expression amounts of recombinant antibodies 11D7, TIML-11D7, abgtx-11D7, mmp9-11D7, pelb-11D7 and mog-11D7 by ELISA.

Detailed Description

In order that those skilled in the art will better understand the present invention, a technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in which it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the present invention without making any inventive effort, shall fall within the scope of the present invention.

It should be noted that the terms "first," "second," and the like in the description and the claims of the present invention and the above figures are used for distinguishing between similar objects and not necessarily for describing a particular sequential or chronological order. It is to be understood that the data so used may be interchanged where appropriate such that the embodiments of the invention described herein may be implemented in sequences other than those illustrated or otherwise described herein. Furthermore, the terms "comprises," "comprising," and "having," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.

The invention is described in further detail below with reference to the attached drawing figures:

the invention provides signal peptides for recombinant antibody expression, wherein the signal peptides comprise bungarotoxin mutant signal peptides TIML (hereinafter referred to as signal peptides TIML) and bungarotoxin signal peptides abgtx (hereinafter referred to as signal peptides abgtx), the signal peptides TIML and abgtx and other 2 natural signal peptides commonly used for guiding antibody secretion expression are used for respectively replacing signal peptides carried by the antibody, so that recombinant antibodies containing different signal peptides are obtained, and the secretion expression amounts of the antibodies of the different signal peptides are respectively verified through ELISA, WB, CBA.

The 2 natural signal peptides commonly used for guiding the secretory expression of antibodies are the signal peptide of Human Serum Albumin (HSA) and the signal peptide of recombinant human interleukin 2 (IL 2).

The amino acid sequences of the above 4 signal peptides are as follows:

TIML：MKLLLLTLVVVTLVCLDLGYT(SEQ ID NO.1)

abgtx：MKTLLLTLVVVTIVCLDLGYT(SEQ ID NO.2)

HSA：MKWVTFISLLFLFSSAYS(SEQ ID NO.3)

IL2：MYRMQLLSCIALSLALVTNS(SEQ ID NO.4)

the nucleotide sequences encoding the 4 signal peptides are as follows:

TIML：

ATGAAACTTCTGCTGCTGACCTTGGTGGTGGTGACACTCGTGTGCCT GGACTTAGGATATACC(SEQ ID NO.5)

Abgtx：

ATGAAAACTCTGCTGCTGACCTTGGTGGTGGTGACAATCGTGTGCCT GGACTTAGGATATACC(SEQ ID NO.6)

HSA：

ATGAAGTGGGTAACCTTCATTTCCCTACTATTCCTATTCAGCTCGGCTT ATTCC(SEQ ID NO.7)

IL2：

ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTT GTCACGAATTCG(SEQ ID NO.8)

example 1: comparison of secretory expression level of antibody 1A9

1. Construction of recombinant expression vectors

1. The heavy chain sequence of the murine CHI3L1 monoclonal antibody 1A9 prepared in the laboratory is SEQ ID NO.9, the light chain sequence is SEQ ID NO.10, the heavy chain of the antibody 1A9 is synthesized on a pcDNA3.1 vector and is marked as pcDNA3.1-1A9-m2a, and the light chain of the antibody 1A9 is synthesized on the pcDNA3.1 vector and is marked as pcDNA3.1-1A9-mk; the constructed recombinant vectors pcDNA3.1-1A9-m2a and pcDNA3.1-1A9-mk are subjected to plasmid large extraction for later use and are named 1A9-m2a and 1A9-mk respectively.

2. The primers are designed as shown in Table 1, the signal peptide (shown as SEQ ID NO. 15) of the heavy chain of the monoclonal antibody 1A9 is respectively replaced by the 4 signal peptides (TIML, abgtx, HSA, IL 2) in a PCR mode, and the obtained recombinant plasmids are respectively named as TIML-1A9-m2a, abgtx-1A9-m2a, HSA-1A9-m2a and IL2-1A9-m2a; the specific operation steps are as follows:

(1) PCR was performed using the recombinant vector pcDNA3.1-1A9-m2a as a template and 4 pairs of primer sequences in Table 1 as primers, respectively, and a PCR amplification system (50. Mu.l): 10ng of template, 2. Mu.l of upstream primer (0.2. Mu.M), 2. Mu.l of downstream primer (0.2. Mu.M), fastPfu DNA Polymerase (2.5 units), 1. Mu.l of 2 XFastpfu buffer, 25. Mu.l of 2.5mM dNTP, 4. Mu.l and the balance of Nuclease-free Water; PCR amplification procedure: pre-denaturation at 98 ℃ for 5min; denaturation at 98℃for 30s, annealing at 58℃for 30s, extension at 72℃for 4min for 30s, denaturation to 25 cycles of extension, extension at 72℃for 5min and storage at 4 ℃.

(2) The PCR product was demethylated with DpnI endonuclease, treated at 37℃for 1h and the master plasmid was removed.

(3) Carrying out agarose gel electrophoresis on the PCR product to successfully amplify the band; cutting and recycling glue; retrieving about 500-1000. Mu.g of the product, adding 1. Mu.l of T4 polynucleotide kinase (500 units), 2. Mu.l of T4 nucleotide buffer and 20. Mu.l of nucleic-free Water, and treating at 37℃for at least 2 hours; and adding T4 ligase, and treating at room temperature for at least 2 hours to obtain 4 recombinant vectors, namely pcDNA3.1-TIML-1A9-m2a, pcDNA3.1-abgtx-1A9-m2a, pcDNA3.1-HSA-1A9-m2a and pcDNA3.1-IL2-1A9-m2a.

(4) Carrying out plasmid large extraction on the 4 recombinant vectors in the step (3) for later use.

TABLE 1

2. Primers were designed as shown in Table 2, and the signal peptide of the light chain of antibody 1A9 (shown as SEQ ID NO. 16) was replaced with the above 4 signal peptides (TIML, abgtx, HSA, IL 2), and the obtained recombinant plasmids were named TIML-1A9-mk, abgtx-1A9-mk, HSA-1A9-mk, and IL2-1A9-mk, respectively. The specific operation steps are as follows: PCR was performed using the recombinant vector pcDNA3.1-1A9-mk as a template and the 4 pairs of primer sequences in Table 2 as primers, respectively, and the system and procedure used and the procedure were the same as in step 1 of this example except that the template and primer sequences used were different.

TABLE 2

2. ELISA for verifying secretion expression level of recombinant antibody

According to the transfection method of PEI (transfection reagent is purchased from thermo company and is used for transfection according to the specification), two groups of 1A9 plasmids of the same signal peptide are respectively transfected into HEK293 cells together, and the specific operation steps are as follows:

(1) Transfection was performed by referring to the instructions of PEI, 1.5. Mu.g of each of plasmids 1A9-m2a and 1A9-mk was CO-transferred to HEK293 cells grown on cell slide plates in 6-well plates, and cultured in a 5% CO2 cell incubator at 37℃for 48 hours, after which the culture broth was collected, centrifuged (4500 r,5 min) and the pellet was discarded, the supernatant was collected and designated 1A9, and the supernatant collected from HEK293 cells transfected with 3. Mu.g of pcDNA3.1 plasmid was designated pcDNA3.1 as a blank control.

The heavy and light chain plasmids of the same signal peptide after the replacement of the signal peptide were successively co-transferred by the above method, and the supernatant was collected, wherein TIML-1A9-m2a and TIML-1A9-mk were co-transferred as TIML-1A9, abgtx-1A9-m2a and abgtx-1A9-mk were co-transferred as abgtx-1A9, HSA-1A9-m2a and HSA-1A9-mk were co-transferred as HSA-1A9, IL2-1A9-m2a and IL2-1A9-mk were co-transferred as IL2-1A9.

(2) The collected supernatants 1A9, TIML-1A9, abgtx-1A9, HSA-1A9, IL2-1A9 and pcDNA3.1 were diluted three-fold by 8 dilutions (1:3, 1:9, 1:27, 1:81, 1:243, 1:729, 1:2187, 1:6561, respectively) respectively, and added to the EL coated with CHI3L1 proteinISA plate, 100 μl per well, incubated for 1h at 37deg.C; PBST is washed for 3 times, and each time is patted dry; incubating the HRP-labeled secondary antibody, incubating for 30min at 37 ℃, washing by PBST for 3 times, and beating dry each time; adding TMB, developing for 10min,2M H ₂ SO ₄ The absorbance was measured at 450nm and four replicate wells were made for each dilution.

The secretory expression amounts of the recombinant antibodies 1A9, TIML-1A9, abgtx-1A9, HSA-1A9 and IL2-1A9 were measured by ELISA, and the average value of 4 duplicate wells was taken, and the results are shown in Table 3 and FIG. 1.

TABLE 3 Table 3

As can be seen from Table 3 and FIG. 1, under the same conditions, the secretion expression amounts of the signal peptides TIML, abgtx, HSA and IL2 are improved compared with the original signal peptides of the antibody, wherein the signal peptides TIML and abgtx of the invention are more efficient than other signal peptides HSA and IL2 commonly used for the secretion expression of the antibody.

3. CBA verification of recombinant antibody secretion expression level

1. Preparation of cell climbing tablet: the CHI3L1 gene is synthesized on a pcDNA3.1 vector, the large plasmids and the pcDNA3.1 plasmids are respectively transfected into HEK293 cells growing on a cell slide according to a PEI transfection method (transfection reagent is purchased from thermo company and is transfected according to instructions), the HEK293 cells are washed for 2 times by PBS after 48 hours, are fixed for 30 minutes by adding acetone, are washed for 2 times by PBS, and are dried to obtain the cell slide over-expressing the CHI3L1 and a control pcDNA3.1 cell slide for later use.

2. Immunofluorescent staining: taking 1mL of the supernatant 1A9, TIML-1A9 and abgtx-1A9 collected in the step two of the embodiment, respectively adding 2 mu L of Tween-20, uniformly mixing, respectively incubating to the cell climbing tablet over-expressing CHI3L1 and the control pcDNA3.1 cell climbing tablet in the step 1, incubating for 1h at room temperature, and washing with PBST for 3 times, wherein each time is 5min; adding FITC labeled secondary antibody (mouse), incubating for 30min at room temperature, and washing with PBST for 3 times each for 5min; the results were observed under a microscope and photographed, and the results are shown in fig. 2.

From FIG. 2, it can be seen that the secretion expression level is obviously improved after the original signal peptides of the light chain and the heavy chain of the 1A9 antibody are replaced by the signal peptides TIML and abgtx according to the invention, and the secretion expression level is consistent with ELISA results.

4. WB to verify the secretory expression level of recombinant antibody

1. Preparing a sample:

(1) Transfection was performed with reference to the instructions of PEI, 1.5. Mu.g of each of the 1A9-m2a and 1A9-mk plasmids was CO-transferred into HEK293 cells cultured in 6-well plates, placed at 37℃and 5% CO ₂ Culturing in a cell incubator, designated 1A9, and using HEK293 cells transfected with 3 μg pcDNA3.1 plasmid as a blank control, designated pcDNA3.1;

the heavy and light chain plasmids of the same signal peptide after the replacement of the signal peptide were successively co-transferred using the method described above, wherein TIML-1A9-m2a and TIML-1A9-mk co-transferred were noted as TIML-1A9, abgtx-1A9-m2a and abgtx-1A9-mk co-transferred were noted as abgtx-1A9, HSA-1A9-m2a and HSA-1A9-mk co-transferred were noted as HSA-1A9, IL2-1A9-m2a and IL2-1A9-mk co-transferred were noted as IL2-1A9.

(2) After 48 hours, the cell culture solution in the step (1) is collected, the collected culture solution is centrifuged (4 ℃ C., 4500r,5 min), the sediment is discarded, and the supernatant is collected; taking 40 μl of supernatant, adding 10 μl of 5×protein Loading, and decocting at 90deg.C for 10min; respectively obtaining 1A9, TIML-1A9, abgtx-1A9, HSA-1A9, IL2-1A9 and pcDNA3.1 supernatant samples;

(3) Washing the cells in the step (1) twice with PBS, adding 500 mu L of RIPA cell lysate, collecting the cells, ultrasonically crushing, centrifuging (4 ℃ C., 9500rpm,20 min), discarding the precipitate, and collecting the supernatant; taking 40 μl of supernatant, adding 10 μl of 5×protein Loading, and decocting at 90deg.C for 10min; obtaining 1A9, TIML-1A9, abgtx-1A9, HSA-1A9, IL2-1A9 and pcDNA3.1 cell samples respectively;

3. preparing a sample, and transferring a PVDF film:

preparing SDS-PAGE gel, loading 10 mu L of the boiled sample (the loading sequence is pcDNA3.1 supernatant, pcDNA3.1 cells, IL2-1A9 supernatant, IL2-1A9 cells, HSA-1A9 supernatant, HSA-1A9 cells, abgtx-1A9 supernatant, abgtx-1A9 cells, TIML-1A9 supernatant, TIML-1A9 cells, 1A9 supernatant, 1A9 cells and Marker in sequence from left to right), and running 120V voltage to blue loading to the bottom of the gel; sealing with 5% skimmed milk powder for 2h after transferring PVDF membrane;

2. sample incubation:

(1) One membrane was incubated with gapdh reference antibody (rabbit source) for 2h, washed 3 times with TBST, incubated with HRP-labeled anti-rabbit secondary antibody for 1h, washed 3 times with TBST, and exposed to light. The results are shown in FIG. 3 (a).

(2) One membrane was taken for direct incubation of HRP-labeled anti-murine secondary antibody for 1h, washed 3 times with tbst, and exposed. The results are shown in FIG. 3 (b).

As can be seen from FIG. 3 (a) and FIG. 3 (b), the secretion function of 1A9 antibody was different after the replacement of different signal peptides under the same cell amount, and the secretion amount of the original signal peptide of 1A9 was very low. Compared with the original signal peptide, the TIML and abgtx have slightly lower intracellular expression quantity, but obviously improved secretion quantity, and compared with the original signal peptide, the HSA and IL2 have obviously reduced intracellular expression quantity and slightly improved secretion quantity, and the result is consistent with ELISA, so that the signal peptides TIML and abgtx can be used for replacing the original signal peptide of the antibody, and the secretion expression quantity of the antibody can be improved.

Example 2: comparison of secretory expression amount of antibody 6D9

1. Construction of recombinant expression vectors

1. The heavy chain sequence of the murine CHI3L1 monoclonal antibody 6D9 prepared in the laboratory is SEQ ID NO.11, the light chain sequence is SEQ ID NO.12, the heavy chain of the antibody 6D9 is synthesized on a pcDNA3.1 vector and is marked as pcDNA3.1-6D9-m2a, and the light chain of the antibody 6D9 is synthesized on the pcDNA3.1 vector and is marked as pcDNA3.1-6D9-mk; the constructed recombinant vectors pcDNA3.1-6D9-m2a and pcDNA3.1-6D9-mk are subjected to plasmid large extraction for later use and are named as 6D9-m2a and 6D9-mk respectively.

2. The primers are designed as shown in Table 4, original signal peptides of a heavy chain (shown as SEQ ID NO. 17) of a monoclonal antibody 6D9 are respectively replaced by the 4 signal peptides (TIML, abgtx, HSA, IL 2) in a PCR mode, and the obtained recombinant plasmids are respectively named as TIML-6D9-m2a, abgtx-6D9-m2a, HSA-6D9-m2a and IL2-6D9-m2a; the specific operation steps are as follows: PCR was performed using the recombinant vector pcDNA3.1-6D9-mk as a template and the 4 pairs of primer sequences in Table 4 as primers, respectively, and the system and procedure used and the procedure were the same as in example 1 except that the template and primer sequences used were different.

TABLE 4 Table 4

The primers were designed as shown in Table 5, and the signal peptide of the light chain of antibody 6D9 (shown as SEQ ID NO. 18) was replaced with the above 4 signal peptides (TIML, abgtx, HSA, IL 2), and the recombinant plasmids obtained were named TIML-6D9-mk, abgtx-6D9-mk, HSA-6D9-mk, IL2-6D9-mk, respectively. The specific operation steps are as follows: PCR was performed using the recombinant vector pcDNA3.1-6D9-mk as a template and the 4 pairs of primers in Table 5 as primers, respectively, and the system and procedure used and the procedure were the same as in example 1 except that the template and primer sequences used were different.

TABLE 5

/>

2. ELISA for verifying secretion expression level of recombinant antibody

According to the transfection method of PEI (transfection reagent is purchased from thermo company and is used for transfection according to the instruction manual), two groups of 6D9 plasmids of the same signal peptide are respectively transfected into HEK293 cells, and the secretory expression amounts of recombinant antibodies 6D9, TIML-6D9, abgtx-6D9, HSA-6D9 and IL2-6D9 are detected by ELISA method in the same specific operation procedure as in example 1, and the results are shown in Table 6 and FIG. 4.

TABLE 6

As can be seen from Table 6 and FIG. 4, under the same conditions, the secretion expression amounts of the signal peptides TIML and abgtx and the original signal peptide of the antibody are improved, the antibody titer is improved by about 3 times, and the titer of other signal peptides IL2 commonly used for antibody secretion expression is slightly lower than that of the original signal peptide of the antibody, and the titer of the HSA signal peptide is obviously reduced compared with that of the original signal peptide.

3. CBA verification of recombinant antibody secretion expression level

Taking 1mL of each of the supernatant 6D9, TIML-6D9 and abgtx-6D9 collected in the step two of the embodiment, respectively adding 2 mu L of Tween-20, uniformly mixing, respectively incubating until the cell climbing sheet which is prepared in the embodiment 1 and over-expresses CHI3L1 is compared with pcDNA3.1 cell climbing sheet, incubating for 1h at room temperature, and washing with PBST for 3 times, wherein each time is 5min; adding FITC labeled secondary antibody (mouse), incubating for 30min at room temperature, and washing with PBST for 3 times each for 5min; the results were observed under a microscope and photographed, and the results are shown in fig. 5.

From FIG. 5, it can be seen that the secretion expression levels of the original signal peptides of the light chain and the heavy chain of the 6D9 antibody are obviously improved after being replaced by the signal peptides TIML and abgtx according to the invention, and the secretion expression levels are consistent with ELISA results.

4. WB to verify the secretory expression level of recombinant antibody

The experimental procedure is the same as in example 2, and the loading sequence is from left to right: pcDNA3.1 supernatant, pcDNA3.1 cells, HSA-6D9 supernatant, HSA-6D9 cells, IL2-6D9 supernatant, IL2-6D9 cells, abgtx-6D9 supernatant, abgtx-6D9 cells, TIML-6D9 supernatant, TIML-6D9 cells, 6D9 supernatant, 6D9 cells, marker, and the results are shown in FIG. 6 (a) and FIG. 6 (b).

From fig. 6 (a) and 6 (b), it can be seen that the secretion functions of different signal peptides of the 6D9 antibody are different under the condition that the cell amounts are the same, and the intracellular expression amounts of the tidl and abgtx are not obviously different from the intracellular expression amounts of the original signal peptide, but the secretion amounts are obviously different, so that the intracellular expression amounts of HSA and IL2 are obviously reduced, and the secretion amounts are obviously reduced, which is consistent with the ELISA result.

Comparative example 1: comparison of secretion expression level of other Signal peptides

Randomly selecting 3 natural signal peptides comprising pelb (pectate lyase B), mmp9 (matrix metalloproteinase 9) and mog (myelin oligodendrocyte glycoprotein) and the signal peptides of the invention simultaneously compare secretion expression levels with the original signal peptide of the antibody itself.

The amino acid sequences of the above 3 signal peptides are as follows:

pelb：MKYLLPTAAAGLLLLAAQPAMA(SEQ ID NO.41)

mmp9：MSLWQPLVLVLLVLGCCFA(SEQ ID NO.42)

mog：MASLSRPSLPSCLCSFLLLLLLQVSSSYA(SEQ ID NO.43)

the nucleotide sequences encoding the above 3 signal peptides are as follows:

pelb：

ATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCT GCCCAGCCGGCGATGGCC(SEQ ID NO.44)

mmp9：

ATGAGCCTCTGGCAGCCCCTGGTCCTGGTGCTCCTGGTGCTGGGCTG CTGCTTTGCT(SEQ ID NO.45)

mog：

ATGGCAAGCTTATCAAGACCCTCTCTGCCCAGCTGCCTCTGCTCCTTC CTCCTCCTCCTCCTCCTCCAAGTGTCTTCCAGCTATGCA(SEQ ID NO.46)

1. construction of recombinant expression vectors

1. The heavy chain sequence of the murine ENO2 monoclonal antibody 11D7 prepared in the laboratory is SEQ ID NO.13, the light chain sequence is SEQ ID NO.14, the heavy chain of the antibody 11D7 is synthesized on a pcDNA3.1 vector and is marked as pcDNA3.1-11D7-mg1, and the light chain of the antibody 11D7 is synthesized on the pcDNA3.1 vector and is marked as pcDNA3.1-11D7-mk; the constructed recombinant vectors pcDNA3.1-11D7-mg1 and pcDNA3.1-11D7-mk are subjected to plasmid large extraction for later use and are named 11D7-mg1 and 11D7-mk respectively.

2. The primers are designed as shown in Table 7, the signal peptide of the heavy chain of monoclonal antibody 11D7 (shown as SEQ ID NO. 19) is replaced by signal peptides TIML, abgtx, mmp, pelb and mog respectively by means of PCR, and the obtained recombinant plasmids are named TIML-11D7-mg1, abgtx-11D7-mg1, mmp9-11D7-mg1, pelb-11D7-mg1, mog-11D7-mg1 respectively; the specific operation steps are as follows: PCR was performed using the recombinant vector pcDNA3.1-11D7-mg1 as a template and the 5 pairs of primer sequences in Table 7 as primers, respectively, and the system and procedure, and the procedure used were the same as in example 1 except that the template and primer sequences used were different.

TABLE 7

3. Primers were designed as shown in Table 8, and the signal peptide of the light chain of antibody 11D7 (shown as SEQ ID NO. 20) was replaced with signal peptides TIML, abgtx, mmp, pelb and mog, respectively, and the obtained recombinant plasmids were named TIML-11D7-mk, abgtx-11D7-mk, mmp9-11D7-mk, pelb-11D7-mk and mog-11D7-mk, respectively. The specific operation steps are as follows: PCR was performed using the recombinant vector pcDNA3.1-11D7-mk as a template and the 5 pairs of primer sequences in Table 8 as primers, respectively, and the system and procedure used and the procedure were the same as in example 1 except that the template and primer sequences used were different.

TABLE 8

2. ELISA (enzyme-Linked immuno sorbent assay) for detecting secretion expression quantity of recombinant antibody

The secretory expression amounts of the recombinant antibodies 11D7, TIML-11D7, abgtx-11D7, mmp9-11D7, pelb-11D7 and mog-11D7 were measured by ELISA method according to the transfection method of PEI (transfection reagent was purchased from thermo company, reference instruction manual) and the same signal peptide was co-transfected into HEK293 cells, and the results are shown in Table 9 and FIG. 7, except that the protein coated on ELISA plate was ENO 2.

TABLE 9

/>

As can be seen from Table 9 and FIG. 7, the TIML secretion expression level of the signal peptide was increased, the abgtx secretion expression level was equivalent, and the other three signal peptides, mmp9, pelb and mog, were each decreased to a different extent under the same conditions as the original signal peptide of the antibody.

Conclusion:

according to the experimental results, the signal peptides TIML and abgtx can guide the correct expression of the target antibody, and compared with the conventional signal peptides HSA and IL2 used for guiding the secretory expression of the antibody, the signal peptide obviously improves the secretory expression quantity of the target antibody in cells, can reduce the production cost of the antibody, and has great application prospect in the biomedical field with great antibody demand.

The above is only for illustrating the technical idea of the present invention, and the protection scope of the present invention is not limited by this, and any modification made on the basis of the technical scheme according to the technical idea of the present invention falls within the protection scope of the claims of the present invention.

Claims

1. The application of the snake venom peptide signal in improving the secretory expression quantity of the recombinant antibody is characterized in that the snake venom peptide signal comprises the snake venom peptide signal and the mutant peptide thereof, and the snake venom peptide signal and the mutant peptide thereof can guide the secretory expression of the recombinant antibody.

2. The use of claim 1, wherein the snake venom signal peptide is a bungarotoxin signal peptide having the amino acid sequence shown in SEQ ID No. 2.

3. The use according to claim 2, wherein the mutated signal peptide based on the bungarotoxin signal peptide is obtained by mutating amino acids 3 and 13 of the bungarotoxin signal peptide, the amino acid sequence of which is shown in SEQ ID No. 1.

4. The use according to claim 1, wherein the snake venom signal peptide is used to replace the original signal peptide of the antibody itself to increase the secretory expression of the target antibody.

5. The use of claim 1, wherein the snake venom signal peptide is added to a recombinant antibody which does not contain a signal peptide, for directing secretion of the antibody to increase secretory expression of the antibody of interest.

6. The use according to claim 5, wherein the recombinant antibodies free of signal peptide are obtained by degenerate primer preparation or by deletion of the antibody self-signal peptide.

7. A snake venom signal peptide for improving the secretion expression level of recombinant antibody is characterized by being obtained by mutation of bungarotoxin signal peptide, and the amino acid sequence of the snake venom signal peptide is shown as SEQ ID NO. 1.

8. A class of snake venom signal peptides which increase secretory expression of recombinant antibodies according to claim 7 wherein the recombinant antibodies are monoclonal antibodies, bispecific antibodies, single chain antibodies, chimeric antibodies, fab, fv, scFv, sdAb, minibodies or nanobodies.

9. A recombinant expression vector comprising a nucleic acid molecule encoding a snake venom signal peptide for increasing the secretory expression of a recombinant antibody according to claim 7, wherein the nucleic acid molecule is linked to the front end of a polynucleotide encoding an antibody of interest and then linked to the expression vector;

the expression vectors include pcDNA3.1, pIRES, pTT3, pCEP4 and pATX1.

10. A host cell comprising the recombinant expression vector of claim 9, the host cell comprising HEK293, CHO, BHK, and SP2/0.