CN116334024A

CN116334024A - Aurora kinase B gene K85 and K87 mutation and application thereof

Info

Publication number: CN116334024A
Application number: CN202211565430.9A
Authority: CN
Inventors: 李莉; 李琴; 马燕芳; 邵根泽
Original assignee: Peking University
Current assignee: Peking University
Priority date: 2022-12-07
Filing date: 2022-12-07
Publication date: 2023-06-27

Abstract

The invention relates to K85 and K87 mutations of human aurora kinase B and application thereof. Specifically, mutations in K85 and/or K87 in human aurora B result in increased ubiquitination modification of K63 class at other sites of aurora kinase, resulting in increased levels of aurora B phosphorylation. Mutations in K85 and/or K87 in aurora B can promote tumorigenesis and result in sensitization of cells to aurora kinase inhibitor drugs. The K85 and/or K87 mutation in aurora kinase B can be used for screening tumor patients sensitive to aurora kinase inhibitor antitumor drugs, can also be used as a pharmaceutical composition for treating tumors together with aurora kinase inhibitors, and can be used for designing and screening novel inhibitors combined with aurora kinase.

Description

Aurora kinase B gene K85 and K87 mutation and application thereof

Technical Field

The invention relates to the fields of molecular biology and cell biology, in particular to mutation of coding amino acid site K202 in aurora kinase B gene and application thereof.

Background

Existing studies confirm that Aurora kinase (Aurora kinase) B is expressed at high frequency in a variety of different tumors such as breast cancer, non-small cell lung cancer, prostate cancer, glioblastoma, thyroid cancer, diffuse large B lymphoma, burkitt's and Hodgkin's lymphomas, plays an important role in multiple links of tumorigenesis, development, metastasis and drug resistance, and is associated with poor prognosis. These studies highlight the role of aurora B in tumor transformation, and thus aurora B is a target for tumor treatment. The international pharmaceutical manufacturers merck, aslican, pyroxene and the like are in great effort to develop targeted Aurora family medicaments, and a plurality of small molecule compounds targeted to Aurora kinase B have been subjected to phase I, phase II or phase III clinical tests in multiple centers worldwide. For example, AZD1152 (Barasertib), a small molecule drug that specifically selectively targets aurora kinase B kinase, was tested in phase I/II clinical trials for malignant solid tumors (NCT 00497731) and relapsed/refractory diffuse large B lymphomas (NCT 01354392), and in phase I/II/III clinical trials for Acute Myelogenous Leukemia (AML) (NCT 00497991) (NCT 00952588). Although these drugs show some antitumor effect, dose-dependent toxicity (neutrophil toxicity) remains a major problem, and no clinical application is approved at present. Researchers have been trying to find ways to attenuate, potentiate or use in combination with other therapeutic agents in an effort to promote the entry of inhibitors of aurora B kinase into the clinical market.

Post-translational modification of aurora kinase B protein has important regulatory effects on its correct localization and kinase activity during mitosis. The inventors found that K63-linked ubiquitination modification has important regulation effect on the activity of aurora kinase B. Ubiquitin (Ub) is a small molecule of only 76 amino acids. Under the action of ubiquitin activating enzyme E1, ubiquitin coupling enzyme E2 and ubiquitin ligase E3, the Gly residue at the C end of ubiquitin molecule is in covalent connection with the Lys residue on target protein, so that the target protein is labeled with ubiquitin. Ubiquitin molecules themselves contain 7 Lys residues (K6, K11, K27, K29, K33, K48, K63), together with the N-terminal methionine (M1) which can be used as a secondary attachment point, can form various ubiquitin chains with different structures and functions, different types of ubiquitin chains confer different functions and fate to proteins. For example, K48-linked polyubiquitin chains label proteins to proteasome degradation, and K63-linked polyubiquitin chains provide a platform for protein-protein interactions, and participate in protein transport, DNA damage repair, immune responses, etc., by altering the stability of target proteins, affecting the localization and functional activity of target proteins, etc. The present inventors have shown by protein mass spectrometry, site-directed mutagenesis and other techniques that lysine residues K at positions 85 and 87 of aurora kinase B are potential ubiquitination sites, and mutation of these sites, i.e. mutation of lysine at position 85 or 87, especially double mutation of K85 and K87, increases ubiquitination level of other sites of aurora kinase B, thereby leading to increase of phosphorylation level, enhancement of activity and promotion of proliferation of cells. Thus, mutations at the K85 and K87 sites of aurora kinase B kinase can be used as a tumor-prone marker, or as a sensitizer for aurora kinase inhibitor for use in a therapeutic drug for tumors, and a method or use for screening for an aurora kinase inhibitor sensitizer.

Disclosure of Invention

The invention discovers that the K63 type ubiquitination of other sites is increased after the lysine at the 85 th or 87 th position or both of the human aurora kinase B shown in SEQ ID NO.1 is mutated, so that the 232 th threonine phosphorylation is increased, and the effect of promoting cell proliferation is achieved. And it is expected that the same effect is exhibited by other human aurora kinase proteins after amino acid sequence alignment corresponding to mutation of lysine at position 85 and/or 87 of SEQ ID NO. 1.

Thus, a first aspect of the present invention relates to a human aurora kinase mutant protein which is a mutant protein of aurora kinase B, aurora kinase C or aurora kinase a, characterized in that the lysine at position 85 and/or 87 of SEQ ID No.1 is replaced by a non-lysine or the lysine corresponding to position 85 and/or 87 of SEQ ID No.1 is replaced by a non-lysine or is deleted by amino acid sequence alignment. Where 85 and/or 87 positions refer herein to 85 or 87 positions or both 85 and 87 positions.

In a preferred embodiment, the human aurora kinase mutant protein is characterized in that the lysine at position 44 and/or 46 of SEQ ID NO.2 is replaced by a non-lysine, the lysine at position 86 and/or 88 of SEQ ID NO.3 is replaced by a non-lysine, the lysine at position 45 and/or 47 of SEQ ID NO.4 is replaced by a non-lysine, the lysine at position 85 of SEQ ID NO.5 is replaced by a non-lysine, the lysine at position 51 and/or 53 of SEQ ID NO.6 is replaced by a non-lysine, the lysine at position 32 and/or 34 of SEQ ID NO.7 is replaced by a non-lysine, the lysine at position 17 and/or 19 of SEQ ID NO.8 is replaced by a non-lysine or the lysine at position 141 and/or 143 of SEQ ID NO.9 is replaced by a non-lysine.

In a further preferred embodiment, the human aurora kinase mutant protein is characterized in that the substitution by non-lysine is substitution by arginine or histidine.

The second aspect of the present invention relates to a human aurora kinase mutant nucleic acid encoding said human aurora kinase mutant protein.

The third aspect of the present invention relates to a vector comprising the human aurora kinase mutant nucleic acid.

The fourth aspect of the present invention relates to a means for identifying the mutant protein or the mutant nucleic acid of the present invention, a specific antibody or antigen-binding fragment thereof directed against the mutant protein of human aurora kinase of the present invention, a primer pair or probe directed against the mutant nucleic acid of the present invention.

The fifth aspect of the present invention relates to the use of the mutant protein or mutant nucleic acid of the present invention or the vector of the present invention for preparing a pharmaceutical composition for treating a tumor, characterized IN that the pharmaceutical composition comprises the human aurora kinase mutant protein or mutant nucleic acid or vector of the present invention, IN addition, aurora kinase inhibitor CYC-116, aurora kinase A inhibitor 2, tozasertib, aurora kinase-IN-2, SCH-1473759, TAK-901, MLN8054, KW-2449, reversible, TAK-901, aurora kinase inhibitor-2, aurora kinase A inhibitor 1, MK-5108, tripolin A, AT9283, ZM-4477439, phthalazinone pyrazole, tinengotinib, AMG, alisertib sodium, PF-03814735, aurora kinase inhibitor 1, NU6140, aurora kinase inhibitor 3, TC-A2317 hydrochloride an aurora kinase inhibitor such AS GSK-1070916, AS-703569, LY3295668, aurora kinase inhibitor-9, CCT241736, derrone, up to Lu She, ABT-348 hydrochloride, SNS-314, aurora kinase inhibitor-10, ENMD-2076, CD532, hesperadin, AZD1152, AZD2811, AAPK-25, CCT129202, CCT-137690, chiauranib, JNJ-7706621, MK-8745, PHA-680632, TC-S7010, BI-847325, BI-831266, BI-811283, TAS-119, JAB-2000, VIC-1911, JS112 or JAB-2485, the tumor is a malignant tumor of blood system (including leukemia, myelogenous leukemia, acute myelogenous leukemia, multiple myeloma, acute lymphoblastic leukemia, chronic myelogenous leukemia, myelodysplastic syndrome, myelogenous fibrosis), myeloid metaplasia, hodgkin's lymphoma, non-hodgkin's leukemia, non-hodgkin's lymphoma, cd30+ lymphoma, recurrent/refractory lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, burkitt's lymphoma, T-cell lymphoma, B-cell lymphoma, transformed follicular lymphoma, peripheral T-cell lymphoma, waldenstrom's macroglobulinemia), solid tumors, breast tumors (including but not limited to breast cancer, metastatic breast cancer), colon tumors (including but not limited to colon cancer, colorectal cancer, rectal cancer), pancreatic tumors (including but not limited to pancreatic cancer), bladder tumors (including but not limited to bladder cancer), prostate cancer, lung cancer (including but not limited to non-small cell lung cancer), lung cancer metastatic and recurrent non-small cell lung cancer, advanced non-small cell lung cancer), mesothelioma, ovarian cancer, fallopian tube tumors (including but not limited to fallopian tube cancer), hepatocellular carcinoma, peritoneal cancer, head and neck squamous cell carcinoma, gastroesophageal adenocarcinoma, myelofibrosis, melanoma, neuroblastoma, adult astrocytoma, adult giant cell glioblastoma, myxofibrosarcoma, leiomyoma, liposarcoma, soft tissue sarcoma, malignant peripheral nerve sheath tumor, undifferentiated polymorphous sarcoma, uterine sarcoma, colonic mucous adenoma, rectal mucous adenoma, hepatoblastoma, pediatric rhabdomyoma, pediatric kidney tumor, soft tissue sarcoma, thyroid cancer or gastric cancer.

A sixth aspect of the invention relates to a method for predicting whether a person is susceptible to a tumour, characterized in that the method comprises the steps of:

(a) Determining whether said human aurora kinase mutant protein is expressed in said human sample; and/or

(b) Determining the presence or absence of said human aurora kinase mutant nucleic acid in said human sample;

(c) The human aurora kinase mutant protein is susceptible to a tumor if the determination in (a) determines the expression of said human aurora kinase mutant protein in a human sample and/or the determination in (b) determines the presence of said human aurora kinase mutant nucleic acid in a human sample.

A seventh aspect of the present invention relates to a method for predicting the therapeutic response of a patient suffering from a tumor to a human aurora kinase inhibitor-type anti-tumor drug, characterized in that said method comprises the steps of:

(a) Determining whether said human aurora kinase mutant protein is expressed in said patient sample; and/or

(b) Determining the presence or absence of said human aurora kinase mutant nucleic acid in said patient sample;

(c) If the assay result in (a) determines that the human aurora kinase mutant protein is expressed in a patient sample and/or the assay result in (b) determines that the human aurora kinase mutant nucleic acid is present in a patient sample, the patient responds to treatment with a human aurora kinase inhibitor-type antitumor drug.

IN a preferred embodiment, the aurora kinase inhibitor-type antitumor drug is CYC-116, aurora kinase A inhibitor 2, tozasertib, aurora kinase-IN-2, SCH-1473759, TAK-901, MLN8054, KW-2449, reversible, TAK-901, aurora kinase inhibitor-2, aurora kinase A inhibitor 1, MK-5108, tripolin A, AT9283, ZM-4477439, phthalazinone pyrazole, tinengotinib, AMG, alisertib sodium, PF-03814735, aurora kinase inhibitor 1, NU6140, aurora kinase inhibitor 3, TC-A2317 hydrochloride, GSK-1070916, AS-703569, LY3295668, aurora kinase inhibitor-9, CCT241736, derrone, da Lu She alternatively, ABT-348 hydrochloride, S-314, aurora kinase inhibitor-10, ENMD-6, CD Hesperadin, AZD, 1152, 28126-BI 26, AAS 3745, JA-3765, JA 37B-37, JA-37B, JA-37, and so on, or the like, and the like, the patient with tumor is malignant tumor of blood system (including leukemia, myelogenous leukemia, acute myelogenous leukemia, multiple myeloma, acute lymphoblastic leukemia, chronic myelogenous leukemia, myelodysplastic syndrome) myeloid fibrosis, myeloid metaplasia, hodgkin ' S lymphoma, non-hodgkin ' S leukemia, non-hodgkin ' S lymphoma, cd30+ lymphoma, relapsed/refractory lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, burkitt lymphoma, T cell lymphoma, B cell lymphoma, transformed follicular lymphoma, peripheral T cell lymphoma, waldenstrom's macroglobulinemia), solid tumors, breast tumors (including but not limited to breast cancer, metastatic breast cancer), colon tumors (including but not limited to colon cancer, colorectal cancer, rectal cancer), pancreatic tumors (including but not limited to pancreatic cancer), bladder tumors (including but not limited to bladder cancer), prostate cancer, lung cancer (including but not limited to non-small cell lung cancer, metastatic and recurrent non-small cell lung cancer, advanced non-small cell lung cancer), mesothelioma, ovarian cancer, fallopian tube tumors (including but not limited to fallopian tube cancer), hepatocellular carcinoma, peritoneal carcinoma, head and neck squamous cell carcinoma, gastroesophageal adenocarcinoma, myelofibrosis, melanoma, neuroblastoma, adult astrocytoma, adult giant cell sarcoma, myxofibrosarcoma, smooth myoma, liposarcoma, soft tissue sarcoma, malignant peripheral nerve sheath tumor, fibrosarcoma, carcinoma of the stomach cancer, fibrosarcoma, carcinoma of the human breast, carcinoma of the children, fibrosarcoma, carcinoma of the uterus, carcinoma of the human being, carcinoma of the uterus, carcinoma of the children, carcinoma of the uterus, tumor of the human being, or the children, tumor of the human being, or the human being.

An eighth aspect of the present invention relates to a method for screening a candidate drug for treating a tumor, characterized by: the method comprises the following steps:

(a) Providing a control cell population and a test cell population, wherein the cells of the test cell population express said human aurora kinase mutant protein, or the cells of the test cell population comprise said human aurora kinase mutant nucleic acid or said vector;

(b) Adding a test drug to the control cell group and the test cell group, respectively;

(c) Detecting the cell proliferation rates of a control cell group and a test cell group respectively;

(d) If the cell proliferation rate of the test cell line is less than the cell proliferation rate of the control cell line, the drug tested is selected as a candidate drug for treating the tumor.

The ninth aspect of the present invention relates to the use of said mutant protein or said mutant nucleic acid for predicting whether a human is susceptible to a tumor, for predicting the therapeutic response of a patient to a human aurora kinase inhibitor-like anti-tumor drug, or for screening candidate drugs for treating a tumor.

The tenth aspect of the present invention relates to an aurora kinase inhibitor, which is characterized in that the binding affinity of the aurora kinase inhibitor to the human aurora kinase mutant protein according to the present invention is higher than the binding affinity to the human aurora kinase wild-type protein.

Drawings

FIG. 1 is a Western Blot detection format showing HeLa cell endogenous aurora kinase B, demonstrating that HeLa cell endogenous aurora kinase B undergoes K63-type ubiquitination during mitosis.

FIG. 2 shows the results of Ni-NTA pull down experiments on ubiquitin molecular mutant plasmids HA-K48-Ub or HA-K63-Ub and aurora kinase B. Wherein, in the HA-K48-Ub plasmid, the ubiquitin molecules except K48 are all mutated into arginine, and in the HA-K63-Ub plasmid, the ubiquitin molecules except K63 are all mutated into arginine. The ubiquitination and phosphorylation of aurora kinase B in the experimental group transfected with HA-K63-Ub were shown to be significantly enhanced.

FIG. 3 shows the results of Ni-NTA pull down experiments on ubiquitin molecular mutant plasmids HA-Ub-K48R or HA-Ub-K63R and aurora kinase B. Wherein, in the HA-Ub-K48R plasmid, only K48 in ubiquitin molecules is mutated into arginine, and in the HA-Ub-K63R plasmid, only K63 in ubiquitin molecules is mutated into arginine. The ubiquitination and phosphorylation of aurora kinase B in the experimental group transfected with HA-Ub-K63R were shown to be significantly reduced.

FIG. 4 is a graph showing the results of Ni-NTA pull-down experiments in which plasmids V5-His-Aurora B, HA-K63-Ub and pEYFP-BRCC36 (labeled pEYFP-B36 in the figure) or pEYFP-BRCC36-QSQ (labeled pEYFP-B36-QSQ in the figure) were transiently transfected into 293T cells, the Nocodazole-treated cells were synchronized to the dividing stage, and the cells were collected for Ni-NTA pull-down experiments under denaturing conditions, showing that BRCC36 regulates the ubiquitination level of Aurora kinase B.

FIG. 5 is a graph of Western Blot results of Abro1-KO, BRCC36-KO and Abro1, BRCC36, aurora kinase B in control cells, showing no difference in protein levels of aurora kinase B in Abro1-KO and BRCC36-KO cell lines compared to control cell lines.

FIG. 6 is a bar graph of T232 phosphorylation of Aurora B in Abro1-KO, BRCC36-KO, and control cells, where ns indicates no statistical difference and p <0.001, showing that the fluorescence intensity of Aurora B-pT232 is significantly higher in Abro1-KO, BRCC36-KO pre-mitotic cells than in control cells.

FIG. 7 is a mass spectrometry graph of Flag-Aurora B immunoprecipitates showing the detection of peptide fragments comprising the K85, K87, K202 and K211 sites in Aurora B, indicating that K85, K87, K202 and K211 may be ubiquitinated modification sites of Aurora B.

FIG. 8 is a Ni-NTA pull-down experiment result of aurora B mutant, and the result shows that K85R/K87R double mutant makes the rising trend of the ubiquitination level of aurora B most obvious, and the phosphorylation level also increases most obviously, and K85R or K87R single mutant makes the ubiquitination level and the phosphorylation level of aurora B also increase.

FIG. 9 is a Flag-IP experiment result of Aurora kinase B mutant, showing that no significant difference in the levels of INCENP and Survivin was detected in the IP product of Flag-Ha-Aurora B-K85R/87R mutant, but the phosphorylation of Aurora B-pT232 was significantly increased. Demonstrating that Aurora B-K85/87R promotes kinase activity of Aurora kinase B.

FIG. 10 is a SDS-PAGE silver staining of Flag-HA-Aurora B and Flag-HA-Aurora B-K85/87R purified proteins. Wherein, the transient over-expression of Flag-HA-Aurora B or Flag-HA-Aurora B-K85/87R in 293T cells, the mid-stage cells were collected and purified by Flag Beads, and then subjected to SDS-PAGE electrophoresis and silver staining.

FIG. 11 is a Western Blot detection of purified Flag-HA-Aurora B or Flag-HA-Aurora B-K85/87R following in vitro phosphorylation with H3 as substrate. Wherein Aurora kinase B, H, H3-pS10, aurora B-pT232 detection was performed using anti-Flag antibody, anti-H3-pS 10 antibody and anti-Aurora B-pT232 antibody, respectively. The results showed that the levels of aurora kinase B phosphorylation and H3 phosphorylation were significantly higher in the Flag-HA-Aurora B-K85/87R treated group than in the Flag-HA-Aurora B treated group.

FIG. 12 is a plate clone formation experiment of HeLa cells stably transfected with FH-Aurora B, FH-Aurora B-K85-R, FH-Aurora B-K87-R, FH-Aurora B-K85/87R. Wherein stably transfected HeLa cells were grown in 6cm diameter petri dishes for about 10 days, stained with crystal violet and photographed. Clones were significantly increased in the dishes of HeLa cells transfected with FH-Aurora B-K85-K R, FH-Aurora B-K87R, FH-Aurora B-K85/87R and the largest number of clones in the dishes of HeLa cells transfected with Aurora B-K85/87R compared to cells stably transfected with FH-Aurora B.

Fig. 13 is a bar graph of the colony formation number in fig. 12 using Image J statistics. Wherein p <0.001. Clones were significantly increased in the dishes of HeLa cells transfected with FH-Aurora B-K85-K R, FH-Aurora B-K87R, FH-Aurora B-K85/87R and the largest number of clones in the dishes of HeLa cells transfected with Aurora B-K85/87R compared to cells stably transfected with FH-Aurora B.

FIG. 14 is the results of drug sensitivity experiments on AZD1152 by stably transfected lung cancer cells A549 of FH-Aurora B and Aurora B-K85/87R. Wherein, stably transfected A549 cells are planted in a 96-well plate, AZD1152 with different concentrations is added for 24 hours after the cells are attached, a CCK8 experiment is carried out, and the viability of the cells is measured. Wherein p <0.01 and p <0.001. The Aurora B-K85/87R mutant was shown to increase the sensitivity of A549 cells to AZD 1152.

FIG. 15 is a graph showing the results of drug sensitivity experiments of PC-3 cells transfected with stabilized FH-Aurora B and Aurora B-K85/87R prostate cancer cells to AZD 1152. Wherein, stably transfected PC-3 cells are planted in a 96-well plate, AZD1152 with different concentrations is added for 24 hours after the cells are attached, CCK8 experiments are carried out, and the viability of the cells is measured. Wherein p <0.01 and p <0.001. The Aurora B-K85/87R mutant was shown to increase the sensitivity of PC-3 cells to AZD 1152.

FIG. 16 is a diagram showing the structure of aurora kinase B, C and A crystals. The three aurora kinases have similar crystal structures in the catalytic regions, and the K85/87 site is adjacent to the K202 site.

FIG. 17 is a crystal structure diagram showing the binding of aurora B with various inhibitors. Wherein the inhibitors bound to aurora kinase B are respectively: a, barasertib (AZD 1152); b, ZM 44739; c, BI 811283; d, VX-680; e, hesperadin and F, reverse.

FIG. 18 shows amino acid sequence comparison results of three aurora kinases. Wherein "+" indicates that the compared amino acid sequences are identical, ":" indicates that the amino acids are strongly conserved, "amino acids are weakly conserved, lysine sites of the invention are boxed, the consensus sequence in the catalytic region is bold, and threonine phosphorylation sites are bold and underlined.

Detailed Description

The equal distribution of genetic material during cell mitosis, precise segregation of chromosomes is critical to the stability of the genome, and if the chromosome distribution is unequal, it will lead to aneuploidy, promoting the phenotype of chromosome instability and even the occurrence of tumors. Each link of mitosis requires precise and detailed regulation, which depends on a series of complex and precise regulation mechanisms in time and space, including the co-coordination of a plurality of related kinases such as PLK (Polo-like kinases), CDK (Cyclin-dependent kinases) and Aurora kinase (Aurora kinase).

Aurora kinase is a serine/threonine kinase, and human aurora kinase comprises three subtypes, namely aurora kinase a, aurora kinase B and aurora kinase C, which play important roles in regulating and controlling multiple links of cell mitosis. Human aurora kinases B and C are now found to exist in many forms. The primary protein structure of members of the human aurora kinase family contains two domains, an N-terminal variable region and a C-terminal catalytic region, and the C-terminal catalytic region is relatively conserved.

Aurora B kinase performs a function in mitosis primarily through the chromosome passenger complex (Chromosome passenger complex, CPC). CPC consists of four subunits, aurora B, endo-centromere protein (Inner centromere protein, incnp), survivin and Borealin. Wherein, INCENP is an assembly platform of CPC complex, which serves as a scaffold protein providing a site of interaction with Survivin, borealin and aurora kinase B; aurora kinase B acts as a catalytic subunit as a core; the other 3 subunits have a regulating effect on the kinase activity and space-time dynamic distribution of the polar light kinase B. The localization of aurora B kinase changes characteristically with cell cycle operation, consistent with this highly spatiotemporal dynamic profile, aurora B plays an important role in several links of mitosis, such as spindle assembly, kinetochore microtubule ligation, spindle assembly checkpoint and cytokinesis. Thus, aurora kinase B is a key mitotic regulator that ensures accurate chromosome segregation, preventing heteroploidy production. Inhibition or overactivation of aurora B kinase activity can cause a disturbance of mitotic progression leading to the development of tumors. The kinase activity of aurora kinase B regulates the queuing process of chromosomes in the pre-mitotic metaphase, promotes the formation of spindle check points and corrects wrong moving point-microtubule connection; after the initiation of the post-mitosis, the CPC complex completes its mission at the action point, transporting to the central spindle. Interference with CPC complex function causes metaphase chromosomal enqueuing, segregation and cytokinesis defects. Studies have shown that substrates for aurora kinase B inhibit kinase activity, and that inhibition may be reversed by phosphorylation of these substrates by PLK 1.

Although expressed mainly in testes, aurora C is also a chromosomal passenger protein whose subcellular localization is identical to aurora B. It is thought that aurora kinases C and B have differences in expressed tissue specificity, and their functions are consistent.

Aurora a replicates from the centrosome to the G1 phase of the next mitosis, always localized in the vicinity of the centrosome. It plays an important role in centrosome replication and maturation.

The inventors found that mutation of lysine at position 85 or 87 or both of human aurora kinase B as shown in sequence of variant 1 of human aurora kinase B (NCBI reference sequence NP-001300879.1,SEQ ID NO.1) resulted in failure of this site to undergo K63-type ubiquitination. According to analysis of the crystal structure of aurora B, the K85/87 site of aurora B is located at the junction between catalytic region sheets β2 and β3 and at the N-terminal leaflet surface, and is spatially adjacent to the K202 site located on the C-terminal leaflet surface, with a cleavage groove, which is normally occupied by ATP when aurora phosphorylation occurs. Presumably, due to steric hindrance, ubiquitination of lysine 85 or 87 has a competitive relationship with ubiquitination of lysine K202, and when K85 and/or K97 are mutated and ubiquitination cannot occur, ubiquitination of lysine K202 or other amino acids is possibly promoted, phosphorylation of threonine 232 is further promoted, and an effect of promoting cell proliferation is generated.

It is believed that other human aurora proteins, when aligned in amino acid sequence, produce the same effect as those obtained by mutation of lysine at positions 85 and/or 87 of SEQ ID NO. 1.

First, the catalytic region sequences of human aurora kinase B variant 1 (NCBI reference sequence np_ 001300879.1), aurora kinase B variant 2 (NCBI reference sequence np_ 001243763.1), aurora kinase B variant 3 (NCBI reference sequence np_ 001271455.1), aurora kinase B variant 4 (NCBI reference sequence np_ 001300881.1), aurora kinase B variant 5 (NCBI reference sequence np_ 001300882.1), aurora kinase C variant 1 (NCBI reference sequence np_ 001015878.1), aurora kinase C variant 2 (NCBI reference sequence np_ 001015879.1), aurora kinase C variant 3 (NCBI reference sequence np_ 003151.2), aurora kinase a (NCBI reference sequence np_ 001310234.1) were very conserved through amino acid multi-sequence alignment analysis, and in all above aurora kinases, the amino acids at positions corresponding to SEQ ID No.1 at positions 85 and/or 87 were all lysines (aurora kinase B variant 5, with only one lysine at the corresponding position), and the catalytic region sequences were highly identical to the sequence of the same sequence of the txgxxgxx (txgzhrecognition sequence of the same sequence in the txg RxT).

Secondly, the crystal structures of aurora B, aurora C and aurora a catalytic regions, as embodied in RCSB protein database PDB, are similar, and wherein the K85/87 site and the K202 site in aurora B, and the lysines at the sites corresponding to the above sites in aurora C and a are located on the surface of cleavage grooves on the N-terminal leaflet (N-lobe) and the C-terminal leaflet (C-lobe) of the catalytic region, respectively, and they are spatially adjacent (see fig. 16). For example, the crystal structure of the catalytic region of aurora kinase B binding VX-680 and INCENP is shown in the website https:// www.rcsb.org/3d-view/4AF3, the protein accession number is 4AF3, and the sequence of the catalytic region is the same as that of the catalytic regions of aurora

kinase B variants

1, 2, 3 and 4. The crystal structure of the catalytic region of aurora kinase C combined with VX-680 and INCENP is shown in https:// www.rcsb.org/3d-view/6GR9, the protein accession number is 6GR9, and the sequence of the catalytic region is the same as that of the catalytic regions of aurora

kinase C variants

1, 2 and 3. The crystal structure of the catalytic region of aurora kinase A combined with VX-680 and TPX2 is shown in https:// www.rcsb.org/3d-view/3E5A, the protein accession number is 3E5A, and the sequence of the catalytic region is the same as that of the catalytic region of aurora kinase A.

Again, mutations in different types of aurora kinases can be compensated for by other types of aurora kinases in the body. For example, studies have found that knockdown of aurora B can be complemented by other aurora kinases. For example, sasai et al found that the effect of an aurora C inactivating mutant was to induce cell production of polynuclear phenomenon, which is very similar to the phenotype produced by aurora B inactivating mutant, and that silencing aurora B or C alone by RNAi interference method could induce production of about 15% or 13% of polynuclear cells, but at the same time silencing aurora B core C produced additive effects, with polynuclear cells accounting for 25%. Overexpression of aurora kinase C in cells that interfere with aurora kinase B can partially rescue polynuclear manifestations due to aurora kinase B silencing (Sasai K, katayama H, stenoien D L, et al aurora-C kinase is a novel chromosomal passenger protein that can complement aurora-B kinase function in mitotic cells.cell Motil Cytoskeleton,2004,59 (4): 249-263). Yan et al found that aurora kinase C is also a chromosomal passenger protein, as is aurora kinase B, and that the functions of both kinases can complement each other (Yan X, wu Y, li Q, et al cloning and characterization of a novel human Aurora C splicing variant.Biochemical and biophysical research communications,2005,328 (1): 0-361). Thus, during mitosis, aurora kinases B and C can perform similar functions, complement each other, meeting the needs of the cell's mitosis process (Li Jiang et al, important functions of aurora kinase in cell mitosis and tumor formation, life sciences, 2005, 424-432).

Finally, experiments show that inhibitors of different types of aurora kinases have cross-reactions. For example, tozasertib, retroelement, AMG 900, up to Lu She, ABT-348, SNS-314, AAPK-25, CCT129202, CCT-137690, PHA-680632, etc., show inhibition of aurora kinase A, B and C.

It follows that the secondary structures of the human aurora kinase A, B and the C catalytic region should be identical or similar, and that the lysines corresponding to said sites in the K85 and K87 of SEQ ID No.1 and other aurora kinases of the present invention lead to ubiquitination of K202 in the same manner of action, thereby promoting phosphorylation of threonine at position 232 and the appearance of a pro-cell proliferation effect, and furthermore acting with an aurora kinase inhibitor to exert an effect of enhancing its tumor inhibition. That is, the same effect was obtained by amino acid sequence alignment of human aurora kinase proteins other than human aurora kinase B variant 1, which corresponds to mutation of lysine at position 85 and/or 87 of SEQ ID NO. 1. Thus, the substitution of lysine at position 44 and/or 46 of the human aurora kinase sequence SEQ ID No.2 by non-lysine, the substitution of lysine at position 86 and/or 88 of SEQ ID No.3 by non-lysine, the substitution of lysine at position 45 and/or 47 of SEQ ID No.4 by non-lysine, the substitution of lysine at position 85 of SEQ ID No.5 by non-lysine, the substitution of lysine at position 51 and/or 53 of SEQ ID No.6 by non-lysine, the substitution of lysine at position 32 and/or 34 of SEQ ID No.7 by non-lysine, the substitution of lysine at position 17 and/or 19 of SEQ ID No.8 by non-lysine, or the substitution of lysine at position 141 and/or 143 of SEQ ID No.9 by non-lysine are also provided with the technical effect of the present invention, and thus are within the scope of the present invention.

As is well known, there are 20 amino acids constituting organisms, which are classified into 4 classes according to the nature of the amino acid side chains, (1) amino acids containing nonpolar, hydrophobic side chains, including alanine (Ala, a), valine (Val, V), leucine (Leu, L), isoleucine (Ile, I), proline (Pro, P), glycine (Gly, G), methionine (Met, M), tryptophan (Trp, W) and phenylalanine (Phe, F); (2) amino acids containing polar, neutral side chains, including glutamine (Gln, Q), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), asparagine (Asn, N), and tyrosine (Tyr, Y); (3) amino acids containing polar, acidic side chains, including aspartic acid (Asp, D) and glutamic acid (Glu, E); (4) amino acids containing polar, basic side chains include lysine (Lys, K), arginine (Arg, R) and histidine (His, H). In the present invention, since the lysine at the position of the present invention is mutated to cause that the site of the protein cannot undergo K63-type ubiquitination, the technical effect of the present invention can be achieved, and thus the lysine at the position can be replaced with other types of amino acids. Since the amino acids of the same class are similar in structure, charge, polarity, hydrophobicity, etc., the amino acid substitution of the same class has minimal effect on the secondary structure of the protein, and thus in a preferred embodiment, the lysine at the position is replaced by the amino acid arginine or histidine of the same class.

Furthermore, since K85 and K87 are located at the junction between N-terminal small She and β3 and at the surface of the root N-terminal leaflet, it is believed that the loss of K85 and/or K87 has very little effect on the structure and thus would have the same effect, i.e., result in increased ubiquitination and phosphorylation of aurora kinase K202 or other sites, and act with aurora kinase inhibitors to enhance their tumor inhibiting effect. Thus, a deletion of a lysine at position 85 and/or 87 of SEQ ID NO.1, a deletion of a lysine at position 44 and/or 46 of SEQ ID NO.2, a deletion of a lysine at position 86 and/or 88 of SEQ ID NO.3, a deletion of a lysine at position 45 and/or 47 of SEQ ID NO.4, a deletion of a lysine at position 85 of SEQ ID NO.5, a deletion of a lysine at position 51 and/or 53 of SEQ ID NO.6, a deletion of a lysine at position 32 and/or 34 of SEQ ID NO.7, a deletion of a lysine at position 17 and/or 19 of SEQ ID NO.8, a deletion of a lysine at position 141 and/or 143 of SEQ ID NO.9, and a deletion of a lysine corresponding to the above positions by other aurora kinase are also within the scope of the present invention.

It is well known to those skilled in the art that there are a variety of endogenous nucleic acid sequences encoding the human aurora kinase muteins due to the presence of genetic mutations. And because of the degeneracy of the genetic code, exogenous nucleic acid sequences capable of encoding said human aurora kinase muteins cannot be listed. However, it is within the scope of the present invention that either these endogenous or exogenous mutant nucleic acids can produce the technical effects of the present invention via the encoded mutant proteins.

It is well known to those skilled in the art that the above-mentioned mutant nucleic acid can be used to construct a vector which can express the mutant protein of the present invention and produce the technical effects of the present invention after being introduced into cells, for example, as a drug into cells to express the mutant protein, to cause apoptosis of the cells, or introduced into cells cultured in vitro to cause the cells to transiently or stably express the mutant protein, for screening tumor drugs, etc., and thus the above-mentioned vector is also within the scope of the present invention. The specific types of vectors, sequences, methods of introducing cells, reagents for introducing, detection of mutant proteins, detection of cell proliferation, etc., which are capable of carrying out the technical scheme of the present invention are all within the routine skill of the present invention.

In the art, it is possible to produce a method for detecting the presence or absence of the mutant protein of the human aurora kinase of the present invention in a sample, for example, using an antibody recognizing only the mutant protein of the present invention but not the non-mutant protein, or using a monoclonal or polyclonal antibody recognizing only the non-mutant protein but not the mutant protein of the present invention or an antigen binding fragment thereof, etc. Thus, the specific antibody or antigen-binding fragment thereof for the human aurora kinase mutant protein according to the present invention refers to an antibody or antigen-binding fragment thereof recognizing only the mutant protein of the present invention, and not recognizing the non-mutant protein. The detection method comprises the steps of extracting protein of biological materials, then performing electrophoresis and hybridization western blotting, and performing in situ hybridization of cells and tissues. The preparation of antibodies and antigen binding fragments thereof, protein extraction, electrophoresis, western blot hybridization, and in situ hybridization of cells or tissues are all conventional techniques in the art.

In addition, it is well known in the art that primer pairs can be designed for the mutant nucleic acids of the present invention, whether the mutant nucleic acids of the present invention are present in a sample can be determined by a PCR amplification method, or probes can be designed for the mutant nucleic acids of the present invention, and whether the mutant nucleic acids of the present invention are present in a sample can be determined by nucleic acid molecule hybridization. The primer for the mutant nucleic acid of the present invention refers to a primer pair capable of identifying whether a sample nucleic acid sequence is the mutant nucleic acid of the present invention or encodes the mutant lysine of the present invention after PCR amplification. The probe for the mutant nucleic acid of the present invention means a probe capable of identifying whether a sample nucleic acid sequence is the mutant nucleic acid of the present invention or encodes the mutant lysine of the present invention after hybridization of the probe. The primer pairs or probes used for implementing the technical scheme of the invention are designed according to the sequences of mutant nucleic acids to be detected, and the sequences of the primer pairs or probes cannot be listed one by one. And techniques for designing primer pairs and primers, PCR amplification, nucleic acid hybridization, etc. are also conventional in the art.

The inventors found that the human aurora kinase mutant protein or mutant nucleic acid of the present invention is capable of promoting the effect of cell proliferation, and thus the human aurora kinase mutant protein or mutant nucleic acid of the present invention can be used for predicting whether a human is susceptible to a tumor, i.e. if a human carries the aurora kinase mutant nucleic acid of the present invention or is capable of expressing the aurora kinase mutant protein of the present invention, the probability of suffering from a tumor is high.

The inventors have also found that the human aurora kinase mutant proteins or mutant nucleic acids of the invention may cause cells to have a sensitizing effect on anti-tumor drugs of the aurora kinase inhibitor class. Analysis of the crystal structure of aurora kinase binding to its aurora kinase inhibitor has found that aurora kinase inhibitors are typically inserted into the cleft of the N-and C-terminal leaflets of aurora kinase and bind to amino acids on the surface of the cleft by forming hydrogen bonds or van der waals forces. Since the positions of K85 and K87 according to the present invention are on the surface of the cleft and adjacent to the inhibitor, it is presumed that K85 and/or K87 after mutation may participate in binding to the inhibitor, especially when mutated to arginine, a group capable of stabilizing the inhibitor, such as a hydroxyl group, on the other hand, may also be bound by the aurora kinase inhibitor smoothly entering the cleft because no further ubiquitination is possible after the K85 and/or K87 mutation. Therefore, the human aurora kinase mutant protein or mutant nucleic acid can be matched with aurora kinase inhibitor antitumor drugs for use, so that on one hand, the treatment effect of the antitumor drugs is enhanced, and on the other hand, the side effects of the antitumor drugs are reduced.

The use of the mutant proteins or mutant nucleic acids of the invention for the preparation of a pharmaceutical composition acting on the treatment of tumors together with an aurora kinase inhibitor, or the use of a combination of both for the treatment of tumors. The invention furthermore relates to a pharmaceutical composition for the treatment of tumors comprising a mutant protein or mutant nucleic acid according to the invention and an aurora kinase inhibitor. Although many inhibitors of aurora kinase are capable of inhibiting a variety of aurora kinases, these inhibitors are generally more potent inhibitors of a certain class of aurora kinase. In the present invention, such an inhibitor having the greatest inhibition of human aurora kinase B is referred to as an aurora kinase B inhibitor, an inhibitor having the greatest inhibition of human aurora kinase C is referred to as an aurora kinase C inhibitor, and an inhibitor having the greatest inhibition of human aurora kinase a is referred to as an aurora kinase a inhibitor. Thus, it is preferred to use the aurora kinase a mutant protein or mutant nucleic acid in combination with an aurora kinase a inhibitor or in the form of a pharmaceutical composition, to use the aurora kinase B mutant protein or mutant nucleic acid in combination with an aurora kinase B inhibitor or in the form of a pharmaceutical composition, and to use the aurora kinase C mutant protein or mutant nucleic acid in combination with an aurora kinase C inhibitor or in the form of a pharmaceutical composition. It is well known in the art that the above-mentioned drugs can be combined with various excipients to prepare pharmaceutical compositions. Excipients for the preparation of pharmaceutical compositions are also well known in the art.

Because the human aurora kinase mutant protein of the present invention can have a sensitization effect on the anti-tumor drugs of the aurora kinase inhibitor class, if the patient has endogenous human aurora kinase mutant protein or mutant nucleic acid of the present invention, the patient can be predicted to be sensitive to the anti-tumor drugs of the aurora kinase inhibitor class, and the tumor can be effectively treated by using the drugs. The present invention thus relates to a method for predicting the response of a patient to treatment with an anti-neoplastic drug of the human aurora kinase inhibitor type, characterized in that it comprises the steps of:

(c) If the assay in (a) determines that the human aurora kinase mutant protein is expressed in a patient sample and/or the assay in (b) determines that the human aurora kinase mutant nucleic acid is present in a patient sample, the patient responds to treatment with a dry human aurora kinase inhibitor-like anti-tumor drug. Therefore, the patient may have better therapeutic effect on the use of the aurora kinase inhibitor anti-tumor drug. Techniques for determining whether to express such a human aurora kinase mutant protein in a patient are well known in the art, such as, but not limited to, extracting a protein from a tissue of a patient, performing western blot hybridization by an antibody or antigen-binding fragment thereof that binds to an aurora kinase mutant protein but does not bind to an aurora kinase wild-type protein, or an antibody or antigen-binding fragment thereof that binds to an aurora kinase mutant protein, or preparing a tissue slice from a sample of a patient, and then performing in situ hybridization using an antibody or antigen-binding fragment thereof that binds to an aurora kinase mutant protein but does not bind to an aurora kinase wild-type protein, or an antibody or antigen-binding fragment thereof that binds to an aurora kinase mutant protein, or the like. Techniques for determining the presence or absence of the human aurora kinase mutant nucleic acid in a sample from a patient are also well known in the art, such as, but not limited to, designing and synthesizing a pair of primers upstream and downstream of the nucleotide encoding K85 and K87, PCR amplifying DNA material extracted from a patient sample using the synthesized pair of primers, sequencing the amplified nucleotide sequence to determine the presence or absence of the mutant nucleic acid of the present invention in the sample, or designing and synthesizing probes for the positions of the nucleotide encoding K85 and K87, southern blot hybridization of DNA material extracted from a patient sample using the synthesized probes to determine the presence or absence of the mutant nucleic acid of the present invention in the sample.

Since the discovery of aurora kinase as an anti-tumor therapeutic target, many researchers have been developing and screening inhibitors of aurora kinase as anti-tumor drugs, but the developed inhibitors of aurora kinase cannot be applied to clinic because of great toxic and side effects caused by high dosage. Because the human aurora kinase mutant protein or mutant nucleic acid of the present invention is capable of the above-described synergistic effect with an aurora kinase inhibitor, these aurora kinase inhibitors having toxic side effects are expected to be used as a drug in cooperation with the human aurora kinase mutant protein or mutant nucleic acid of the present invention at a lower dose or to be used at a lower dose for patients carrying the mutant protein or mutant nucleic acid of the present invention.

The invention also relates to a method for screening candidate drugs for treating tumors, which is characterized by comprising the following steps of: the method comprises the following steps:

(d) If the cell proliferation rate of the test cell group is less than the cell proliferation rate of the control cell group, the drug tested is selected for use as a candidate drug for treating the tumor. Wherein the cells used can be determined by one skilled in the art on the basis of routine procedures in the art. Determination of the proliferation rate of cells is also well known in the art, for example, a bench blue staining method, a colony formation method, a 3H radioisotope incorporation method, an MIT method, a CCK8 cell activity assay, and the like.

Aurora kinase inhibitors developed in the art, and their specificity for various aurora kinases and the disease categories treated, include:

CYC-116, CAS number 693228-63-6, is a potent inhibitor of aurora kinases A and B, with Ki values of 8 and 9nM, respectively. Cyclacel Pharmaceuticals company clinical trials are used to treat solid tumors.

Aurora kinase a inhibitor 2 (Aurora A inhibitor), CAS No. 2412144-74-0, is a potent aurora kinase a inhibitor with an IC50 of 21.94nM. It induces caspase-dependent apoptosis in MDA-MB-231 cells.

Tazasertib (Tozasertib, VX-680, MK-0457, VX 6), CAS number 639089-54-6 is an aurora kinase A/B/C inhibitor, and Ki values for aurora kinases A, B and C are 0.6, 18, 4.6nM, respectively. The effect on the aurora kinase A is strongest, the effect on the aurora kinase B/C is weaker, and the selectivity on the aurora kinase A is 100 times higher than that of other 55 kinds of kinases. Merck Sharp & Dohme company clinical trial is used to treat leukemia, non-small cell lung cancer, colorectal cancer, chronic myelogenous leukemia.

Aurora kinase-IN-2 (Aurora Kinases-IN-2, compound 12 Aj), CAS number 2241914-86-1, is a potent Aurora kinase inhibitor with IC50 values of 90 and 152nM for Aurora Kinases A and B, respectively.

SCH-1473759, chemical name 1-propanol, 2- [ ethyl [ [5- [ [ 6-methyl-3- (1H-pyrazol-4-yl) imidazo [1,2-a ] pyrazin-8-yl ] amino ] -3-isothiazole ] methyl ] amino ] -2-methyl, CAS No. 1094069-99-4, is a multi-target aurora kinase inhibitor, with IC50 values of 4 and 13nM for aurora kinases A and B, respectively.

TAK-901, CAS number 934541-31-8, is a multi-targeted aurora kinase inhibitor with IC 50's of 21 and 15nM for aurora kinases A and B, respectively. Millennium Pharmaceuticals the company clinical trials are used to treat malignant tumors of the blood system, including acute myelogenous leukemia, acute lymphoblastic leukemia, chronic myelogenous leukemia, multiple myeloma, myelodysplastic syndrome, waldenstrom's macroglobulinemia, myeloid fibrosis, myeloid metaplasia, non-hodgkin's lymphoma, etc., and solid tumors.

MLN8054, chemical name (4- [ [ 9-chloro-7- (2, 6-difluorophenyl) -5H-pyrimido [5,4-d ] [2] benzazepin-2-yl ] amino ] benzoic acid, CAS number 869363-13-3, is a highly potent, selective, orally active aurora kinase A inhibitor with an IC50 value of 4nM, is used in a phase I clinical trial of company Millennium Pharma for the treatment of breast, colon, pancreatic, bladder, progressive malignancies, with 40-fold higher selectivity for aurora kinase A than aurora kinase B.

KW-2449, chemical name [4- [2- (1H-indazol-3-yl) vinyl ] phenyl ] -1-piperazinylmethanone, CAS number 1000669-72-6, multi-target kinase inhibitor, IC50 values for FLT3, ABL, ABLT315I and aurora kinase of 6.6, 14, 4 and 48nM, respectively. Kyowa Kirin, inc. was developed for the treatment of leukemia, stage I clinical.

Reversine (CAS number 656820-32-5), an ATP-competitive aurora kinase inhibitor, acts on aurora kinases A, B and C with IC50 of 400, 500 and 400nM, respectively.

TAK-901, chemical name 5- [3- (ethylsulfonyl) phenyl ] -3, 8-dimethyl-N- (1-methyl-4-piperidinyl) -9H-pyrido [2,3-B ] indole-7-carboxamide, CAS number 934541-31-8, is a multi-target aurora kinase inhibitor with IC50 values for aurora kinases A and B of 21 and 15nM, respectively.

Aurora kinase inhibitor-2 (Aurora kinase inhibitor-2), CAS number 331770-21-9, is a selective ATP-competing aurora kinase inhibitor with IC 50's of 310nM and 240nM for aurora kinases A and B, respectively.

Aurora kinase a inhibitor 1 (Aurora A inhibitor), CAS No. 2677799-04-9, is a potent and selective inhibitor of aurora kinase a.

MK-5108 (VX-689), CAS number 1010085-13-8, is a highly potent and specific aurora kinase A inhibitor with an IC50 value of 0.064nM. The selectivity of the aurora kinase A acting on the aurora kinase B/C is 220 times and 190 times higher. Merck Sharp & Dohme company clinical trial was used to treat tumors.

Tripolin A ((E) -Tripolin A), chemical name (3E) -3- [ (2, 5-dihydroxyphenyl) methylene ] -1, 3-dihydro-2H-indol-2-one, CAS number 1148118-92-6, is a specific non-ATP-competitive aurora kinase A inhibitor with IC 50's for aurora kinases A and B of 1.5. Mu.M and 7. Mu.M, respectively.

AT9283, chemical name 1-cyclopropyl-3- (3- (5- (morpholinomethyl) -1H-benzo [ d ] imidazol-2-yl) -1H-pyrazol-4-yl) urea, CAS number 896466-04-9, is a multi-target kinase inhibitor effective in inhibiting aurora kinase A, aurora kinase B, JAK, JAK2 and Abl, IC50 is 3nM, 1.1nM, 1.2nM and 4nM, respectively. Cancer Research UK clinical trial for treatment of hematological malignancies: leukemia, multiple myeloma, solid tumor, acute myelogenous leukemia, acute lymphoblastic leukemia, chronic myelogenous leukemia, myelodysplastic syndrome, myeloid fibrosis, myeloid metaplasia, non-hodgkin's leukemia.

ZM-447539, chemical name N- [4- [ [ 6-methoxy-7- [3- (4-morpholino) propoxy ] -4-quinazolinyl ] amino ] phenyl ] benzamide, CAS No. 331771-20-1, is an aurora kinase inhibitor with IC50 values of 110 and 130nM for aurora kinases A and B, respectively.

Phthalazinone pyrazole (Phthalazinone pyrazole), CAS number 880487-62-7, is an effective, selective, orally active aurora kinase A inhibitor with an IC50 of 0.031. Mu.M.

Tinengtinib, CAS No. 2230490-29-4, is a modulator of one or more protein kinases, and can modulate aurora kinase and VEGFR kinase.

AMG 900, CAS number 945595-80-2, is a potent and selective pan-Aurora inhibitor acting on Aurora kinases A, B and C with IC50 of 5nM, 4nM and 1nM, respectively. Clinical trials by Amgen corporation are used to treat malignant tumors, myelogenous leukemia, solid tumors of the blood system.

Alisertib (Alisertib, MLN 8237), CAS number 1028486-01-2, is a selective aurora kinase a inhibitor with an IC50 of 1.2nM, acting on aurora kinase a is more than 200-fold more selective than acting on aurora kinase B. Millennium Pharma and the like are used in clinical trials for the treatment of metastatic breast cancer, childhood solid tumors (excluding CNS), prostate cancer, lymphomas, lung cancer (metastatic and recurrent non-small cell lung cancer, small cell lung cancer), mesothelioma, cd30+ lymphoma, cd30+ solid tumors, recurrent/refractory lymphomas, diffuse large B-cell lymphomas, mantle cell lymphomas, burkitt lymphomas, T cell lymphomas, B-cell lymphomas, multiple myeloma, transformed follicular lymphomas, ovarian cancer, fallopian tube tumors, peritoneal cancer, waldenstrom's macroglobulinemia, head and neck squamous cell carcinoma, gastroesophageal adenocarcinoma, myelofibrosis, melanoma, neuroblastoma, bladder cancer, pancreatic tumors, adult interstitial astrocytomas, adult giant cell glioblastomas, acute myelogenous leukemia, acute lymphocytic leukemia, myxofibrosarcoma, smooth muscle tumors, liposarcoma, soft tissue sarcoma, malignant peripheral nerve sheath tumors, undifferentiated multiforme sarcoma, uterine sarcoma, colon carcinoma, colorectal cancer, rectal cancer, gene mutation of the liver tumor, renal cell carcinoma, fibromatosis, and the like.

Alisertib sodium (MLN 8237 sodium), CAS number 1028486-06-7, a selective aurora kinase a inhibitor (ic50=1.2 nM) that binds to aurora kinase a, resulting in abnormal mitotic spindle and mitotic accumulation. Has entered phase III clinical stage for peripheral T cell lymphomas.

PF-03814735, chemical name N- [2- [ (1S, 4R) -6- [ [4- (cyclobutylamino) -5- (trifluoromethyl) -2-pyrimidine ] amino ] -1,2,3, 4-tetrahydronaphthalen-1, 4-amidin-9-yl ] -2-oxoethyl ] acetamide, CAS No. 942487-16-3, is an inhibitor of potent reversible aurora kinases A and B, with IC50 values of 0.8 and 5nM, respectively. Phase II clinical trials of Pfizer corporation were used to treat solid tumors.

Aurora inhibitor 1 (Aurora inhibitor 1), CAS number 2227019-45-4, is an effective Aurora inhibitor, with IC 50's for inhibition of Aurora kinases A and B being less than or equal to 4nM and less than or equal to 13nM, respectively.

NU6140, CAS number 444723-13-1, has potent aurora kinase A and B inhibitory activities with IC50 values of 67 and 35nM, respectively. Has antitumor effect.

Aurora kinase inhibitor 3 (Aurora Kinase Inhibitor), CAS number 879127-16-9, is an effective, selective aurora kinase A inhibitor with an IC50 of 42nM while weakly inhibiting EGFR with an IC50> 10. Mu.M.

TC-A2317 hydrochloride, CAS number 1245907-03-2, is an orally active aurora kinase A inhibitor (Ki=1.2 nM). TC-A2317 hydrochloride has a Ki of 101nM for aurora kinase B.

GSK-1070916, chemical name N' - [4- [4- [2- [3- [ (dimethylamino) methyl ] phenyl ] -1H-pyrrolo [2,3-B ] pyridin-4-yl ] -1-ethyl-1H-pyrazol-3-yl ] phenyl ] -N, N-dimethylurea, CAS No. 942918-07-2, is a selective ATP-competing aurora kinase B/C inhibitor with an IC50 of 3.5nM/6.5nM and Ki values of 0.38/1.5nM,Cancer Research UK, respectively, for use in a company clinical trial for the treatment of solid tumors.

AS-703569 (Cenisertib, MSC 1992371A), CAS number 871357-89-0 is a multi-kinase inhibitor that inhibits the activity of aurora kinases A/B, ABL1, AKT, STAT5, FLT 3. Cenisertib inhibits the growth of tumor Mast Cells (MC) by inhibiting their activity of several different molecular targets. Cenisertib inhibits tumor growth of pancreatic, breast, colon, ovarian and lung cancers and leukemia in xenograft models.

LY3295668 (AK 01, erbumine), CAS No. 1919888-06-4, is a highly specific inhibitor of aurora kinase A, with Ki values of 0.8nM and 1038nM for aurora kinase A and B, respectively. Eli Lilly and Company company clinical trials are used to treat metastatic breast cancer.

Aurora kinase inhibitor-9 (Aurora kinase inhibitor-9, compound 9 d), CAS number 2419107-09-6, is a potent aurora kinase A/B dual inhibitor with IC50s of 0.093 and 0.09 μm for aurora kinases A and B, respectively. Aurora kinase inhibitor-9 has broad spectrum antiproliferative activity.

CCT241736, CAS No. 1402709-93-6, is a potent dual inhibitor of FLT3 and aurora kinase, and is capable of effectively inhibiting the activity of aurora kinase A (Kd 7.5nM, IC50 38 nM), aurora kinase B (Kd 48 nM), FLT3 (Kd 6.2 nM) and FLT3 mutants FLT3-ITD (Kd 38 nM) and FLT3 (D835Y) (Kd 14 nM).

Derrone, CAS number 76166-59-1, is an isoflavone propofol, an aurora kinase inhibitor, with IC50 values of 6 and 22.3. Mu.M for aurora kinases B and A, respectively. Has antitumor activity.

Up to Lu She (Danusertib, PHA-739358), CAS No. 827318-97-8 is an aurora kinase inhibitor capable of inhibiting the activity of aurora kinases A, B and C with IC50 values of 13, 79 and 61nM, respectively. The nervia medical science and the university of california machine division Jonsson integrated cancer center clinical trial were used to treat leukemia, prostate cancer, multiple myeloma.

ABT-348 (Iloraertib), CAS No. 1227939-82-3, is a ATP-competitive multi-target inhibitor capable of inhibiting the activity of aurora kinase B/C/A, RET tyrosine kinase, PDGFRbeta and Flt1 with IC50 values of 7nM, 1nM, 120nM, 7nM, 3nM and 32nM, respectively.

ABT-348 hydrochloride (Ilorasertib hydrochloride), CAS No. 1847485-91-9, is an effective, ATP-competitive, multi-target kinase inhibitor that inhibits the activity of aurora kinases C, B and A with IC50 values of 1nM, 7nM and 120nM, respectively. ABT-348 hydrochloride inhibited RET, PDGFRbeta and Flt1 activities simultaneously, with IC50 values of 7nM, 3nM and 32nM, respectively. Phase II clinical phase has been entered.

SNS-314, chemical name N- (3-chlorophenyl) -N '- [5- [2- (thieno [3,2-D ] pyrimidin-4-ylamino) ethyl ] -2-thiazolyl ] urea, CAS number 1057249-41-8, is a potent selective aurora kinase inhibitor with IC 50's of 9, 31 and 6nM for aurora kinases A, B and C, respectively. Sunesis Pharmaceuticals company clinical trials are used to treat solid tumors.

Aurora kinase inhibitor-10 (Aurora kinase inhibitor-10, compound 6 c), CAS number 2417228-90-9, is an orally active aurora kinase B inhibitor with an IC50 of 8nM. Aurora kinase inhibitor-10 shows anti-tumor activity.

ENMD-2076, chemical name 6- (4-methyl-1-piperazinyl) -N- (5-methyl-1H-pyrazol-3-yl) -2- [ (1E) -2-styryl ] -4-pyrimidinamine, CAS number 934353-76-1, is a multi-target kinase inhibitor with IC50 values of 1.86, 14, 58.2, 15.9, 92.7, 70.8, 20.2 and 56.4nM for inhibition of aurora kinase A, flt, KDR/VEGFR2, flt4/VEGFR3, FGFR1, FGFR2, src, PDGFRα, respectively. The selectivity of the aurora kinase A acting on the aurora kinase B is 25 times higher. CASI Pharmaceuticals clinical trials are used to treat ovarian cancer, soft tissue sarcoma, hepatocellular carcinoma, breast cancer, fallopian tube cancer, peritoneal cancer, multiple myeloma.

CD532, CAS number 1639009-81-6, is a potent aurora kinase A inhibitor with an IC50 of 45nM. CD532 has the dual effects of blocking aurora kinase A activity and promoting MYCN degradation.

Hesperadin, chemical name N- [ (3Z) -2-oxo-3- [ phenyl- [4- (piperidine-1-methyl) aniline ] methylene ] -1H-indol-5-yl ] ethanesulfonamide, CAS number 422513-13-1, is an ATP-competitive aurora kinase B inhibitor with an IC50 value of 250nM.

AZD1152 (balaseertib), chemical name 5- [ [7- [3- [ ethyl [2- (phosphoryloxy) ethyl ]]Amino group]Propoxy group]-4-quinazolinyl]Amino group]-N- (3-fluorophenyl))-1H-pyrazole-3-acetamide, CAS number 722543-31-9, a prodrug of Barasertib-HQPA, a highly selective aurora B inhibitor with an IC50 value of 0.37nM. The AstraZeneca company clinical trial was used to treat acute myelogenous leukemia, diffuse large B-cell lymphoma, solid tumors, and small cell lung cancer.

AZD2811 (balasetil-HQPA barasentib-HQPA), CAS number 722544-51-6, is a highly selective aurora kinase B inhibitor with an IC50 value of 0.37nM and a 3700 times selectivity to aurora kinase B as compared with aurora kinase A. Can cause growth retardation and apoptosis of cancer cells. The AstraZeneca company clinical trial was used to treat acute myelogenous leukemia, diffuse large B-cell lymphoma, solid tumors, and small cell lung cancer.

AAPK-25, CAS number 2247919-28-2, is an effective selective aurora kinase/PLK kinase dual inhibitor, and has anti-tumor activity. AAPK-25 targets aurora kinases A, B and C with Kd values of 23nM-289nM and PLK-1, -2, -3 with Kd values of 55-456nM.

CCT129202, CAS No. 942947-93-5, are aurora kinase inhibitors with IC50 values for aurora kinases A, B and C of 42, 198 and 227nM, respectively.

CCT-137690, CAS number 1095382-05-0, is a potent, orally active aurora kinase inhibitor with IC50 values for aurora kinases A, B and C of 15, 25 and 19nM, respectively.

Chiauranib, targeted aurora kinase B, VEGFR/PDGFR/c-Kit, CSF-1R, shenzhen micro-core Biotechnology Co., ltd. Clinical trials are used to treat non-Hodgkin's lymphoma, ovarian cancer, small cell lung cancer and hepatocellular carcinoma.

JNJ-7706621, CAS No. 443797-96-4, is a potent aurora kinase inhibitor and is effective in inhibiting CDK1 and CDK2, and has IC50 values of 9nM, 3nM, 11nM and 15nM for CDK1, CDK2, aurora kinases A and B, respectively.

MK-8745, CAS number 885325-71-3, is an inhibitor of aurora kinase A with an IC50 value of 0.6nM.

PHA-680632, CAS No. 398493-79-3, is an aurora kinase inhibitor with IC50 values for aurora kinase A, B and C of 27, 135 and 120nM, respectively.

TC-S7010, CAS number 1158838-45-9, is a potent and highly selective aurora kinase A inhibitor with an IC50 value of 3.4nM.

BI-847325, CAS number 1207293-36-4, is a dual ATP-competitive inhibitor of MEK and aurora kinase A/B/C with IC50 values of 4 and 15nM for human MEK2 and aurora kinase C, respectively. Boehringer Ingelheim company clinical trials are used to treat solid tumors.

BI-831266, CAS number 958227-46-8, is a potent and selective inhibitor of aurora kinase B, has an IC50 of 42nM, inhibits proliferation of human non-small cell lung carcinoma (NSCLC), pancreatic and prostate cancer cell lines (H460) tumor cell proliferation inhibition IC50=11 nM), and causes tumor regression and growth inhibition in murine xenograft tumor models (HCT 116 colon carcinoma, bxPC3 pancreatic carcinoma and NCI-H460 NSCLC). Clinical trials are used to treat solid tumors.

BI-811283, aurora kinase B inhibitor, IC50 9nM, has entered phase II clinical stage.

TAS-119 is a potent, selective, orally active aurora kinase A inhibitor with an IC50 of 1.0nM. TAS-119 is more selective for aurora kinase A than other protein kinases, including aurora kinase B (IC 50 of 95 nM). TAS-119 has potent antitumor activity.

JAB-2000, a selective aurora kinase A inhibitor, is in the preclinical evaluation stage and is intended to be developed for the treatment of various RB1 deficient patients with advanced solid tumors.

ViC-1911, aurora kinase A inhibitor of Jiesida medical technology Co., ltd, and has the indication of advanced non-small cell lung cancer.

JS112 (WJS 05129), an aurora kinase A inhibitor of Suzhou Junz biological medicine Co., ltd.

JAB-2485, a high-selectivity small molecule aurora kinase A inhibitor developed by Beijing Gakesi New drug development Co., ltd, has an inhibition activity to aurora kinase A which is thousands times higher than that to aurora kinase B. JAB-2485 can inhibit aurora kinase A activity at cellular level, induce apoptosis, inhibit tumor growth, and has good anti-tumor activity. In 2022, month 1 and 17, JAB-2485 filed a clinical trial with new drugs in the united states, and will develop a clinical trial in the united states of stage I/IIa against a variety of advanced solid tumors.

Furthermore, studies have shown that expression of aurora kinase is associated with the development of various cancers, such as ovarian, pancreatic, breast, colon cancers. Thus, the aurora kinase family is considered as an attractive target for anticancer therapy. Aurora kinase B is expressed in high frequency in various tumors such as breast cancer, non-small cell lung cancer, prostatic cancer, glioblastoma, thyroid cancer, diffuse large B lymphoma, burkitt lymphoma, hodgkin lymphoma and the like, and plays an important role in a plurality of links of tumorigenesis, development, metastasis and drug resistance. Aurora kinase a is detected to have higher expression in colon cancer, breast cancer, ovarian cancer, gastric cancer and pancreatic cancer , and abnormality of aurora kinase a may have a certain correlation with pathological characteristics of malignant tumor, clinical stage and prognosis.

Thus, the aurora kinase inhibitors and tumor types described above may be used in the practice or in the application of the present invention. Specifically, aurora kinase inhibitors include CYC-116, aurora kinase A inhibitor 2, tozasertib, aurora kinase-IN-2, SCH-1473759, TAK-901, MLN8054, KW-2449, reversible, TAK-901, aurora kinase inhibitor-2, aurora kinase A inhibitor 1, MK-5108, tripolin A, AT9283, ZM-4477439, phthalazinone pyrazole, tinengotinib, AMG, alisertib sodium, PF-03814735, aurora kinase inhibitor 1, NU6140, aurora kinase inhibitor 3, TC-A2317 hydrochloride, GSK-1070916, AS-703569, LY3295668, aurora kinase inhibitor-9, CCT241736, derrone, darout Lu She, ABT-348 hydrochloride, SNS-314, aurora kinase inhibitor-10, ENMD-2076, CD532, hesperadin, AZD, AZD2811, CCT-28125, CCT-26, JA Chiauranib, JNJ-3745, JA-3765, JA-3745, JA-3735, JA-37B-37, and JA-37-35. Tumor types include hematological malignancies (including leukemia, myelogenous leukemia, acute myelogenous leukemia, multiple myeloma, acute lymphoblastic leukemia, chronic myelogenous leukemia, myelodysplastic syndrome, myelogenous fibrosis, myelogenous metaplasia, hodgkin's lymphoma, non-hodgkin's leukemia, non-hodgkin's lymphoma, cd30+ lymphoma, relapsed/refractory lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, burkitt lymphoma, T-cell lymphoma, B-cell lymphoma, transformed follicular lymphoma, peripheral T-cell lymphoma, waldenstrom's macroglobulinemia), solid tumors, breast tumors (including but not limited to breast cancer, metastatic breast cancer), colon tumors (including but not limited to colon cancer, colon cancer colorectal cancer, rectal cancer), pancreatic tumors (including but not limited to pancreatic cancer), bladder tumors (including but not limited to bladder cancer), prostate cancer, lung cancer (including but not limited to non-small cell lung cancer, metastatic and recurrent non-small cell lung cancer, advanced non-small cell lung cancer), mesothelioma, ovarian cancer, fallopian tube tumors (including but not limited to fallopian tube cancer), hepatocellular carcinoma, peritoneal cancer, head and neck squamous cell carcinoma, gastroesophageal adenocarcinoma, myelofibrosis, melanoma, neuroblastoma, adult mesenchymal astrocytomas, adult giant glioblastoma, myxofibrosarcoma, smooth myoma, liposarcoma, soft tissue sarcoma, malignant peripheral nerve sheath tumor, undifferentiated polymorphic sarcoma, uterine sarcoma, colonic myxoadenoma, rectal myxoma, hepatoblastoma, pediatric rhabdomyoma, pediatric renal tumor, soft tissue sarcoma, thyroid cancer, and gastric cancer.

In addition, since the mutation sites K85 and/or K87 of the present invention may be possibly lost due to the inability to ubiquitinate, steric hindrance may be eliminated, and the mutation sites may be involved in binding with an aurora kinase inhibitor, the present invention also relates to an aurora kinase inhibitor designed or selected based on the mutation sites K85 and/or K87 of the present invention. The aurora kinase inhibitor thus designed or selected is characterized in that its binding affinity to the human aurora kinase mutant protein of the present invention is higher than its binding affinity to the corresponding human aurora kinase wild-type protein, for example, its binding affinity to the aurora kinase B mutant protein of the present invention is higher than its binding affinity to the aurora kinase B wild-type protein, its binding affinity to the aurora kinase C mutant protein of the present invention is higher than its binding affinity to the aurora kinase C wild-type protein, and its binding affinity to the aurora kinase a mutant protein of the present invention is higher than its binding affinity to the aurora kinase a wild-type protein. In the present application, the wild-type protein refers to a protein in which mutations at the K85 and K87 positions have not occurred. Binding force determination methods are well known in the art and include, but are not limited to, affinity chromatography, chemical probe techniques, drug-target protein complex stability detection techniques, and computer simulation techniques, among others.

The invention is further illustrated by the following specific examples and figures, which are illustrative and do not constitute a limitation on the technical solutions of the invention as claimed.

Example 1: k63 ubiquitination modification of aurora kinase B

Ubiquitination of K63 connection type is a common non-degradation ubiquitination modification, and is involved in various physiological processes of cells such as DNA damage repair, protein transport and immune response by changing the stability of target protein, influencing the positioning and activity of the target protein and the like. K63-type ubiquitination modifications also play an important role in mitosis. To explore the effect of K63 ligation type ubiquitination modification on aurora B function, the present inventors used the co-immunoprecipitation technique to verify whether aurora B was present in HeLa cells in the presence of K63 ligation type ubiquitination modification.

Because aurora kinase B is specifically and highly expressed in the M phase, the cell cycle synchronization treatment is carried out on the cells in the experiment. First, after growing HeLa cells for 16 hours, heLa cells were treated with 30ng/mL Nocodazole (purchased from Sigma) for 14 hours, the cells were synchronized to the mitosis phase, and then eluted and released for 20 minutes, and the metaphase cells were collected. Endogenous IP experiments were then performed with an antibody to aurora B (from Cell Signaling Technology, cat 3094S) and Western Blot detection was performed on the co-immunoprecipitates with an antibody specifically recognizing the K63 ubiquitin chain (from Cell Signaling Technology, cat 5621S), the results of which are shown in fig. 1. As shown, a distinct ubiquitination band was detected in immunoprecipitates of aurora B antibodies, suggesting that ubiquitination modification of the K63 type exists in the mitotic phase of aurora B endogenous to the cell.

For further validation, the inventors used two sets of mutant plasmids of ubiquitin molecules, HA-K48-Ub or HA-K63-Ub and HA-Ub-K48R or HA-Ub-K63R, to detect the ubiquitinated modification type of aurora kinase B during mitosis under denaturing conditions. In the HA-K48-Ub plasmid, ubiquitin molecules only retain lysine 48 and other lysine residues are all mutated to arginine. In the HA-K63-Ub plasmid, ubiquitin molecules only retain lysine 63 and other lysine residues are all mutated to arginine. In the HA-Ub-K48R plasmid, the 48 th lysine of ubiquitin molecule is mutated into arginine, and other lysine sites are reserved. In the HA-Ub-K63R plasmid, the 63 rd lysine of ubiquitin molecule is mutated into arginine, and other lysine sites are reserved.

Construction of plasmid HA-Ub: the gene sequence of ubiquitin molecule Ub refers to the gene sequence of Pubmed gene library, and the design of the primer is carried out by using software Oligo 7.0. The construction of HA-K48-Ub, HA-K63-Ub and HA-Ub-K48R, HA-Ub-K63R adopts site-directed mutagenesis technology to mutate the corresponding K site, and the mutation primers are as follows:

K48R-F	TGCTGGGAAACAGCTGGAAGATGGACGCAC
		K48R-R	AGCTGTTTCCCAGCAAAGATCAACCTCTGC
K63R-F	CATCCAGAAAGAGTCCACCCTGCACCTG
		K63R-R	GACTCTTTCTGGATGTTGTAGTCAGACAGGG
K48-F	TGCTGGGAAACAGCTGGAAGATGGACGCAC
		K48-R	AGCTGTTTCCCAGCAAAGATCAACCTCTGC
K63-F	CATCCAGAAAGAGTCCACCCTGCACCTG
		K63-R	GACTCTTTCTGGATGTTGTAGTCAGACAGGG

the full-length cDNA amplified by PCR was subcloned into the plasmid pcDNA3.1-HA. Phusion DNA polymerase used in PCR and T4DNA ligase used in molecular cloning were purchased from TOYOBO Co., japan.

The construction of the plasmid will be described in detail below by taking V5-His-Aurora B as an example. Construction of V5-His-Aurora B plasmid: referring to the nucleic acid sequence of Aurora B of nm_001313950.2, primer design was performed using software Oligo 7.0, the primer sequence was as follows:

His-Aurora B-F CCCAAGCTTGCCACCATGGCCCAGAAGGAGAACT CCTACC

His-Aurora B-R CGGGATCCGGCGACAGATTGAAGGGCAGAG

obtaining a target fragment: template amount: cDNA is less than or equal to 200ng,Plasmid DNA and less than or equal to 50ng, and the reaction system is as follows:

the reaction procedure was as follows:

and taking a proper amount of products for electrophoresis verification. The fragment product of interest was cleaned with a PCR cleaning kit and the concentration of the recovered product was determined.

And (3) carrier enzyme cutting: the corresponding endonuclease is selected to cut the carrier, and the reaction system is as follows:

and (3) carrying out electrophoresis verification on the enzyme-digested carrier, recovering by using a DNA gel recovery kit, and measuring the concentration.

And (3) connection: the target fragment and the digestion vector are connected by using a seamless cloning kit, and the reaction system is as follows:

conversion: mixing the connection product with competent cells uniformly, applying ice for 30min, heat-shock for 90s at 42 ℃, and standing on ice for 5min. The transformed competent cells were added to 1mL of LB liquid medium and activated for 45 min at 180rpm on a constant temperature shaker at 37 ℃. 3000g of activated competent cells, centrifuging for 3min, discarding supernatant, re-suspending the bacterial liquid, coating onto LA solid culture plates, and culturing in a constant temperature incubator at 37 ℃. After 14h, the monoclonal was picked and grown up. The plasmids were submitted to sequencing and identification.

Over-expressing V5-His-Aurora B plasmid and wild HA-Ub or mutant HA-K48-Ub or HA-K63-Ub in 293T cells, collecting metaphase cells, and carrying out Ni-NTA pull-down experiment under denaturing conditions, wherein the specific Ni-NTA pull-down experiment steps are as follows:

cells transfected with His-tagged plasmids were sonicated on ice with 8mol/L urea Lysis Buffer B (8M urea, 100mM NaH2PO4,10mM Tris-Cl pH 8.0,25mM imidazole, supplemented with protease inhibitor (P8340) and phosphatase inhibitor (Selleck)). About 1mg of protein was taken, and 20. Mu.L of Ni-NTA agaros was added thereto and bound at 4℃for about 4 hours. The supernatant was centrifuged off and agaros was washed by adding 8mol/L urea Lysis Buffer C (8M urea, 100mM NaH2PO4,10mM Tris-Cl (pH 6.3), 25mM imidazole). The residual liquid was sucked off, 8mol/L urea Lysis Buffer E (8M urea, 100mM NaH2PO4,10mM Tris-Cl (pH 4.0), 250mM imidazole) was added, the tube wall was gently stirred, the supernatant was centrifuged and eluted 1 time repeatedly. The resulting samples were separated by SDS-PAGE and Western blotting detected the corresponding proteins.

The results of the Ni-NTA pull-down experiment are shown in FIG. 2. The results show that ubiquitination modification of aurora kinase B is significantly enhanced in the experimental group transfected with HA-K63-UbIt was shown that aurora B can undergo polyubiquitination modification of the K63 ligation type in the metaphase of mitosis. Furthermore, it is noted that when the K63-linked ubiquitination modification of Aurora B is enhanced, the level of phosphorylation of Aurora B (Aurora B-pT232, wherein T232 is the 232 th threonine referenced in the sequence shown by sequence reference number np_001300879.1 of Aurora B variant 1) is also significantly enhanced. Whereas in the experimental group transfected with HA-K48-Ub, the ubiquitination modification of aurora kinase B was not significantly enhanced. Previous studies have shown that the type of ubiquitination modification mediated by the mitotic phase for aurora kinase B degradation is mainly determined by APC/C ^Cdh1 The type of polyubiquitination modification of K11 ligation that occurs catalytically explains why retention of only lysine at position K48 in ubiquitin molecules results in a non-significant enhancement of ubiquitination.

Then, similar denaturation experiments are carried out by utilizing HA-Ub-K48R or HA-Ub-K48R, V5-His-Aurora B and wild HA-Ub or HA-Ub-K48R mutant or HA-Ub-K63R mutant are overexpressed in 293T cells, after Nocodazole treatment, the cells in the division period are collected and subjected to Ni-NTA pull-down experiments under the denaturation conditions, and the specific experimental steps are described above. The experimental results are shown in fig. 3. The results show that in cells transfected with HA-Ub-K63R, the ubiquitination level of aurora kinase B in mitosis is significantly reduced, while in cells transfected with HA-Ub-K48R, the ubiquitination modification of aurora kinase B is not significantly changed. In addition, when the ubiquitination modification of the K63 linkage type of aurora B was decreased, the phosphorylation level of aurora B was also significantly decreased as compared with the wild-type control group (HA-Ub).

Taken together, these experimental results indicate that aurora B is capable of undergoing a K63-linked type of ubiquitination during mitosis, and that the K63-linked ubiquitination of aurora B is positively correlated with its phosphorylation level.

Example 2BRISC Complex modulates the K63-linked ubiquitination level of aurora kinase B

BRCC36 is a deubiquitinase that is capable of specifically hydrolyzing the K63 ubiquitin chain on the target protein. BRCC36 alone is not enzymatically active and, in the cytoplasm, BRCC36 often functions enzymatically by binding its mpn+ domain to the color 1 with MPN-domain to form a BRISC (BRCC 36 isopeptidase complex) complex. As a result of previous work by the inventors, it was found that there was an interaction of the BRISC complex with aurora kinase B and members BRCC36 and Abro1 of the aurora kinase B and BRISC complex were co-localized in centromeres, central spindle and intermediates. Thus, the inventors believe that aurora B may be a substrate for the BRISC complex, which may regulate the level of ubiquitination modification of K63 ligation of aurora B.

To this end, the inventors have verified by denaturing IP experiments whether the BRISC complex is capable of hydrolyzing the K63 ubiquitinated chain of aurora B. Firstly, the following plasmids were constructed: V5-His-Aurora B, HA-K63-Ub and pEYFP-BRCC36 (pEYFP-B36 for short) or pEYFP-BRCC36-QSQ (pEYFP-B36-QSQ for short).

Plasmid V5-His-Aurora B and HA-K63-Ub were constructed as described in example 1.

Construction of plasmid pEYFP-B36: the gene sequence of BRCC36 refers to the gene sequence of the Pubmed gene bank, and the design of the primer is performed by using software Oligo 7.0. Construction of pEYFP-B36-QSQ: site-directed mutagenesis was used to replace histidine at both positions H122 and H124 with glutamine. PCR amplification and cloning conditions are described in example 1.

The plasmid pEYFP-B36-QSQ expresses an enzyme activity mutant of BRCC36, wherein the histidine at the H122 and H124 sites is replaced by glutamine, namely H122Q and H124Q, and the two sites mutate to destroy BRCC36 and Zn ²⁺ The ability to bind, and therefore the enzymatic activity of BRCC36, is greatly reduced.

The plasmids V5-His-Aurora B, HA-K63-Ub and pEYFP-B36 or pEYFP-B36-QSQ constructed above were transiently transfected into 293T cells, so that the encoded proteins were overexpressed in the 293T cells. Cells were synchronized to the dividing phase by Nocodazole treatment at 30ng/mL and the dividing phase cells were collected and subjected to Ni-NTA pull-down experiments under denaturing conditions, the results of which are shown in FIG. 4. As shown in FIG. 4, in the cell transfected with HA-K63-Ub and V5-His-Aurora B simultaneously, aurora B can undergo very strong ubiquitination modification of the K63 linkage type; when pEYFP-B36 is co-transformed, the K63 ubiquitination level of aurora kinase B is obviously reduced; and when the BRCC36 enzyme activity mutant pEYFP-B36-QSQ is co-transformed, the K63 ubiquitination level of aurora kinase B is only partially reduced and is obviously higher than that of a pEYFP-B36 group, which indicates that the deubiquitinase BRCC36 can hydrolyze the K63 connecting ubiquitin chain of aurora kinase B and regulate the ubiquitination level. Aurora kinase B is a substrate for the bric complex.

Example 3BRISC Complex modulates aurora kinase B kinase Activity

The literature shows that the kinase activity of aurora B is related to aurora B self-activation, i.e. phosphorylation of threonine at position 232 of aurora B. The inventors devised experiments to investigate whether knockout of the BRISC complex would affect aurora B protein levels and kinase activity.

The CRISPR/Cas9 technology is first utilized to construct and screen out cell lines of stable knockout Abro1 (Abro 1-KO) or BRCC36 (BRCC 36-KO) in HeLa cells. Two sgrnas of Abro1 were designed, and a LentiCRISPRv2-Abro1-sg1/2 lentiviral plasmid was constructed, virus was packaged, heLa cells were infected, homozygous clones of Abro1-KO were screened by infinite dilution, and a cell line for BRCC36-KO was constructed using the same method.

Construction of Lenigisprv 2-Abro1-sg1/2 lentiviral plasmid:

sgRNA primer design: referring to https:// chopchop. Cbu. Uib. No/website design, primers are as follows:

the Lenigisprv 2 vector was digested with the corresponding restriction endonuclease. The enzyme digestion system is as follows:

37 ℃ for 30min; and (3) carrying out agarose gel electrophoresis on the carrier after enzyme digestion, recovering enzyme digestion fragments by using a kit, and measuring the concentration.

Primer phosphorylation and annealing

And cooling to 25 ℃ at a speed of 5 ℃ per minute at a temperature of 37 ℃ for 30min and 95 ℃ for 5 min. The vector recovered from the digested gel and oligo were ligated using T4 DNA ligase at 16deg.C for 16h in the following ligation system:

10. Mu.L of ligation product was used to transform Stbl3 competent cells. Single bacteria were picked and sequenced.

Lentivirus packaging: HEK-293T cells with cell densities of 80% -90% were used for transfection. 10. Mu.g of the total amount of plasmid (target gene plasmid: 5. Mu.g, pCMV-VSVG: 3. Mu.g, psPAX2: 2. Mu.g) was added to 500. Mu.l of the solution containing Lipofectamine 2000+500. Mu.l of optiMEM to prepare solution I, and after standing at room temperature for 5 minutes, the solution I and solution II were mixed and left at room temperature for 20 minutes, and the mixture was added to cells and cultured in an incubator. After 72h of transfection, the culture supernatant, which is the culture supernatant containing the virus particles, is collected and stored at-80 ℃.

Screening of homozygous clones of Abro1-KO/BRCC 36-KO: supernatants containing LenntiCRISPRv 2Abro1 or LenntiCRISPRv 2 BRCC36 or LenntiCRISPRv 2 control virus particles were added dropwise to HeLa cells, and screened and diluted with medium containing 10mmol/L puromycin, 10-15 cells/10 mm dish. When each clone grows to about 30 cells, adsorbing the cells by using a filter paper sheet, putting the cells into a 96-well plate containing puromycin culture solution, and continuing culturing. Finally, KO effect is identified by Western Blot.

Western Blot was performed using Abro1-KO and BRCC36-KO cell lines and Control cell CT (Control, i.e., cell line containing only empty vector) as described above, and the results are shown in FIG. 5. The results showed that no Abro1 was detected in both Abro1-KO cell lines and BRCC36 protein levels were also significantly reduced, no BRCC36 protein was detected in BRCC36-KO cell lines and protein levels of Abro1 were also significantly reduced, indicating that the knockdown of both cell lines was successful and that knockdown of either Abro1 or BRCC36 protein affected stabilization of other proteins of the BRISC complex. However, there was no difference in protein levels of aurora B in the Abro1-KO and BRCC36-KO cell lines compared to the control cell line, indicating that the absence of Abro1 or BRCC36 did not affect the protein levels of aurora B.

Next, the present inventors examined the phosphorylation levels of aurora kinase B during CT mitosis in Abro1-KO, BRCC36-KO, and control cells by immunofluorescence technique. After the three cells were planted on a slide glass and grown, 30ng/mL of Nocodazole was added for 4 hours, and the elution was released for 25 minutes to perform an Aurora B-pT232 immunofluorescence experiment. For each cell line, 20 cells were randomly selected, three regions were randomly selected for each cell, fluorescence intensity was analyzed with zeiss 880, and then a histogram was made, the results are shown in fig. 6, where ns represents no statistical difference; * Represents p <0.001. The results showed that the fluorescence intensity of Aurora B-pT232 was significantly stronger in Abro1-KO or BRCC36-KO mitotic prophase cells than in control cells, indicating that the absence of the BRISC complex promoted activation of Aurora B, and therefore the BRISC complex regulated kinase activity of Aurora B.

EXAMPLE 4 identification of K63-linked ubiquitination site of aurora kinase B

To investigate deeply the site where K63-linked ubiquitination modification of aurora B occurs, the present inventors carried out the identification of the site of K63-linked ubiquitination modification of aurora B. The sequence of aurora kinase B used below is the sequence shown by sequence reference number np_001300879.1 of aurora kinase B variant 1, and positions K85, K87, K202, K211 and other positions all refer to the positions of the sequence shown by sequence reference number np_ 001300879.1.

Firstly, constructing a plasmid Flag-Aurora B, wherein the specific construction method is as follows: referring to the nucleic acid sequence of Aurora B of nm_001313950.2, the design of primers was performed using software Oligo 7.0, the primer sequences were as follows. The full-length cDNA amplified by PCR was subcloned into the plasmid pcDNA3.1-Flag.

The Flag-Aurora B and His-K63-Ub were transfected in 293T cells, and then immunoprecipitated using anti-Flag-M2 beads, and the immunoprecipitates of Flag-Aurora B were subjected to mass spectrometry, and as a result, positions K85, K87, K202 and K211 were found to be potential K63-type ubiquitination modification sites, and the results are shown in FIG. 7. The conserved sequence analysis was performed at these sites and K202 was found to be highly conserved in higher mammals, the results are shown in FIG. 8. The above results indicate that K202 may be the main ubiquitination site for aurora B.

To further verify whether K85, K87, K202 and K211 are K63 type ubiquitination modification sites, the inventors performed Ni-NTA pull-down experiments. Firstly, constructing a V5-His-Aurora B plasmid, a V5-His-Aurora B-K85/R, V-His-Aurora B-K87/R, V-His-Aurora B-K202/R, V-His-Aurora B-K211R single mutant and a V5-His-Aurora B-K85/87/R, V5-His-Aurora B-K202/211R double mutant plasmid. Construction of V5-His-Aurora B plasmid As described above, construction of each mutant plasmid was performed with a V5-His-Aurora B template using site-directed mutagenesis technique, and primers used in the construction were as follows:

the constructed wild type plasmid or various mutant plasmids are respectively transfected with HA-K63-Ub together to carry out transient over-expression, the cells are treated with 30ng/mL Nocodazole to the middle stage, the cells are collected, ni-NTA pull-down is carried out, western Blot detection is carried out on the products, wherein the HA antibody is used for detecting the K63-Ub, and the V5 antibody is used for detecting the aurora kinase B protein or single and double mutants which are transfected and expressed. As demonstrated in examples 2 and 3 above, the K63-linked ubiquitination modification of aurora B was significantly increased following deletion of the bric complex, suggesting that the K63-linked ubiquitination modification of aurora B may affect the kinase activity of aurora B, with high activation of aurora B kinase. Thus, in this experiment, the phosphorylation of Aurora kinase B was also detected simultaneously, i.e., aurora B-pT232 was detected using an anti-T232 phosphorylated antibody. The results are shown in FIG. 9, where WCL is whole cell lysate and Ni-NTA is the product of using Ni-NTA pull-down.

As can be seen from fig. 9, the level of ubiquitination of cells was significantly reduced after single site K202 and double site mutation of K202/211, whereas mutation of single site K211 did not affect the level of K63 ubiquitination of aurora B, indicating that K202 is the main ubiquitination site of aurora B. The K211 (as in aurora B variant 1) site was also found to be a non-conserved position after multiple sequence alignment analysis for aurora A, B and C in example 9 below, lysine in aurora B and the amino acid arginine R in aurora C and the amino acid alanine a in aurora a, which also demonstrates from another aspect that aurora K211 is not a K63 ubiquitination site. From a steric perspective, the K211 (in position in aurora B variant 1) site is exactly in the hinge, which also reasonably explains why K211 is not the K63 ubiquitination site.

When the K63-linked ubiquitination level of aurora B was reduced (e.g. K202R or K202/211R mutant), the T232 phosphorylation level of aurora B was also significantly reduced, and the total protein level of intracellular aurora B (shown by V5) was not significantly changed in this case. These results indicate that K63 ubiquitination at the K202 position of aurora B promotes activation of aurora B kinase. This example again demonstrates that the ubiquitination modification of the K63 linkage of aurora B is positively correlated with its phosphorylation level, as demonstrated in example 1 above.

Example 5: experiment of the Effect of Aurora B-K85/87 on the kinase Activity of Aurora B

To further verify that K63 ligation of the K85/87 site of aurora B ubiquitination reduced kinase activity of aurora B, the present inventors performed Flag-IP experiments by cells transiently transfected with Flag-HA-Aurora B as well as mutant plasmids.

Flag-HA-Aurora B or Flag-HA-Aurora B-K85R/K87R plasmids were constructed as follows: construction of Flag-HA-Aurora B plasmid As described in example 4, flag-HA-Aurora B-K85R/K87R plasmid was subjected to site-directed mutagenesis on the basis of Flag-HA-Aurora B, and the primer sequences used in site-directed mutagenesis were as follows:

after transient transfection of the cells with Flag-HA-Aurora B and mutant plasmids, 30ng/mL Nocodazole treated the cells to metaphase and the cells were collected for Flag-IP.

The experimental results are shown in FIG. 9. No significant difference in the levels of INCENP and Survivin was detected in the IP product of the Flag-Ha-Aurora B-K85R/87R mutant compared to wild-type Flag-Ha-Aurora B, indicating that the mutation at the K85/87 site did not affect the interaction between Aurora kinase B and the CPC complex members, but that the phosphorylation of Aurora B-pT232 was significantly increased. Demonstrating that Aurora B-K85/87R promotes kinase activity of Aurora kinase B.

In addition, the present inventors purified the Flag-HA-Aurora B and Flag-HA-Aurora B-K85/87R proteins from HeLa cells via Flag-IP, and performed in vitro phosphorylation experiments using histone H3 as a substrate.

The Flag-HA-Aurora B-K85/87R protein was purified as follows. Transient overexpression of Flag-HA-Aurora B or Flag-HA-Aurora B-K85/87R in 293T cells, treatment of cells with 30ng/mL Nocodazole to the medium stage, collection of cells, purification with Flag Beads, SDS-PAGE electrophoresis of partially purified proteins, and silver staining were performed, and the results are shown in FIG. 10.

Purified Flag-Ha-Aurora B or Flag-Ha-Aurora B-K85/87R was then subjected to in vitro phosphorylation with 0.5 μ g H3 at 37℃for 45min, followed by Western Blot detection of Aurora kinase B, H, H3-pS10, aurora B-pT232 using anti-Flag antibody, anti-H3-pS 10 antibody and anti-Aurora B-pT232 antibody, respectively. The results are shown in FIG. 11.

FIG. 10 shows that this experiment successfully purified the Flag-Ha-Aurora B and Flag-Ha-Aurora B-K85/87R proteins, and FIG. 11 shows that the levels of Aurora B phosphorylation (labeled Aurora B-pT 232) and H3 phosphorylation (labeled H3-pS 10) were significantly higher in the Flag-Ha-Aurora B-K85/87R treated group than in the Flag-Ha-Aurora B treated group, indicating that the kinase activity of the mutant Flag-Ha-Aurora B-K85/87R was significantly higher than in the wild-type Flag-Ha-Aurora B.

Example 6: experiment of the Effect of K85 and/or K87 of aurora kinase B on tumor cell proliferation

In order to examine whether K85 and/or 87 of aurora B have an effect on proliferation of cells, the present inventors have conducted the following experiments.

The cervical cancer cell HeLa cell line is transfected by the plasmids of Flag-HA-Aurora B, flag-HA-Aurora B-K85-R, flag-HA-Aurora B-87R, flag-HA-Aurora B-K85/87R or Flag-HA empty (CT), the cells are re-planted in a culture dish according to the proportion of 30 percent after being digested, and the cells are cultured for two weeks by a culture solution containing 10mmol/L of Puromin drugs for screening, and a stable cell line is obtained after the cells are no longer dead. Through identification, the obtained HeLa cell line stably expresses Flag-HA-Aurora B wild type or Flag-HA-Aurora B-K85R, flag-HA-Aurora B-87R, flag-HA-Aurora B-K85/87R mutant protein, and the Flag-HA no-load (CT) stably transfected HeLa cell line does not express exogenous aurora kinase B.

Proliferation capacity of HeLa cells was then tested by a plate clone formation assay. The experimental procedure was as follows: 5 stably transfected HeLa cells were seeded in 2500 cells/dish in 6cm diameter dishes, four replicates were set per cell group, fresh medium was changed once for 3 days, and cultured for about 15 days. The medium was discarded, washed 1 time with PBS and 4% paraformaldehyde was fixed at room temperature for 20min. The solution was washed 1 time with PBS, stained with 0.5% crystal violet for 5min, and washed with ultrapure water until no background was present. 5 cells were photographed and the results are shown in FIG. 12. The results showed that significantly more clones were formed in the dishes when the Flag-HA-Aurora B-K85, flag-HA-Aurora B-87R or Flag-HA-Aurora B-K85/87R were overexpressed, whereas the most clones were formed in the dishes when the Flag-HA-Aurora B-K85/87R was overexpressed, compared to the control group Flag-CT.

The number of cell clones in fig. 12 was counted and plotted using Image J, and the results are shown in fig. 13. When Flag-HA-Aurora B is overexpressed, the number of cell clones formed is significantly increased compared to the control group, whereas when Flag-HA-Aurora B-K85R, flag-HA-Aurora B-87R or Flag-HA-Aurora B-K85/87R is overexpressed, the number of clones formed is significantly greater, and when Flag-HA-Aurora B-K85/87R is overexpressed, the number of clones formed is the greatest. The results of FIG. 12 and FIG. 13 are combined to show that both Aurora B-K85 or Aurora B-87R single mutant and Aurora B-K85/87R double mutant can promote HeLa cell proliferation, and that Aurora B-K85/87R double mutant has the strongest effect of promoting cell proliferation.

Example 7: influence of Aurora B-K85/87R on drug sensitivity of tumor cells

Small molecule AZD1152 is a high-selectivity aurora kinase inhibitor, and the IC 50 values of the aurora kinase A and the aurora kinase B are respectively 1.37 mu M and 0.37nM. AZD1152 is a dihydrogen phosphate prodrug of HQPA and is a highly effective and specific serine/threonine kinase aurora kinase inhibitor.

The inventors further designed experiments to observe the effect of lysine mutations at positions 85 and 87 of aurora kinase B on the sensitivity of cells to inhibitors of aurora kinase.

Lung cancer cells a549 or prostate cancer cells PC-3 expressing Flag-HA-Aurora B or Flag-HA-Aurora B-K85/87R were seeded in 96-well plates, 5000 cells/well, respectively, and 5 multiplex wells were set for each AZD1152 concentration. For lung cancer cell A549, AZD1152 with concentration of 0, 300, 600, 1250 or 2500nM is added for 24 hours after cell adherence, then CCK8 experiment is carried out, and the viability of the cells is measured. For prostate cancer cells PC-3, cells were treated with AZD1152 at a concentration of 0, 100, 200, 300, 400, 500 or 1000nM, respectively, for 24 hours after adherence, and then CCK8 experiments were performed to measure the viability of the cells. The results are shown in fig. 14 and 15, respectively. The results show that when lysine at positions 85 and 87 of aurora kinase B is mutated, the sensitivity of tumor cells to an aurora kinase inhibitor AZD1152 is increased.

Example 8: aurora B-K85/87R mutation affects the mechanism of action of kinase activation

The crystal structure of the aurora kinase B catalytic region binding to VX-680 and INCENP was searched in the protein database PDB of PCSB, the website was https:// www.rcsb.org/3d-view/4AF3, the protein accession number was 4AF3, and the catalytic region sequence was identical to that of aurora

kinase B variants

1, 2, 3 and 4. The lysines K85, K87 and K202 corresponding to SEQ id No.1 are then highlighted in boxes A, B and C, respectively, in fig. 16. It can be seen from the crystal structure that the K85 and K87 sites are spaced from the K202 site, and that no other amino acid is present between the K85 and K87 sites and the K202 site, which are spatially adjacent. Therefore, it is speculated that after ubiquitination of lysine at the K85 and/or K87 position, lysine at the K202 position is not able to undergo ubiquitination due to steric reasons. However, since the K85 or K87 lysine can not be ubiquitinated by mutation, the K202 lysine is more easily ubiquitinated, especially when the K85 and K87 lysines are both mutated, so that the phosphorylation level of aurora kinase B is increased, and the cell proliferation is promoted.

Similarly, the crystal structures of the aurora kinase C and aurora kinase a catalytic regions were also retrieved in the RCSB protein database. The crystal structure of the catalytic region of aurora kinase C binding VX-680 and INCENP is shown in https:// www.rcsb.org/3d-view/6GR9, protein accession number is 6GR9, the sequence of the catalytic region is the same as that of the catalytic region of aurora

kinase C variants

1, 2 and 3, and the lysine corresponding to K85, K87 and K202 in SEQ ID NO.1 is highlighted in boxes D, E and F in FIG. 16, respectively. The crystal structure of the catalytic region of aurora kinase A combined with VX-680 and TPX2 is shown in https:// www.rcsb.org/3d-view/3E5A, the protein accession number is 3E5A, the sequence of the catalytic region is the same as that of the catalytic region of aurora kinase A, and the K85, K87 and K202 lysines corresponding to SEQ ID NO.1 are highlighted in boxes, namely G, H and I in figure 16 respectively. As can be seen by comparison, the crystal structures of the catalytic regions of aurora kinases B, C and a are similar, and wherein the K85/87 site is located in the junction region of sheets β2 and β3, which is located immediately adjacent to the ATP-binding cleft on the N-terminal leaflet and C-terminal leaflet, respectively, with the lysine at the K202 site.

The present inventors also analyzed the crystal structure of aurora kinase binding to inhibitors recorded in the RCSB protein database, and each crystal structure is shown in fig. 17, wherein the inhibitors bound to aurora kinase B are: a, combined with Barasertib (AZD 1152) (website https:// www.rcsb.org/3d-view/4C 2V); b, incorporated ZM 44739 (website https:// www.rcsb.org/3d-view/2 VRX); c, in conjunction with BI 811283 (website https:// www.rcsb.org/3d-view/5K 3Y); d, combined with VX-680 (website https:// www.rcsb.org/3D-view/4AF 3); e, combining with Hesperadin (website https:// www.rcsb.org/3d-view/2 BFY); and F, binding to reverse (website https:// www.rcsb.org/3d-view/2 VGO).

Since aurora kinase inhibitors typically bind to amino acids in the aurora kinase cleft with hydrogen bonds and van der waals forces, crystal structure analysis finds that the aurora kinase inhibitors are adjacent to the positions of K85 and K87 of the present invention, which position mutation is followed by a smooth entry of the inhibitor due to the absence of ubiquitination on the one hand, and on the other hand, it is possible to promote the inhibitory effect of aurora kinase by directly participating in the binding with the aurora kinase inhibitor.

Example 9: three aurora kinase protein sequence alignments

Protein sequences of three aurora kinases were downloaded from NCBI protein database, namely aurora kinase B variant 1 (NCBI reference sequence np_ 001300879.1), aurora kinase B variant 2 (NCBI reference sequence np_ 001243763.1), aurora kinase B variant 3 (NCBI reference sequence np_ 001271455.1), aurora kinase B variant 4 (NCBI reference sequence np_ 001300881.1), aurora kinase B variant 5 (NCBI reference sequence np_ 001300882.1), aurora kinase C variant 1 (NCBI reference sequence np_ 001015878.1), aurora kinase C variant 2 (NCBI reference sequence np_ 001015879.1), aurora kinase C variant 3 (NCBI reference sequence np_ 003151.2), aurora kinase a (NCBI reference sequence np_ 001310234.1). The protein sequences of these aurora kinases were then aligned using the NCBI's on-line ClustalW tool (https:// www.genome.jp/tools-bin/ClustalW), the results are shown in FIG. 18, wherein "+" indicates that the compared amino acid sequences are identical, ":" indicates that the amino acids have strong conservation, "amino acids have weak conservation,", the lysine sites of the invention are boxed, the consensus sequence DFGWSxxxxxRxTxCGTxYLPPE in the catalytic region is bold, and the threonine phosphorylation site in RxT is bold and underlined.

According to the comparison result in FIG. 18, the identity of the catalytic regions of the three aurora kinases is calculated, wherein the catalytic regions are amino acids 76 to 344 of aurora kinase B variant 1, amino acids 35 to 303 of aurora kinase B variant 2, amino acids 77 to 345 of aurora kinase B variant 3, amino acids 36 to 304 of aurora kinase B variant 4, amino acids 76 to 312 of aurora kinase B variant 5, amino acids 132 to 403 of aurora kinase A, amino acids 42 to 309 of aurora kinase C variant 1, amino acids 23 to 290 of aurora kinase C variant 2, and amino acids 8 to 275 of aurora kinase C variant 3, respectively. Since amino acids 76-101 of the catalytic domain of aurora B variant 5 are relatively specific, aurora B variant 5 is excluded from calculation. It was found that 178 amino acids in the 272 amino acids (calculated as aurora kinase A catalytic region) were completely identical, the identity was 65.44%, and the sequence was relatively conserved. Importantly, the lysines of the present invention and their conservation (except aurora B variant 5) in the compared sequences, and the catalytic region consensus sequences are identical. It can thus be deduced that the catalytic regions of the three aurora kinases compared are able to form the same or similar secondary structure, and that the lysine site of the present invention affects in the same way the phosphorylation of threonine in the consensus sequence and a series of effects downstream in all aurora kinases.

Claims

1. A human aurora kinase mutant protein which is a mutant protein of aurora kinase B, aurora kinase C or aurora kinase a, characterized in that lysine at position 85 or 87 or both of SEQ ID No.1 is replaced or deleted by non-lysine or lysine at position corresponding to 85 or 87 or both of SEQ ID No.1 is replaced or deleted by non-lysine through amino acid sequence alignment.

2. The mutant protein of claim 1, wherein the lysine at position 44 or 46 or both of SEQ ID No.2 is replaced or deleted by a non-lysine, the lysine at position 86 or 88 or both of SEQ ID No.3 is replaced or deleted by a non-lysine, the lysine at position 45 or 47 or both of SEQ ID No.4 is replaced or deleted by a non-lysine, the lysine at position 85 of SEQ ID No.5 is replaced or deleted by a non-lysine, the lysine at position 51 or 53 or both of SEQ ID No.6 is replaced or deleted by a non-lysine, the lysine at position 32 or 34 or both of SEQ ID No.7 is replaced or deleted by a non-lysine, the lysine at position 17 or 19 or both of SEQ ID No.8 is replaced or deleted by a non-lysine, or the lysine at position 141 or 143 or both of SEQ ID No.9 is replaced or deleted by a non-lysine.

3. The human aurora kinase mutant protein according to claim 1 or 2, wherein the substitution by non-lysine is substitution by arginine or histidine.

4. A mutant nucleic acid encoding the human aurora kinase mutant protein according to any one of claims 1 to 3.

5. A vector comprising the mutant nucleic acid of claim 4.

6. A means for identifying a mutant protein according to claims 1 to 3 or a mutant nucleic acid according to claim 4, comprising a specific antibody or antigen binding fragment thereof against a human aurora kinase mutant protein according to any one of claims 1 to 3, a primer pair or probe against a mutant nucleic acid according to claim 4.

7. A pharmaceutical composition for the treatment of tumors, characterized by comprising a human aurora kinase mutant protein according to any one of claims 1 to 3, or a mutant nucleic acid according to claim 4 or a vector according to claim 5, and an aurora kinase inhibitor.

8. The pharmaceutical composition of claim 7, wherein the aurora kinase inhibitor is CYC-116, aurora kinase a inhibitor 2, tozasertib, aurora kinase-IN-2, SCH-1473759, TAK-901, MLN8054, KW-2449, reversible, TAK-901, aurora kinase inhibitor-2, aurora kinase a inhibitor 1, MK-5108, tripoliin a, AT9283, ZM-44739, phthalazinone pyrazole, tinengotinib, AMG, alisertib sodium, PF-03814735, aurora kinase inhibitor 1, NU6140, aurora kinase inhibitor 3, TC-a 2317 hydrochloride, GSK-1070916, AS-703569, LY3295668, aurora kinase inhibitor-9, CCT241736, derrone, darout Lu She, ABT-348, ABT 348 hydrochloride, SNS-314, aurora kinase inhibitor-10, ENMD-6, CD Hesperadin, AZD, PF 2, 28126, NU6140, NU-3757, TC-3765, CCT-3757, zb-3745, zc-3745, zb-3765, zb-3745, and/or the like.

9. The pharmaceutical composition of claim 7, wherein, the tumor is a hematological malignancy (including leukemia, myelogenous leukemia, acute myelogenous leukemia, multiple myeloma, acute lymphoblastic leukemia, chronic myelogenous leukemia, myelodysplastic syndrome, myeloid fibrosis, myeloid metaplasia, hodgkin's lymphoma, non-hodgkin's leukemia, non-hodgkin's lymphoma, cd30+ lymphoma, relapsed/refractory lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, burkitt lymphoma, T-cell lymphoma, B-cell lymphoma, transformed follicular lymphoma, peripheral T-cell lymphoma, waldenstrom's macroglobulinemia), solid tumor, breast tumor (including but not limited to breast cancer, metastatic breast cancer) colon tumor (including but not limited to colon cancer, colorectal cancer, rectal cancer), pancreatic tumor (including but not limited to pancreatic cancer), bladder tumor (including but not limited to bladder cancer), prostate cancer, lung cancer (including but not limited to non-small cell lung cancer, metastatic and recurrent non-small cell lung cancer, advanced non-small cell lung cancer), mesothelioma, ovarian cancer, fallopian tube tumor (including but not limited to fallopian tube cancer), hepatocellular carcinoma, peritoneal cancer, head and neck squamous cell carcinoma, gastroesophageal adenocarcinoma, myelofibrosis, melanoma, neuroblastoma, adult mesenchymal astrocytoma, adult giant cell glioblastoma, myxofibrosarcoma, smooth myoma, liposarcoma, soft tissue sarcoma, malignant peripheral nerve sheath tumor, undifferentiated polymorphous sarcoma, uterine sarcoma, colonic mucous adenoma, rectal mucous adenoma, hepatoblastoma, pediatric rhabdomyoma, pediatric renal tumor, soft tissue sarcoma, thyroid carcinoma or gastric carcinoma.

10. Use of a human aurora kinase mutant protein according to any one of claims 1 to 3, or a mutant nucleic acid according to claim 4 or a vector according to claim 5 for the preparation of a medicament for the treatment of a tumor.

11. A method for predicting whether a person is susceptible to a tumor, the method comprising the steps of:

(a) Determining whether the mutant protein of claims 1 to 3 is expressed in the human sample; and/or

(b) Determining the presence or absence of the mutant nucleic acid of claim 4 in the human sample;

(c) A tumor is susceptible if the assay in (a) determines that the mutant protein of claims 1 to 3 is expressed in a human sample and/or the assay in (b) determines that the mutant nucleic acid of claim 4 is present in a human sample.

12. A method for predicting the response of a patient suffering from a tumor to treatment with a human aurora kinase inhibitor-type anti-tumor drug, said method comprising the steps of:

(a) Determining whether the mutant protein of claims 1 to 3 is expressed in the patient sample; and/or

(b) Determining the presence or absence of the mutant nucleic acid of claim 4 in the patient sample;

(c) If the assay of (a) determines that the mutant protein of claims 1 to 3 is expressed in a patient sample and/or (b) determines that the mutant nucleic acid of claim 4 is present in a patient sample, the patient responds to treatment with a dry human aurora kinase inhibitor-like anti-tumor agent.

13. The method of claim 12, wherein, the aurora kinase inhibitor antitumor drug is CYC-116, aurora kinase A inhibitor 2, tozasertib, aurora kinase-IN-2, SCH-1473759, TAK-901, MLN8054, KW-2449, reversible, TAK-901, aurora kinase inhibitor-2, aurora kinase A inhibitor 1, MK-5108, tripolin A, AT9283, ZM-44739, phthalazinone pyrazole, tinengotinib, AMG, alisertib sodium, PF-03814735, aurora kinase inhibitor 1, NU6140, aurora kinase inhibitor 3, TC-A2317 hydrochloride, GSK-1070916, AS-703569, LY3295668, aurora kinase inhibitor-9, CCT241736, derrone, darwintertiaryb, ABT-348, ABT-hydrochloride, SNS-314, aurora kinase inhibitor-10, ENMD-2076, CD532, hesperadin, AZD1152, AZD2811, NU6140, JAK 3, TC-2317, TC-37B 37, JAK-37B 2317 hydrochloride, GSK-10737-0916, AS-37B 37-37, JAK-37B 37-37, CCT-37, JAK 37-37B, and so on-37, the patient with tumor is malignant tumor of blood system (including leukemia, myelogenous leukemia, acute myelogenous leukemia, multiple myeloma, acute lymphoblastic leukemia, chronic myelogenous leukemia, myelodysplastic syndrome) myeloid fibrosis, myeloid metaplasia, hodgkin ' S lymphoma, non-hodgkin ' S leukemia, non-hodgkin ' S lymphoma, cd30+ lymphoma, relapsed/refractory lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, burkitt lymphoma, T cell lymphoma, B cell lymphoma, transformed follicular lymphoma, peripheral T cell lymphoma, waldenstrom's macroglobulinemia), solid tumors, breast tumors (including but not limited to breast cancer, metastatic breast cancer), colon tumors (including but not limited to colon cancer, colorectal cancer, rectal cancer), pancreatic tumors (including but not limited to pancreatic cancer), bladder tumors (including but not limited to bladder cancer), prostate cancer, lung cancer (including but not limited to non-small cell lung cancer, metastatic and recurrent non-small cell lung cancer, advanced non-small cell lung cancer), mesothelioma, ovarian cancer, fallopian tube tumors (including but not limited to fallopian tube cancer), hepatocellular carcinoma, peritoneal carcinoma, head and neck squamous cell carcinoma, gastroesophageal adenocarcinoma, myelofibrosis, melanoma, neuroblastoma, adult astrocytoma, adult giant cell sarcoma, myxofibrosarcoma, smooth myoma, liposarcoma, soft tissue sarcoma, malignant peripheral nerve sheath tumor, fibrosarcoma, carcinoma of the stomach cancer, fibrosarcoma, carcinoma of the human breast, carcinoma of the children, fibrosarcoma, carcinoma of the uterus, carcinoma of the human being, carcinoma of the uterus, carcinoma of the children, carcinoma of the uterus, tumor of the human being, or the children, tumor of the human being, or the human being.

14. A method of screening for a candidate agent for treating a tumor, comprising: the method comprises the following steps:

(a) Providing a control cell population and a test cell population, wherein the cells of the test cell population express the mutant protein of claims 1-3, or the cells of the test cell population comprise the mutant nucleic acid of claim 4 or the vector of claim 5;

15. Use of a mutant protein according to claims 1 to 3 or a mutant nucleic acid according to claim 4 for predicting whether a human is susceptible to a tumor, for predicting the therapeutic response of a patient to a human aurora kinase inhibitor-like anti-tumor drug, or for screening candidate drugs for treating a tumor.

16. An aurora kinase inhibitor, characterized in that it has a higher binding affinity to the human aurora kinase mutant protein according to claims 1-3 than to the human aurora kinase wild-type protein.