CN116333887A

CN116333887A - Cladosporium endophyte of Chinese angelica, and separation method and application thereof

Info

Publication number: CN116333887A
Application number: CN202210832441.2A
Authority: CN
Inventors: 刘培; 冯伟萌; 张森; 严辉; 段金廒
Original assignee: Nanjing University of Chinese Medicine
Current assignee: Nanjing University of Chinese Medicine
Priority date: 2022-07-14
Filing date: 2022-07-14
Publication date: 2023-06-27

Abstract

The invention discloses an endophytic fungus of angelica sinensis and a fermentation product thereof, wherein the endophytic fungus is obtained by separating, purifying and culturing seeds of Angelica sinensis (Oliv.) Diels of Umbelliferae, and is identified as Cladosporium (Cladosporium) by microorganism ITS sequencing. The strain is preserved in China center for type culture Collection, address: china, hubei Wuhan, university of Wuhan student's college of life science; post code: 430072, a date of deposit of 2022, 6, 9, a deposit number of: cctcno: M2022842. The liquid fermentation product of the cladosporium Z1 can produce active ingredients such as flavone, phenols and the like, has good DPPH free radical scavenging capability, can promote the germination of angelica seeds, improves the accumulation of the content of the senkyunolide A in angelica plants, and can be applied to preparing special microbial fertilizers for the angelica.

Description

Cladosporium endophyte of Chinese angelica, and separation method and application thereof

Technical Field

The invention relates to an angelica endophytic cladosporium strain which has good antioxidant activity and the functions of promoting seed germination, plant growth and active ingredient accumulation, and belongs to the technical field of microorganisms.

Background

Endophytic fungi are endophytes which are grown among plant tissue cells, distributed in roots, stems, leaves, flowers and seeds and do not cause any diseases, and the variety of endophytic fungi is up to 100 ten thousand. Host plants and endophytes gradually form a reciprocal survival relationship and an interdependent symbiont structure in a long-term co-evolution process. Endophytic fungi can show multidimensional interactions in host plants, and the endophytic fungi of plants can promote plant growth by producing nutrient substances (nitrogen, phosphorus, iron and the like) or regulating and controlling the level of phytohormone (auxin, cytokinin, gibberellin and the like) which are necessary for the growth of the hosts; the host plant can be stimulated to produce metabolic products with biological activity to activate the host defense system, so that the stress resistance of the host plant to biological and abiotic stress is enhanced. In addition, the endophyte can directly or indirectly influence the content and distribution of the active substances of the medicinal plant by influencing the synthesis, content and accumulation of the secondary metabolites of the medicinal plant.

The endophytic fungi commonly existing in the tissues and organs of the medicinal plants have rich diversity, and the active substances generated by partial endophytic fungi in the metabolic process have huge application prospect and economic value in the aspects of drug research and development, biological control of plant diseases and the like, so that the endophytic fungi are widely paid attention to scientists around the world. The fungal metabolites in the medicinal plants are various, and the biological activities of the fungal metabolites are different, especially the antitumor activity, the antibacterial activity, the antioxidant activity and the like are widely paid attention to.

The angelica is the dry root of the Umbelliferae plant angelica Angelica sinensis (Oliv.) Diels, mainly contains volatile oil, ferulic acid and water-soluble components, has the effects of activating blood, replenishing blood, regulating menstruation, relieving pain, relaxing bowel and has wide pharmacological activity. The Chinese angelica plays important roles in regulating human body functions, enhancing organism immunity, resisting anoxia, inhibiting bacteria, resisting cancer, resisting arteriosclerosis and the like in clinical treatment. However, as the demands of the market on the angelica are increasing, the phenomena of large fertilizer consumption, strong fertilization blindness and the like in the angelica cultivation process cause a series of problems of soil quality reduction, hardening, nutrient imbalance, poor fertilizer storage capacity and the like, and seriously influence the yield and quality of angelica medicinal materials, so that the sustainable development of the angelica planting industry is seriously threatened. The endophytic fungi not only can promote the accumulation of host secondary metabolites, but also can generate various chemical components, and has important significance for protecting resources, developing novel biological bacterial fertilizers and developing ecological planting. At present, researchers separate a plurality of endophytic fungi from angelica sinensis, but the researches on the endophytic fungi and the application thereof still belong to a starting stage, and the screening of strains with the functions of promoting the high-quality growth of the angelica sinensis and improving the activity accumulation has important significance for developing biological bacterial manure deeply, developing green healthy planting and the like.

Disclosure of Invention

The invention aims to: the invention aims to deeply screen the endophytic fungi and cultivate the endophytic fungi to obtain a novel Chinese angelica endophytic cladosporium strain which has good antioxidant activity and the functions of promoting seed germination, plant growth and active ingredient accumulation.

The technical scheme is as follows: in order to achieve the above purpose, the invention adopts the following technical scheme:

an endophytic cladosporium of angelica, which is preserved in China center for type culture collection, address: china, hubei Wuhan, university of Wuhan student's college of life science; post code: 430072, a date of deposit of 2022, 6, 9, a deposit number of: cctccc No. M2022842; the classification is named Cladosporium sp.Z1.

The method for separating the Chinese angelica endophyte comprises the following specific steps of cleaning, inoculating, separating, culturing and preserving:

a) Cleaning: removing sediment impurities on the surface of the angelica, and flushing the surface with sterile water for three times in an ultra-clean workbench. Cutting the dried powder into 3cm pieces with a sterilized blade, placing in a sterile culture dish, sequentially soaking in 75% ethanol for 1min,5% sodium hypochlorite for 5min, washing with sterile water for 4-6 times, and sucking excessive water with sterile filter paper for use. And uniformly smearing the sterilized water washed out in the last time on a PDA culture medium to serve as a control of the surface sterilizing effect.

b) Separating: and (3) separating endophytes by adopting two modes of direct cutting and grinding treatment respectively. Directly cutting: cutting off the sterilized small section of 3cm angelica, placing the sterilized small section of the angelica into a PDA culture medium by using sterile forceps, culturing 3 samples in each dish at a constant temperature of 28 ℃, after hyphae grow out of the edge of a tissue block, picking a small amount of hyphae by using an inoculating loop, inoculating the small amount of hyphae into a new PDA culture medium, purifying by using a streaking method, and repeating for a plurality of times until a single colony is obtained. Grinding: cutting off the sterilized small sections of 3cm angelica, grinding the sterilized small sections of angelica uniformly by using a sterile mortar and pestle, taking 1mL of sterile water to dilute a sample, sucking 100 mu L of the diluted liquid to uniformly spread on a PDA culture medium, repeating three treatments, culturing at constant temperature of 28 ℃, picking hyphae with different colors and forms into a new PDA culture medium, purifying by a streaking method, and repeating for a plurality of times until a single colony is formed.

c) Culturing and preserving: pouring PDA culture medium into a test tube, placing the culture medium in an inclined manner to occupy about 1/5 of the test tube, picking the purified mycelium into the test tube by using an inoculating loop in an ultra-clean workbench after the culture medium is solidified, inoculating by using a streaking method, culturing in a 28 ℃ incubator, and placing the culture medium in a refrigerator at 4 ℃ for preservation after the mycelium grows out. The purified fungi on the plates were prepared as spore suspensions with 50% glycerol 1:1, placing the materials into a sterilized freezing tube, uniformly mixing, sealing by a sealing film, and storing in an ultralow temperature refrigerator at-80 ℃.

The preparation method of the bacterial strain spore suspension of the Chinese angelica endophyte is characterized in that Cladosporium sp.Z1 bacterial strain is inoculated into a PDA culture medium, activated and cultured in a biological incubator at a constant temperature of 28 ℃, after 5d, the culture is completed, 3mL of sterile water is added into an ultra-clean workbench to flush the surface bacterial cells of the culture medium, and liquid is collected to obtain the spore suspension. Spore suspension concentrations were counted using a hemocytometer.

The invention provides a fermentation culture method of Chinese angelica endophytic Cladosporium, which comprises the following steps of inoculating Cladosporium sp.Z1 strain into a 50mLPDB liquid culture medium, carrying out activation culture at a constant temperature of 28 ℃ in a shaking table 160r/min, taking 1mL of the activated strain after 3d to a triangular flask filled with 500mL of PDB liquid culture medium for fermentation, and carrying out shaking table culture at the temperature of 28 ℃ and 160r/min for 5d; after the fermentation culture, collecting fermentation liquor.

And (3) analyzing fermentation products of the Chinese angelica endophyte, wherein fermentation liquid is taken as a raw material, ethyl acetate is extracted for three times, ethyl acetate is volatilized, methanol is used for redissolving, and the solution can be used for detecting the fermentation products, wherein the total flavone content is 37.35 mug/mL and the total phenol content is 393.84 mug/mL.

The invention provides an application of Chinese angelica endophyte in preparing antioxidant preparation and promoting germination of Chinese angelica seeds and plant growth, wherein spore suspension is obtained by the preparation method, and the spore suspension is co-cultured with Chinese angelica seeds and aseptic seedlings of Chinese angelica, so that germination conditions of Chinese angelica seeds and growth conditions of aseptic seedlings are recorded.

The beneficial effects are that: compared with the prior researches, the invention has the following advantages:

(1) The cladosporium Z1 strain provided by the invention can be directly metabolized to produce flavonoid, phenols and other components, has good antioxidant activity, and has important significance for developing research on novel antioxidants for microbial fermentation.

(2) The cladosporium Z1 strain provided by the invention can promote the germination of angelica seeds, improve the content of angelica senkyunolide A, can be used for developing a biological bacterial fertilizer with low cost, no pollution and stable yield increase, and can effectively improve soil, thereby being applied to the green and healthy planting industry of angelica.

Drawings

FIG. 1 shows a front view of a colony of the Acremonium Z1 strain;

FIG. 2 shows a back side view of colonies of Acremonium Z1 strain;

FIG. 3 cladosporium Z1 ITS sequence phylogenetic tree;

FIG. 4 analysis of antioxidant activity of fermentation products of Cladosporium Z1;

FIG. 5 influence of Acremonium Z1 strain on angelica growth (A: plant height; B: fresh weight);

FIG. 6 effect of Cladosporium Z1 on the content of secondary metabolite of the Chinese angelica (A: senkyunolide A; B: ferulic acid).

Detailed description of the preferred embodiments

The endophytic fungi of the present invention are strains isolated from Angelica sinensis at Min county, min and Angelica sinensis, gansu province, and the present invention can be better understood from the following examples.

Example 1

A method for separating Chinese angelica endophyte, which comprises the following steps:

(1) Cleaning: removing sediment impurities on the surface of the angelica, and flushing the surface with sterile water for three times in an ultra-clean workbench. Cutting the dried powder into 3cm pieces with a sterilized blade, placing in a sterile culture dish, sequentially soaking in 75% ethanol for 1min,5% sodium hypochlorite for 5min, washing with sterile water for 4-6 times, and sucking excessive water with sterile filter paper for use. And uniformly smearing the sterilized water washed out in the last time on a PDA culture medium to serve as a control of the surface sterilizing effect.

(2) Separating: and (3) separating endophytes by adopting two modes of direct cutting and grinding treatment respectively.

Directly cutting: 3cm of the sterilized small sections of Angelica sinensis were excised from the contact surface, and then placed in PDA medium with sterile forceps, 3 specimens per dish, and incubated at 28 ℃. After hypha grows out from the edge of the tissue block, small amount of hypha is picked by an inoculating loop and inoculated into a new PDA culture medium, and the purification is carried out by a streaking method, and the steps are repeated for a plurality of times until a single colony is formed, so that the Cladosporium sp.Z1 strain of the Chinese angelica endophyte is obtained.

Grinding: cutting off the sterilized small sections of 3cm angelica, grinding the sterilized small sections of the angelica uniformly by using a sterile mortar and pestle, taking 1mL of sterile water to dilute a sample, sucking 100 mu L of the diluted solution, uniformly coating the diluted solution on a PDA culture medium, repeating three treatments, culturing at constant temperature of 28 ℃, picking hyphae with different colors and forms into a new PDA culture medium, purifying by using a streaking method, and repeating for a plurality of times until a single colony is obtained, thus obtaining the Cladosporium sp.Z1 strain of the angelica endophyte.

(3) Preparing a bacterial strain spore suspension of the Chinese angelica endophytic cladosporium: inoculating Cladosporium sp.Z1 strain into PDA culture medium, activating and culturing in a biological incubator at constant temperature of 28deg.C for 5d, washing surface thallus of the culture medium with 3mL sterile water, and collecting liquid to obtain spore suspension.

(4) Culturing and preserving: pouring PDA culture medium into a test tube, placing the culture medium in an inclined manner to occupy about 1/5 of the test tube, after the culture medium is solidified, picking the purified mycelium into the test tube by using an inoculating loop in an ultra-clean workbench, inoculating by using a streaking method, culturing in a 28 ℃ incubator, and placing the incubator in a refrigerator at 4 ℃ for short-term storage after the mycelium grows out. The purified fungi on the plates were prepared as spore suspensions with 50% glycerol 1:1, placing the materials into a sterilized freezing tube, uniformly mixing, sealing by a sealing film, and storing in an ultralow temperature refrigerator at-80 ℃ for a long time.

The PDA culture medium involved in the isolation and cultivation of the strain described above consisted of 200g/L potato, 20g/L glucose and 15g/L agar.

Example 2

Molecular identification of the endophyte of angelica sinensis is carried out by the following method:

the Cladosporium sp.Z1 strain plates of Cladosporium Angelica cultivated in example 1 were sent to the division of biological engineering (Shanghai) for ITS sequencing. The upstream primer ITS1 (5'-TCCGTAGGTGAACCTGCGG-3'), the downstream primer ITS4 (5'-TCCTCCGCTTATTGATATGC-3') and the ITS sequences were aligned on the NCBI database (https:// www.ncbi.nlm.nih.gov /), and the Cladosporium sp.Z1 strain was identified as Cladosporium (Cladosporium) by Blast sequence alignment analysis to have a homology of 88% to Cladosporium.

Sequence listing

CCCCCCCGCGCGACACGACTCAAAAAAAGAGTGGTGTTTTGCCGCCGCGCCCCGCGCTCTCCATGTAGTATATTTTCCCCCCCAGCGGGGGAGGGGACACAACCCCCCCCCCTGCGTTTTGAGCGCGGGCGCCCGCTCGCCAAATCCCCAGCGCGGCGTGGTGAAATGACGCTCAACAGCATGCCCCCCCGAATACGAGGGCGCAATGGCTAAAGATTGCATGATTCACGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCATGCCAGAACCAAGAGATCCGTTGTGAAAGTTTTAATTTGTTAATTAAATTTACTCAGACTGCAAAGTTACGCAAGAGTTTGAAATGTCCACCCGGGGCCCCCGCCCGGAGGCAGGGTCGCCCCGGAGGCAACAGAGTCGGACAACAAAGGGTTGTGAACATCCCGGCCCGAGGGCCGGGGTCAACTTGTAATGATCTTCCGTAGGGGTACCTGCGGAGGGATCATTACAAGTTGACCCCGGCCCTCGGGCCGGGATGTTCACAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTCCGGGCGGGGGCCCCGGGTGGACATTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAATTTAATTAACAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGACGCGGTCCGCCGCGCGCCTCAAATCGACCGGCTGGGTCTTTCGTCCCCTCAGCGTTGTGGAAACTATTCGCTAAAGGGTGCCGCGGGAGGCCACGCCGTTAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCATAAGCCGAAGGAAATG。

TABLE 1 alignment of sequences of Z1 strains Table

Example 3

Fermentation culture method of Cladosporium sp.Z1 strain of Chinese angelica endophytic fungi

(1) Taking single colony obtained by repeated purification in the step (2) of the example 1, inoculating the single colony into 50mLPDB liquid culture medium (200 g/L potato and 20g/L glucose), performing activation culture at a constant temperature of 28 ℃ in a shaking table at 160r/min, taking 1mL of activated strain after 3d, and fermenting in a triangular flask filled with 500mL of PDB liquid culture medium, and performing shaking culture at 28 ℃ in 160r/min for 5d; after the fermentation culture, collecting fermentation liquor. Extracting the fermentation broth sample with equal amount of ethyl acetate for three times, volatilizing the ethyl acetate, and redissolving with methanol;

(2) Adopting an aluminum nitrate colorimetric method, taking a rutin standard substance as a reference substance solution, and determining that the total flavone content in the fermentation broth is 37.35 mug/mL;

(3) And (3) determining the total phenol content in the fermentation broth to be 393.84 mug/mL by adopting a Fu Lin Fen colorimetric method and using a gallic acid standard substance as a reference substance solution.

Example 4 antioxidant Activity assay

(1) The antioxidant activity of the fermentation product was evaluated by DPPH radical scavenging test. The Cladosporium sp.Z1 fermentation broth of the Chinese angelica is diluted by methanol solution in multiple ratio to prepare sample solutions with volume fractions of 100%,50%,25%,12.5%,6.25% and 3.125% for standby. Accurately weighing an appropriate amount of ascorbic acid powder, adding ultrapure water for dissolution, and preparing 1mg/mL ascorbic acid solution as a positive control. 0.25mmol/L DPPH solution (light shielding) was prepared with absolute ethyl alcohol, 50. Mu.L of the sample solutions with different concentrations and 150. Mu.L of the DPPH solution were placed in 96-well plates (50. Mu.L of methanol+150. Mu.L of DPPH solution was used as a blank, 50. Mu.L of the sample solution+150. Mu.L of absolute ethyl alcohol was used as a control), 3 wells were placed in parallel, and reacted at 37℃for 30 minutes in the dark, and absorbance was measured at 517 nm.

DPPH radical clearance (%) = [1- (sample-a control)/a blank ] ×100%

(2) The results of the antioxidant activity experiments are shown in fig. 4: the clearance rate of the Cladosporium sp.Z1 fermentation liquor to DPPH free radical can reach 100 percent, which is equivalent to 62.5 mug/mL VC solution.

Example 5 test of seed germination of Angelica sinensis by Cladosporium sp.Z1

(1) Preferably 200 Chinese angelica seeds with full seeds and uniform quality, wherein each 100 Chinese angelica seeds are filled in 1 culture flask, the reference numerals are 1 and 2, the Chinese angelica seeds are sterilized by 75% ethanol for 1min, the Chinese angelica seeds are sterilized by mercuric chloride for 9min, the Chinese angelica seeds are rinsed by sterile water for 5 times, and the sterile water is poured out. Cladosporium sp.Z1 spore suspension (4X 10) was obtained as in step (3) of example 1 ⁵ cfu/mL), diluted and counted, the diluted Cladosporium sp.z1 spore suspension was poured into a No. 1 flask, and sterile water was poured into a No. 2 flask and immersed for 24 hours. Transferring the seeds into culture dishes containing 3 layers of sterile filter paper, placing 30-35 seeds in order in each culture dish, repeating 3 treatments for each sample, pouring about 5mL of sterile water to fully saturate the seeds and filter paper, and usingThe sealing film seals the culture dish to prevent contamination. The dishes and seeds were weighed together and recorded.

(2) Then placing the culture dish in an illumination incubator for culture, weighing the culture dish every 24 hours, supplementing the culture dish to the original weight, and recording the germination number of the seeds. As shown in Table 2, spore suspension of Cladosporium sp.Z1 obtained by screening of the present invention can promote germination of seeds of Angelica sinensis.

TABLE 2 short term germination vigor and final germination percentage of Angelica sinensis seeds

6d

8d

9d

10d

11d

13d

16d

Final germination rate

Control group

0％

13％

39％

59％

62％

65％

Cladosporium Z1

0％

20％

45％

66％

68％

71％

76％

80％

Example 6 test of the Effect of Cladosporium sp.Z1 Strain on the growth of Angelica sinensis on promoting Angelica sinensis

Preferably, the Chinese angelica seeds with full seeds and uniform quality are sterilized by 75% ethanol for 1min, sterilized by mercuric chloride for 9min, rinsed by sterile water for 5 times, poured out of the sterile water, uniformly placed in an MS culture medium, 5 seeds per bottle, placed in a climatic chamber for culture at the temperature of 23 ℃ and the humidity of 70%, the illumination time is 14h/d, and the illumination intensity is 2000lx. Culturing for about 30 days, randomly grouping radix Angelicae sinensis seedlings with relatively uniform leaf size, which are blank group and Z1 strain group, respectively, five bottles of each group, six radix Angelicae sinensis seedlings each bottle, adding 20 μl blank PDB culture medium or Z1 strain spore suspension (4×10) into root of each seedling ⁵ cfu/mL). And co-culturing the bacterial liquid and the aseptic seedlings for 7 days, and taking the aseptic seedlings of the Chinese angelica to measure the fresh weight and the plant height. As shown in FIG. 5, the spore suspension of Cladosporium sp.Z1 obtained by screening in the invention can promote the growth of Chinese angelica and increase the fresh weight of Chinese angelica.

Example 7 Effect of Cladosporium sp.Z1 Strain on the secondary metabolite

(1) The preparation method of the sample solution is as follows: the angelica seedlings obtained by the blank PDB culture medium culture in example 6 and the angelica seedlings cultivated by Cladosporium sp.Z1 spore suspension are taken. Respectively weighing two Chinese angelica seedlings with the same weight, respectively homogenizing, then respectively adding 10 times of 70% methanol, swirling, performing ultrasonic extraction at 220W and 80Hz for 20min, taking out, centrifuging at 12000rpm for 10min, and taking out supernatant; obtaining a sample solution of angelica seedlings obtained by culturing a blank PDB culture medium and a sample solution of angelica seedlings obtained by culturing a Cladosporium sp.Z1 strain spore suspension.

(2) The preparation method of the reference substance solution is carried out as follows: taking appropriate amount of ferulic acid and senkyunolide A reference substances, precisely weighing, and adding 70% methanol to obtain mixed reference substance solution containing ferulic acid and senkyunolide A105.61 μg and 154.74 μg per 1 mL.

(3) The content measurement is carried out according to the following liquid phase conditions: acquity UPLC BEH C18 chromatography column (2.1 mm. Times.100 mm,1.7 μm), mobile phase 0.1% formic acid water (A) -acetonitrile (B), gradient elution (0-5 min, 5-43% B, 5-9 min, 43-43% B, 9-12 min, 43-70% B, 12-14 min, 70-95% B, 14-15 min, 95-5% B, 15-16 min, 5-5% B. Flow rate 0.4mL/min, column temperature 30 ℃ C., sample volume 2. Mu.L).

(4) Content determination

Taking the two sample solutions in the step (1) and the mixed reference solution in the step (2), respectively injecting into a high performance liquid chromatograph, injecting sample according to the chromatographic condition in the step (3), and calculating the contents of ferulic acid and senkyunolide A according to an external standard one-point method.

The experimental results are shown in fig. 6: the cladosporium Z1 spore suspension obtained by screening can increase the content of senkyunolide A and ferulic acid, which shows that the cladosporium Z1 spore suspension has a regulating and controlling effect on the active ingredients of the senkyunolide A and the ferulic acid of the Chinese angelica.

The results show that the new Chinese angelica endophytic fungus-cladosporium Z1 is obtained by screening, and the methods for separating, culturing, preserving, metabolizing and analyzing the growth promoting function are established, so that the cladosporium Z1 strain can be directly metabolized to produce rich flavonoid and phenolic components, has good antioxidant activity, and provides a new component source for the preparation of medical raw materials and functional products. Meanwhile, the cladosporium Z1 has the good functions of promoting the germination of angelica seeds, growing plants and regulating and controlling the accumulation of secondary metabolites, can develop related products such as biological bacterial fertilizers, and has important practical application value.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

1. A strain of Chinese angelica endophytic cladosporium is preserved in China Center for Type Culture Collection (CCTCC), and has a preservation number of CCTCCNO: M2022842, and is classified and named as Cladosporiumsp Z1.

2. The method for separating endophytic cladosporium of angelica according to claim 1, which comprises the following steps:

(1) Cleaning: removing sediment impurities on the surface of Chinese angelica, flushing the surface of the Chinese angelica with sterile water in an ultra-clean workbench, cutting the Chinese angelica into small sections by using a sterilized blade, placing the small sections in a sterile culture dish, sequentially soaking the small sections in 75% ethanol and 5% sodium hypochlorite, flushing the small sections with sterile water, and sucking the excessive water with sterile filter paper for later use; uniformly smearing the sterilized water washed out in the last time on a PDA culture medium to serve as a contrast of the surface sterilizing effect;

(2) Separating: endophyte separation is carried out by adopting two modes of direct cutting and grinding treatment respectively

Directly cutting: cutting off the sterilized small contact surface of the angelica in the step (1), and then placing the angelica in a PDA culture medium by using sterile forceps for constant-temperature culture; after hyphae grow out of the edge of the tissue block, a small amount of hyphae are picked by an inoculating loop and are inoculated into a new PDA culture medium, and the culture medium is purified by a streaking method, and the culture medium is repeated for a plurality of times until a single colony is formed;

grinding: cutting off the sterilized small sections of the angelica sinensis in the step (1), grinding the sterilized small sections of the angelica sinensis uniformly by using a sterile mortar and pestle, taking a sterile water dilution sample, sucking a small amount of dilution liquid, uniformly coating the dilution liquid on a PDA culture medium, culturing at constant temperature, picking hyphae with different colors and forms into a new PDA culture medium, purifying by using a scribing method, and repeating for a plurality of times until a single colony is formed;

(3) Preparing a spore suspension of the endophytic cladosporium angelica Z1 strain: inoculating Cladosporium p.Z1 strain into PDA culture medium, culturing in constant temperature biological incubator, adding sterile water into ultra-clean workbench to flush surface thallus of culture medium, and collecting liquid to obtain spore suspension;

(4) Culturing and preserving: pouring part of PDA culture medium into a test tube, placing the culture medium in an inclined manner, after the culture medium is solidified, picking the purified mycelium into the test tube by an inoculating loop in an ultra-clean workbench, inoculating by a streaking method, culturing in an incubator, and placing the incubator into a refrigerator for short-term storage after the mycelium grows out; preparing spore suspension from purified fungi on a flat plate with sterile water, mixing the spore suspension with glycerol, placing into sterilized freezing tube, mixing, sealing with sealing film, and storing in ultralow temperature refrigerator at-80deg.C for a long time.

3. The method for isolating amycolatopsis angelicae according to claim 2, characterized in that the PDA medium involved in the isolation and cultivation of the strain consists of 200g/L potato, 20g/L glucose and 15g/L agar.

4. A fermentation method of a Chinese angelica endophytic cladosporium, which is characterized by comprising the following steps of;

inoculating Cladosporium p.Z1 strain into PDB liquid culture medium, performing shaking table activation culture at constant temperature of 28deg.C, and taking a small amount of activated strain into bottle filled with PDB liquid culture medium for fermentation to obtain fermentation broth.

5. The fermentation method of the endophytic cladosporium of angelica according to claim 4, comprising the following steps of;

inoculating Cladosporium p.Z1 strain into 50mLPDB liquid culture medium, performing activation culture at a constant temperature of 28 ℃ in a shaking table at 160r/min, taking 1mL of the activated strain after 3d, and performing fermentation in a triangular flask filled with 500mLPDB liquid culture medium, and performing shaking table culture at 28 ℃ at 160r/min for 5d; after the fermentation culture, collecting fermentation liquor.

6. The fermentation method of the endophytic cladosporium of angelica sinensis according to claim 4 or 5, wherein the PDB medium consists of 200g/L potato and 20g/L glucose.

7. The method for fermenting a. Angelicae sinensis endophyte according to claim 4 or 5, wherein the fermentation broth is extracted with ethyl acetate, the ethyl acetate is volatilized, and the ethyl acetate is redissolved with methanol to obtain a fermentation product containing 37.35 mug/mL total flavonoids and 393.84 mug/mL total phenols.

8. Use of the fermentation broth of claim 4 or 5 for preparing an antioxidant preparation.

9. The use of endophyte of angelicae sinensis as claimed in claim 1 in preparing microbial fertilizer for promoting germination of angelicae sinensis seeds and increasing fresh weight of angelicae sinensis plants and content of senkyunolide a.

10. Use according to claim 9, characterized in that endophytic cladosporium angelica sinensis is co-cultivated with angelica sinensis seeds, angelica sinensis aseptic seedlings.