CN116333925B - Bacillus subtilis XD1 and application thereof - Google Patents

Abstract

The invention relates to bacillus subtilis (Bacillus subtilis) XD1, and the strain preservation number is CGMCC No.26097. The invention also relates to application of the strain in detecting rice yellowing. The bacillus subtilis (Bacillus subtilis) XD1 has extremely strong capability of causing the rice to turn into yellow, establishes the relationship between bacterial infection and the rice to turn into yellow through the infection of the strain, can be used for detecting the rice to turn into yellow, can effectively prevent the rice from turning into yellow from the aspect of microbial control, and reduces the occurrence of the rice to turn into yellow.

Description

Bacillus subtilis XD1 and application thereof

Technical Field

The invention belongs to the field of food microorganisms, and relates to bacillus subtilis XD1 and application thereof.

Background

Rice yellowing is a common but problematic problem in rice storage. At present, more researches on the yellow rice remain in researches on physicochemical properties and nutritional values of the rice after the yellow rice, and researches on the effect of bacteria on the yellow rice are fresh. At present, no relation between the yellow rice and bacteria is established in a simulation experiment of the rice yellowing phenomenon, and the ordinary simulation yellowing can only obtain that high humidity and high temperature are main conditions for causing the rice to yellow, and obviously the conditions are not suitable for the effect of bacteria on the rice yellowing, and the higher temperature and humidity are not suitable for the growth temperature of fungi, but can inhibit the growth of fungi. Other external conditions such as oxygen and carbon dioxide content have very little effect on rice yellowing. It is evident that the exploration of these external conditions is not practical to establish a link between bacteria and yellowing. Therefore, the relationship between the bacteria and the rice yellowing is established, the role of the bacteria in the rice yellowing is explored, and the method has important significance for delaying or preventing the rice yellowing.

Disclosure of Invention

The first aim of the invention is to provide bacillus subtilis (Bacillus subtilis) XD1, which solves the problem that bacterial strains causing rice yellowing cannot be found at present and the detection of the rice yellowing cannot be realized.

A second object of the present invention provides the use of the above Bacillus subtilis (Bacillus subtilis) XD 1.

The invention is realized by the following technical scheme:

1. a bacillus subtilis (Bacillus subtilis) XD1 has a strain preservation number of CGMCC No.26097.

Bacillus subtilis (Bacillus subtilis) XD1 is a gram-positive bacterium belonging to the genus Bacillus (Bacillus) of the order Bacillus (Bacillales) of the order Bacillus (Bacillus) belonging to the order Thick-walled bacteria (Firmicutes).

2. The use of bacillus subtilis (Bacillus subtilis) XD1 as described above for detecting rice yellowing.

Further, the detection method is to quantitatively inoculate bacterial liquid on sterile rice, culture for a certain period at constant temperature of 28 ℃ under the sterile condition, determine the yellowing process of the rice, and determine the nutrition index of the yellowing rice.

Further, the concentration of the bacterial liquid is 10 ⁶ CFU/mL.

According to the invention, 5 strains of bacteria are separated from the naturally stored yellowing and simulated yellowing rice, the 5 strains of bacteria are sequentially marked as (Ma, mb, M1, XD1 and M3), the 5 strains of bacteria all generate different degrees of color change under the same infection treatment condition, the XD1 strain has the highest infection speed, the highest capability and the best effect, and the rice shows a uniform and consistent color change state. Therefore, XD1 strain was selected as a dominant strain of yellowing, and exogenous strain XR (Lactobacillus plantarum) was selected as a control strain of non-yellowing. The dominant yellowing strain XD1 bacillus subtilis (Bacillus subtilis) was determined by morphological and 16s rDNA gene identification. The yellow rice samples produced by XD1 infection have a significant difference in chromaticity from ordinary rice, and have significant changes in free amino content, reducing sugar content, and starch microstructure.

The technical scheme has the advantages that: the bacillus subtilis (Bacillus subtilis) XD1 has extremely strong capability of causing the rice to turn into yellow, establishes the relationship between bacterial infection and the rice to turn into yellow through the infection of the strain, can be used for detecting the rice to turn into yellow, can effectively prevent the rice from turning into yellow from the aspect of microbial control, and reduces the occurrence of the rice to turn into yellow.

Drawings

FIG. 1 is a graph of isolated bacterial infection rice yellowing results;

FIG. 2 is a colony morphology of XD1 on BHI plates;

FIG. 3 is a view of the XD1 microscopic morphology;

FIG. 4 is an electropherogram of the 16s rDNA gene PCR product of XD 1;

FIG. 5 is a phylogenetic tree result diagram of XD 1;

FIG. 6 is a graph of the raw rice results for XD1 infestation 1, 2, 3, 4, 5 d;

FIG. 7 is a graph of the results of a colorimetric analysis of XD1 on an infected sample;

FIG. 8 is a graph showing the analysis of the free amino content of XD1 upon infection with 3d and 7 d;

FIG. 9 is a graph showing the analysis of reducing sugar content at 3d and 7d of XD1 infection;

Fig. 10 is a graph (labeled a, b, c, d, e, f in sequence) comparing the microstructure of the yellow rice and normal rice starch granules.

The bacillus subtilis (Bacillus subtilis) XD1 related to the invention is subjected to patent program preservation in China patent office or International patent organization (International patent organization) acknowledged preservation center at 10-11-2022, and the preservation unit is totally called China general microbiological culture Collection center (CGMCC), and the preservation unit address is: the institute of microbiology, national academy of sciences, 3, of west way 1, north Star, of the region of korea, beijing, accession number: CGMCC No.26097.

Detailed Description

The technical scheme of the present invention is further described below with reference to specific examples, but should not be construed as limiting the present invention:

Example 1

This example illustrates the screening of Bacillus subtilis XD 1.

(1) Eluting proper amount of natural yellow rice with sterile water, coating the eluate into PDA culture medium, culturing at 28deg.C for 3-4 days in biochemical incubator, and streaking to separate and purify bacteria in the mixed colony after colony formation;

(2) Transferring the bacterial pure colony obtained by separation and purification in the step (1) into a BHI liquid culture medium for culturing overnight, eluting with 0.85% physiological saline, repeating for 3-5 times until no culture medium color interference exists, re-suspending the bacterial strain obtained by centrifugation to the original volume with 0.85% physiological saline, preparing 10 ⁶ CFU/mL of fresh bacterial suspension, inoculating 3mL of fresh bacterial suspension into sterile rice, gently shaking, culturing and observing the condition of yellow change of the rice in a biochemical incubator at 28 ℃, and screening out bacterial strain capable of causing yellow change of the rice;

(3) Selecting the yellowing strain obtained by screening in the step (2), and selecting the dominant yellowing strain XD1 with high infection speed, strong infection capacity, good infection effect and stability as a yellowing sample strain, wherein the exogenous strain XR strain is a non-yellowing control strain.

The results of the implementation are shown in FIG. 1, which is a comparison of the control group (FIG. 1 a) and the yellowing of rice infected with 5 strains of bacteria, 5 strains of bacteria being marked Ma, mb, M1, XD1, M3 (in the figures, they are marked b, c, d, e, f in sequence). Under the same infection treatment conditions, the 5 bacteria all generate different degrees of color change, but the XD1 strain has the highest infection speed, the highest capability and the best effect and stability, and the yellowing rice shows a uniform and consistent color change state. Therefore, XD1 strain was selected as a dominant strain of yellowing, and exogenous strain XR (Lactobacillus plantarum) was selected as a control strain of non-yellowing.

Example 2

This example illustrates strain identification and morphological identification.

(1) Streaking the XD1 strain on a BHI culture medium, culturing overnight at 37 ℃ in a biochemical incubator, and taking a colony morphology picture;

(2) Picking a small amount of the bacterial colony in the step (1) into a BHI liquid culture medium, culturing overnight at 37 ℃ in a constant-temperature shaking incubator, then carrying out gram staining and microscopic observation, and taking a bacterial strain morphology picture;

(3) Carrying out PCR amplification on the XD1 strain in the step (2), carrying out 16s rDNA identification, and carrying out PCR amplification by using bacterial universal primers 27F:5'AGAGTTTGATCCTGGCTCAG 3',1492R:5'TACGGCTACCTTGTTACGACTT 3'. PCR reaction system 25. Mu.L: 2 XTaq Mix 12.5. Mu.L, primers 27F and 1492R each 1. Mu.L, XD1 bacteria solution template 2. Mu.L, ddH2O 8.5. Mu.L. PCR amplification procedure: pre-denaturation at 95℃for 3min; pre-denaturation at 95℃for 30s, annealing at 55℃for 45s, extension at 72℃for 60s,30 cycles; extending at 72℃for 10min. The PCR amplification products were detected by 1.5% agarose gel electrophoresis. Sequencing of the PCR products was performed by Shanghai Biotechnology Co. Sequencing results phylogenetic tree was constructed using BLAST for homology comparison in NCBI system.

(4) Uploading the XD1 sequence of the strain causing rice yellowing in the step (3) to an NCBI database to obtain NCBI accession number PRJNA898888 and strain preservation number CGMCC No.26097. The strain that does not cause yellowing in XR is Lactobacillus plantarum (Lactobacillus plantarum).

The results of the implementation are shown in FIGS. 2 and 3, which are a colony morphology of the XD1 strain (FIG. 2) and a gram-stained fungus morphology picture (FIG. 3). As can be seen from the colony morphology picture, the XD1 colony is milky white or yellowish in whole, rough and not smooth in surface and is an aerobic bacterium. Gram staining smears are blue-violet, gram positive bacteria, elliptic to rod-like, capsular-free, periflagella, and motile. The overall morphology of the XD1 strain was consistent with that of Bacillus subtilis.

As shown in FIG. 4, the XD1 target fragments obtained from the PCR amplification products by agarose gel electrophoresis were 1196bp in length, respectively; as shown in FIG. 5, by Blast sequence alignment and MEGA11 construction of phylogenetic tree, the analysis result shows that the homology of the yellowing strain XD1 with Bacillus subtilis (Bacillus subtilis) is the highest, 99%, which can be determined as Bacillus subtilis, belonging to gram-positive bacteria.

Example 3

This example illustrates the results of a bacterial infection.

(1) The identified Bacillus subtilis (Bacillus subtilis) XD1 and Lactobacillus plantarum (Lactobacillus plantarum) XR were inoculated in BHI and MRS broth cultures, respectively, at an inoculum size of 2%, and incubated overnight at 37 ℃. The bacterial solution was repeatedly eluted with 0.85% physiological saline until no interference of the color of the culture medium was observed, and a bacterial suspension of 10 ⁶ CFU/mL was prepared. Sterile rice was plated uniformly in a 90mm dish, and 3mL of fresh XR, XD1 bacterial suspension was inoculated into the dish. Culturing at 28 deg.C under aseptic condition, observing and recording rice yellowing, and repeating three groups of parallel;

(2) Obtaining yellow rice under the condition of the step (1), taking a certain amount of yellow rice, adding a proper amount of sterile water into a rice steaming box for steaming for 30 minutes, and observing and recording the degree and uniformity of the yellow rice;

(3) Air-drying the yellow rice in the step (1), grinding in a cyclone mill, and preserving for later use;

(4) Taking a certain amount of the yellowing rice powder obtained in the step (3) for chromaticity analysis, starch granule microstructure analysis, free amino content analysis and reducing sugar content analysis.

The results of the implementation are shown in FIG. 6, which is a comparison of the results of the strains infected with 1, 2, 3,4 and 5 d. The picture samples are arranged in rows, the infection results of the control group, XR and XD1 strains are sequentially from top to bottom, and the picture shows that the control group samples have no obvious color change during storage, the XR group infection samples are similar to the control group results, and the rice yellowing is not infected during storage. Compared with the control group and XR group samples, the XD1 strain has stronger yellowing capability, the color change occurs on the next day of bacterial liquid infection, the infection degree of the XD1 strain is gradually deepened along with the extension of storage time, and the yellowing phenomenon is obvious.

Example 4

This example is intended to illustrate the effect of XD1 strain infection on rice quality.

(1) The sample powder prepared in example 3 was taken in an amount for colorimetric analysis, microscopic observation of starch granules, free amino analysis and analysis of reducing sugar content.

(2) Taking a certain amount of each sample in the step (1), detecting the rice color difference by adopting a color difference meter CM-5, wherein the change of the rice color difference is represented by a parameter L ^*,a^*,b^*, wherein L ^* represents the brightness degree of the sample, the smaller the value is, the darker the sample is, the more the value is-80-100, the value a ^* is positive, the color is reddish, the negative, the color is greenish, the value b ^* is changed between-80-70, the value b ^* is positive, the color is slightly yellowish, and the negative, the color is slightly bluish.

(3) Taking a certain amount of each sample in the step (1), grinding the sample to be observed, soaking 0.1g of each ground sample in a 7ml centrifuge tube with 0.4% NaOH solution for 24 hours, neutralizing with 0.1mol/L HCl solution to be neutral, and washing with distilled water for 5-10 times. Centrifuging at 3500r/min for 10min, taking out the lower precipitate, grinding the sample in a mortar at 60 ℃ for 2h, and sieving with a 40-mesh sieve for later use. Under the condition of accelerating voltage, the starch particles of the yellow rice are observed by using a scanning electron microscope.

(4) Taking a certain amount of each sample in the step (1), referring to the national standard GB 5009.124-2016 method and slightly modifying, accurately weighing a certain amount of samples with good uniformity (the protein content of the samples is 10mg-20 mg), adding 6mol/L hydrochloric acid, hydrolyzing for 24 hours at 110 ℃ in a constant temperature drying box, transferring all the hydrolyzed solution to a 50mL volumetric flask, using deionized water to fix the volume, taking 1-2mL hydrolyzed solution, completely evaporating the hydrolyzed solution in a rotary evaporator, dissolving the evaporated sample in 1-2mL sodium citrate buffer solution with pH of 2.2, and filtering the solution with a 0.22 filter membrane to a sample injection bottle for testing.

(5) Taking a certain amount of each sample in the step (1), adopting a phthalic aldehyde (OPA) method, and (1) accurately weighing 0.1640g L-leucine in a 500ml volumetric flask, fixing the volume by using 10% isopropanol (55 ml isopropanol and 495ml water), and respectively fixing the volume by using 0,0.2,0.4,0.6,0.8 and 1.0ml of the solution into 6 50ml conical flasks, wherein the volume is fixed to 25ml by using ultrapure water, and numbering 1-6. (2) OPA solution preparation: preparation of OPA solution 80mg of OPA was dissolved in 2ml of absolute ethanol in the dark, 1.9068g of sodium tetraborate (n=0.5), 0.1g of SDS (SDS was heated in a water bath at 60-65℃to completely dissolve), 88mg of DTT was added with water, and the solution was left to dissolve completely. The above solution was transferred to a 100ml brown volumetric flask and water was added to volume. (3) determination of standard curve absorbance: the absorbance was measured at 340nm after the reaction at room temperature for 2min by sucking 0.4ml of the test solution and 3ml of OPA solution, respectively. (4) sample preparation and measurement: 0.2g of powder sample is taken, 2ml of 10% acetic acid is added for grinding and homogenization, ultrapure water is added to 25ml, and the mixture is filtered into a 100ml conical flask for standby. After 50-fold dilution of the filtrate, 200ul of the diluted solution was added to 4ml of OPA solution, and the mixture was reacted at room temperature for 2min at 340nm to measure absorbance, and 200ul of water was added in OPA as a blank.

(6) Taking a certain amount of each sample in the step (1), and measuring the content of reducing sugar in rice of each sample by referring to a potassium ferricyanide method in a national standard GB 5009.124-2016 method.

The results of the implementation are shown in FIG. 7, wherein the L ^* value and the a ^* value of the XD1 strain infected yellowing samples are slightly higher than those of the control group and XR group samples. The XD1 strain-infected samples had b ^* >0 overall yellow, and were higher than the control and XR samples. The b ^* value of the control sample was slightly higher than that of normal rice because of the slight color change that may occur due to high temperature stress after the rice is sterilized.

As shown in FIG. 8, the free amino content of the samples was changed when XR strain and XD1 strain were infected for 3d and 7d, as compared with the control rice. The free amino content in the sample increased significantly when the XD1 strain was infected for 3d, and the free amino content in the sample increased further at 7 d. In contrast, the free amino content of the control samples did not change significantly, and there was a slight increase in free amino content in XR-group infested samples.

As shown in FIG. 9, the high levels of reducing sugar content in the XR and XD1 group samples were likely related to the growth of the cells, as compared with the control group rice samples. The reducing sugar content in the XR group and XD1 group samples is far higher than that in the normal rice and control group samples, and the reducing sugar content in the XR group and XD1 group samples shows an ascending trend along with the extension of the storage time, and is possibly influenced by heat generated by bacterial activity metabolism, so that the activity of related enzymes such as alpha-amylase and the like is improved, and the reducing sugar content is further increased.

As shown in fig. 10, the internal structures of normal rice (fig. 10 a) and aseptic rice (fig. 10 b) are clearly seen, starch grains are uniformly arranged, a typical multi-angle morphology is shown, and the cell wall structure is clearly complete. The control samples after 3 days of treatment (fig. 10c, d) did not differ significantly from the microstructure of normal and sterile rice, with slight damage to the cell wall occurring in very individual starch particles. XR, XD1 strain infested samples (fig. 10e, f) differed significantly between their starch particles and the remaining samples. First, yellowing causes a significant change in the morphology of the starch granules, there are significant gaps between the granules, and the cell walls of the starch granules are severely damaged. At the same time, the starch particles also lose the typical multi-angle morphology, the particle morphology is more blunt, and needle-shaped holes are found on the surfaces of the yellowing rice starch particles, so that the holes in the yellowing sample (figure 10 f) are more dense, and the yellowing sample is possibly affected by microorganism infection and has a certain relation with the yellowing of the rice.

The bacillus subtilis (Bacillus subtilis) XD1 has extremely strong capability of causing the rice to turn into yellow, establishes the relationship between bacterial infection and the rice to turn into yellow through the infection of the strain, can be used for detecting the rice to turn into yellow, can effectively prevent the rice from turning into yellow from the aspect of microbial control, and reduces the occurrence of the rice to turn into yellow.

Claims (2)

1. A bacillus subtilis (Bacillus subtilis) XD1 has a strain preservation number of CGMCC No.26097.

2. Use of bacillus subtilis (Bacillus subtilis) XD1 according to claim 1 for detecting rice yellowing.