CN116333885A

CN116333885A - Toxoplasma vaccine for expressing RBD protein of coronavirus and construction method thereof

Info

Publication number: CN116333885A
Application number: CN202211567080.XA
Authority: CN
Inventors: 刘贤勇; 索勋; 刘亚欣; 王超越; 姜昕雨; 王敏; 索静霞; 汤新明
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2022-12-07
Filing date: 2022-12-07
Publication date: 2023-06-27

Abstract

The invention relates to the technical field of biology, in particular to toxoplasma vaccine for expressing coronavirus RBD protein and a construction method thereof. Toxoplasma vaccine contains toxoplasma strain expressing coronavirus RBD protein, and toxoplasma strain contains amino acid sequence for encoding coronavirus RBD protein; the amino acid sequence is shown as SEQ ID NO. 1. The toxoplasma strain expressing the RBD protein of the coronavirus has higher safety to a host, can induce organisms to generate stronger humoral immune response and cellular immune response, can prevent toxoplasma infection, effectively prevent toxoplasma oocyst from being discharged, and can prevent novel coronavirus infection.

Description

Toxoplasma vaccine for expressing RBD protein of coronavirus and construction method thereof

Technical Field

The invention relates to the technical field of biology, in particular to toxoplasma vaccine for expressing coronavirus RBD protein and a construction method thereof.

Background

Toxoplasma gondii (Toxoplasma gondii) is an obligate intracellular parasite and is also an important zoonotic pathogen, and is classified into type I, type II and type III according to its pathogenicity in mice. Toxoplasma infection can cause diseases in different ways and to different degrees in humans and animals, leading to miscarriage, stillbirth and other reproductive disorders in pregnant and pregnant animals, and is life threatening for immunosuppressed patients. Toxoplasma cat is a parasitic disease formed by a cat swallowing toxoplasma cysts, oocysts or sham cysts. Cats are the final host of toxoplasma, and for the first infected cats, a large number of oocysts can be discharged into the environment, and the oocysts have extremely strong resistance to the external environment and are an important source for human and animal infection of toxoplasma. Meanwhile, cats are also intermediate hosts of toxoplasmosis, can form cysts in tissues after being infected, and can also transmit toxoplasmosis after being predated. Severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) is the causative agent of the 2019 novel coronavirus disease (COVID 19). Recent studies of SARS-CoV-2 susceptibility in cats have shown that viruses can replicate in these companion animals and spread to other cats.

Therefore, how to develop a novel vaccine which can prevent toxoplasma infection, prevent toxoplasma oocyst from being discharged and prevent coronavirus infection becomes a technical problem to be solved urgently.

Disclosure of Invention

The invention provides a toxoplasma strain for expressing coronavirus RBD protein, which contains an amino acid sequence for encoding the coronavirus RBD protein;

the amino acid sequence is shown as SEQ ID NO. 1.

Compared with the original insect strain, the toxoplasma gondii strain expressing the coronavirus RBD protein provided by the invention has no obvious change in proliferation speed in vitro, no obvious change in pathogenicity, almost no pathogenicity in a rat body and higher safety to a host; simultaneously can induce organism to generate humoral immune response and cellular immune response, not only can prevent toxoplasma infection, effectively prevent toxoplasma oocyst from being discharged, but also can prevent coronavirus SARS-CoV-2 infection.

The RBD is positioned at the c end of the S1 subdomain, and after the RBD is specifically combined with the corresponding part of a cell surface receptor (ACE 2), the conformation change of the fusion core helical structure of the S2 is induced, the coiled helix is folded to form a hairpin-like structure, the hairpin-like structure enables viruses to be combined with cell membranes, and finally fusion is caused, and the step is the key of the viruses to infect host cells.

However, RBD is easy to mutate in SARS-CoV-2 of different types, and the invention discovers that the RBD protein with the amino acid sequence shown as SEQ ID NO.1 can excite stronger immune response when being selected to construct recombinant toxoplasma gondii strain.

As a preferred embodiment of the invention, the nucleic acid sequence encoding said amino acid sequence is shown in SEQ ID NO. 2.

As a preferred embodiment of the present invention, the toxoplasma gondii strain is a toxoplasma gondii type I, type II or type III strain, more preferably a Δku80 RH strain.

Further, the present invention provides a method for constructing a toxoplasma strain in any one of the above embodiments, comprising: the gene encoding RBD protein is introduced into toxoplasma strain by transgenic technology.

As a preferred embodiment of the invention, the transgenic technology employs a CRISPR/Cas system; CRISPR/Cas9 systems are preferred.

As a preferred embodiment of the present invention, the construction method comprises:

constructing a pUPRT-Tub-Gra8ss-RBD-3HA-UPRT vector by taking a pUPRT-Tub-Gra8ss-OVA-DHFR-3HA-UPRT plasmid as a template;

the pSAG1-CAS9-TgU6-sgUPRT plasmid was then co-transfected with the vector into the toxoplasma strain.

Preferably, the construction method comprises the following steps:

(1) Taking pUPRT-Tub-Gra8ss-OVA-DHFR-3HA-UPRT plasmid as a template;

(2) Constructing pUPRT-Tub-Gra8ss-RBD-3HA-UPRT vector: the 5 'homologous arm of the UPRT gene and the 3' homologous arm of the UPRT gene are connected in sequence;

(3) pSAG1-CAS9-TgU6-sgUPRT plasmid

pUPRT-Tub-Gra8ss-RBD-3HA-UPRT is co-transfected to toxoplasma I type insect strain, and monoclonal insect strain expressing RBD protein is obtained through screening and identification.

By adopting the construction method, the capability of the toxoplasma gondii strain for inducing organism to generate humoral immune response and cellular immune response can be further improved, and the toxoplasma gondii oocyst can be prevented from being discharged.

Further, the present invention provides a vaccine comprising a toxoplasma strain according to any one of the above embodiments, or a toxoplasma strain produced by any one of the above construction methods.

Preferably, the vaccine is a transgenic toxoplasma live vaccine.

As a preferred embodiment of the invention, the vaccine contains an adjuvant.

As a preferred embodiment of the invention, the vaccine contains a buffer or culture.

Preferably, the buffer is PBS and the culture medium is DMEM.

In particular embodiments, including but not limited to, immunization of an animal with the vaccine;

preferably, at the time of animal vaccination, the tachyzoites of the vaccine are mixed with PBS or DMEM to make a suspension and then injected for vaccination.

Further, the invention also provides the use of a toxoplasma strain according to any one of the embodiments described above, or a method of constructing any one of the embodiments described above, or a vaccine according to any one of the embodiments described above, in at least one of the following:

(1) Preparing a medicament for preventing or treating toxoplasma infection;

(2) Preparing a medicament for preventing or treating coronavirus infection;

(3) Improving immunity.

Compared with the prior art, the invention has the beneficial effects that:

the toxoplasma strain expressing the RBD protein of the coronavirus has higher safety to a host, can induce organisms to generate stronger humoral immune response and cellular immune response, can prevent toxoplasma infection, effectively prevent toxoplasma oocyst from being discharged, and can prevent novel coronavirus infection.

Drawings

In order to more clearly illustrate the invention or the technical solutions of the prior art, the following description will briefly explain the drawings used in the embodiments or the description of the prior art, and it is obvious that the drawings in the following description are some embodiments of the invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 is a schematic diagram showing the insertion and identification of RBD gene in example 1 of the present invention.

FIG. 2 is a graph showing the PCR identification result of RH ΔKu80RBD insect strain in example 1 of the present invention; wherein Clone14, clone15 and Clone16 represent different clones of RH ΔKu80 RBD;

PCR (1) for identifying 5' homologous recombination (1515 bp),

PCR (2) for identifying 3' homologous recombination (1010 bp),

PCR (3) for amplifying RBD gene fragments (584 bp);

PCR (4) for identification of UPRT CDS (316 bp).

FIG. 3 is a graph showing the results of intracellular proliferation rate of RH Δku80-RBD insect strains in example 2 of the present invention.

FIG. 4 is a graph showing the results of toxicity experiments of RH Δku80-RBD insect strains in mice in example 2 of the present invention.

FIG. 5 is a schematic illustration of the experimental procedure (A) and the test result (B) of the rat weight change in the rat immunoprotection experiment in example 2 of the present invention.

FIG. 6 is a graph showing the results of detecting changes in the levels of antibodies and cytokines in serum at various times when mice were immunized in example 3 of the present invention.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is apparent that the described embodiments are some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The examples are not intended to identify the particular technology or conditions, and are either conventional or are carried out according to the technology or conditions described in the literature in this field or are carried out according to the product specifications. The reagents and instruments used, etc. are not identified to the manufacturer and are conventional products available for purchase by regular vendors.

Toxoplasma Δku80 RH strain is disclosed in (Huynh, m.h. and Carruthers, v.b. (2009). Tagging of endogenous genes in a Toxoplasma gondii strain lacking Ku80.Eukaryotic Cell 8, 530-539).

EXAMPLE 1 construction of Toxoplasma gondii Strain expressing RBD protein

An insect strain expressing RBD protein is constructed by taking delta Ku80 RH as a basic insect strain.

Δku80 RH is a toxoplasma species type I strain that loses the ability to form cysts in animals. The amino acid sequence of RBD is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO. 2.

1. Experimental reagent and conditions

(1) Fragment amplification

The pUPRT-Tub-Gra8ss-RBD-3HA-UPRT vector is amplified by three fragments, and the primer sequences are as follows:

fragment one:

an upstream primer: backbone-1Fw (SEQ ID NO. 3)

GTCTCTAGTTTTTTTGACAGAC；

A downstream primer: backbone-1Rv (SEQ ID NO. 4)

ATTCTGTTGGTTGGACTCTCAAAGGACCGTTCATGGCGCGA；

Fragment two:

an upstream primer: backbone-2Fw: (SEQ ID NO. 5)

TGTCAATTTCGGTGGAGGTGGAAGT；

A downstream primer: backbone-2Rv: (SEQ ID NO. 6)

CTGTCAAAAAAACTAGAGACCTACCCTACAAACCAAGACTGA; fragment three:

an upstream primer: RBD-Fw (SEQ ID NO. 7)

AGAGTCCAACCAACAGAATCTA；

A downstream primer: RBD-Rv (SEQ ID NO. 8)

GAAATTGACACATTTGTTTT。

All the above DNA fragments were treated with the NEB Q5 high-fidelity DNA polymerase @ Co

High-Fidelity DNA Polymerase), the PCR reaction system is shown in Table 1, and the PCR reaction conditions are shown in Table 2.

TABLE 1PCR reaction System

TABLE 2PCR reaction conditions

Note that: q5 high-fidelity DNA polymerase extends at least 2kb per minute, so the extension time is determined by the specific amplified fragment length.

After the PCR reaction is finished, the target fragment is recovered by running gel, and gel is purified by using a gel recovery kit of TransGen Biotech company

Quick Gel Extraction Kit) purifying and recovering each DNA fragment.

(2) Fragment ligation

The purified DNA product was ligated using a multi-fragment seamless cloning kit from TransGen Biotech company

Basic Seamless Cloning and Assembly Kit). The reaction system is shown in Table 3.

TABLE 3 reaction conditions for the multi-fragment ligation

The reaction system was gently mixed and reacted at 50℃for 15min, after the reaction was completed, the mixture was cooled on ice. The product was transferred to 50. Mu.L of Trans1-T1 competent cells (TransGen Biotech, trans1-T1 Phage Resistant Chemically Competent Cell), gently mixed, placed on ice for 30min, heat-shocked on a metal bath at 42℃for 1min, immediately thereafter onto ice for 2min. mu.L of LB medium was added and incubated for 1h at 250rpm on a shaker at 37 ℃. mu.L of the solution was uniformly spread on an ampicillin-resistant plate. After 24 hours, several monoclonal samples were picked for sequencing, and the sequencing primers used for one reaction at each junction of the three fragments. Sequencing results showed no errors at the junction of the three fragments and successful plasmid construction.

(3) Plasmid pSAG1-CAS 9-TgU-sgUPRT was extracted for use using PL 14-Large Scale plasmid extraction kit (Aidlab biotechnologies CO.Ltd).

2. preparation of pUPRT-Tub-Gra8ss-RBD-3HA-UPRT vector

(1) The RBD gene was amplified using the Q5 high-fidelity DNA polymerase and pET28a-2019-nCoV-S plasmid (purchased from plasmid pal) as a template, and the amplification primer sequences were as follows: an upstream primer: RBD-Fw (SEQ ID NO. 7)

AGAGTCCAACCAACAGAATCTA；

A downstream primer: RBD-Rv (SEQ ID NO. 8)

GAAATTGACACATTTGTTTT。

(2) Use of Q5 high fidelity DNA polymerase

The pUPRT-Tub-Gra8ss-OVA-3HA-DHFR-UPRT vector was amplified for the backbone, and the primer sequence was as follows:

fragment one:

Backbone-1Fw:(SEQ ID NO.3)

GTCTCTAGTTTTTTTGACAGAC；

Backbone-1Rv:(SEQ ID NO.4)

ATTCTGTTGGTTGGACTCTCAAAGGACCGTTCATGGCGCGA; fragment two:

Backbone-2Fw：(SEQ ID NO.5)

TGTCAATTTCGGTGGAGGTGGAAGT；

Backbone-2Rv：(SEQ ID NO.6)

CTGTCAAAAAAACTAGAGACCTACCCTACAAACCAAGACTGA；

(3) After the amplification products of RBD genes and cloning vector skeletons are cut and purified, three fragment products are connected, transformed, plated and monoclonal selected by using a multi-fragment kit, and sample-feeding sequencing is carried out for identification, wherein the specific steps refer to the preparation process of pUPRT-Tub-Gra8ss-RBD-3HA-UPRT plasmids.

(4) And (3) taking bacterial liquid with correct sequencing as a template, and taking 5H-UPRT-Fw/3H-UPRT-Rv as a primer for amplification to obtain the template. 50 mu L of reaction system is amplified into 4 tubes, 3 mu L of PCR products are taken for gel running identification, and if target bands exist, DNA purification is carried out on the rest PCR products, and the operation steps are as follows:

a: adding 10 times volume of absolute ethyl alcohol into the PCR product, and standing at-20 ℃ for more than 1 h;

b: centrifuging at 10000rpm for 10min at 4deg.C, and discarding supernatant;

c: adding 500 μL of 75% ethanol, centrifuging at 10000rpm at 4deg.C for 5min, discarding supernatant, volatilizing ethanol, adding 50 μL of sterile water to dissolve precipitate, and preserving at-20deg.C.

3. Construction of Toxoplasma gondii expressing exogenous protein RBD

(1) Collect 5X 10 ⁶ The freshly released Δku80 RH tachyzoites were filtered off with a 5 μm filter to remove cell debris and centrifuged at 2000rpm for 5min, and the supernatant was discarded.

(2) Add 2ml cytomix buffer (120mM KCl,0.15mM CaCl) ₂ ，10mM K ₂ HPO ₄ /KH ₂ PO ₄ ，25mM HEPES，2mM EGTA，5mM MgCl ₂ Ph=7.6) the pellet was resuspended, centrifuged at 2000rpm for 5min and the supernatant discarded.

(3) mu.L of cytomix buffer was added to a volume of about 80. Mu.L of pUPRT-Tub-Gra8ss-RBD-3HA-UPRT template (50. Mu.g) and pSAG1-CAS9-TgU6-sgUPRT plasmid (20. Mu.g), and the mixture was mixed well and added to an electric rotating cup having a diameter of 4 mm.

(4) Setting an electrotometer program: voltage 2000V, capacitance 25F, resistance infinity. Toxoplasma is transfected and inoculated into HFF cells for culture, and the culture medium is replaced by a culture medium containing 3 mu M of 5-fluorodeoxyuridine with a final concentration after 24 hours.

(5) Screening of monoclonal: after three generations of drug screening, monoclonal screening was performed. A bottle of confluent HFF cells (T25) was digested, added to a 96-well plate (100. Mu.L per well volume), worms were collected, counted with a cell counting plate, diluted to 300 tachozoites/ml, 100. Mu.L worms were added to each end of the 96-well plate, and serial multiple dilutions (30, 15, 7.5, 3.75, 1.875, 0.9375) were performed, and 100. Mu.L of medium was supplemented per well after the dilution was completed.

(6) Culturing in a cell culture incubator (37 ℃,5% CO) ₂ ) After 7 days, wells with only one plaque were selected under the microscope and transferred to 12 well plates with vero cells confluent for 3 days.

(7) The monoclonal insect strain in a part of 12-well plates is taken for identification (Tiangen biochemical technology (Beijing) limited company, blood/cell/tissue genome DNA extraction kit), and the DNA extraction method refers to the cell DNA extraction method of the kit. The identification primers were as follows: PCR1:

5’-UPRT-Fw：TCCCTTCCAACTCTCCGCTT；(SEQ ID NO.9)

5’-UPRT-Rv：ATGGCGCGAGCTACACCAAA；(SEQ ID NO.10)PCR2：

3’-UPRT-Fw：TTTCAGATTTGCAAAAGTCC；(SEQ ID NO.11)

3’-UPRT-Rv：TAGTTCAAATAACTCGATAAATTA；(SEQ ID NO.12)PCR3：

RBD-Fw：AACCAACAGAATCTATTGTT；(SEQ ID NO.13)

RBD-Rv：AAAAGAAAGTACTACTACTCT；(SEQ ID NO.14)

PCR4：

UPRT-CDS-Fw：TTCCCAATGTGGTGCTCATGAAG；(SEQ ID NO.15)UPRT-CDS-Rv：AATTCTTCCTTCGGTGTTTCTTTA；(SEQ ID NO.16)

the RBD gene insertion and identification strategy is shown in figure 1, wherein the transgenic insect strain PCR1/PCR2/PCR3 has target bands, and the PCR4 has no target bands; the wild insect strain PCR1/PCR2/PCR3 has no target band, and the PCR4 has target band, so the transgenic insect strain is a positive monoclonal insect strain. As shown in FIG. 2, the RBD gene insert insect strain identified as correct was designated RH Δku80-RBD insect strain.

EXAMPLE 2 proliferation Rate, virulence and immunoprotection assays of Toxoplasma strains expressing RBD proteins

1. In vitro proliferation experiment of RH delta ku80-RBD insect strain

The intracellular proliferation rate of the toxoplasma gondii strain RH delta ku80-RBD expressing the RBD protein constructed in the example 1 is detected, and the specific method is as follows:

collecting the tachyzoites of the freshly released RH DeltaKu 80 and RH Deltaku 80-RBD insect strains, and inoculating 10 respectively ⁵ Tachyzoites were plated into 12-well plates (sterile cell slide prior to plating) filled with HFF cells (human foreskin fibroblasts, purchased from ATCC). After 1h inoculation, uninjured worms were washed off and the culture was continued in an incubator. After 24 hours or 48 hours of cultivation, IFA test was performed as follows:

(1) toxoplasma-infected cells were fixed at 37 ℃ for 30min in 4% paraformaldehyde.

(2) Permeabilization in 0.25% Triton X-100 for 30min at 37 ℃.

(3) Blocking was performed in 3% BSA at 37℃for 30min.

(4) A primary antibody against the rabbit-derived Toxoplasma gondii GAP45 protein (Plattner, F., yarovinsky, F., romero, S., didry, D., carlier, M.F., sher, A.and Soldati-Favre, D. (2008) Toxoplasma profilin is essential for host cell invasion and TLR11-dependent induction of an interleukin-12response.CELL HOST MICROBE 3,77-87.) was added and incubated at 37℃for 1h and washed 3 times with PBS.

(5) Secondary anti-FITC/Cy 3-labeled goat anti-mouse IgG (H+L) and nuclear dye Hoechst33258 (both purchased from Beijing Mich. Technology Co., ltd.) were added and incubated at 37℃for 1H. The PBS was washed 3 times.

(6) 10 mu L of anti-fluorescence quenching agent sealing sheet is added on the sheet, and the number of tachyzoites in the artemia cavity membrane is counted under a fluorescence microscope.

Counting the ratio of the nano-insect vacuoles of the delta ku80 insect strain and the delta ku80-RBD insect strain in different proliferation stages, wherein each insect strain randomly counts 100 nano-insect vacuoles, and #14, #15 and #16 are three different monoclonal of the delta ku80-RBD insect strain;

as shown in FIG. 3, there was no significant difference in the in vitro proliferation rate of the RH Δku80-RBD strain compared to the starting strain after 24h growth in HFF cells.

2. Mouse virulence experiment of RH delta ku80-RBD insect strain

The toxicity of the toxoplasma gondii strain RH delta ku80-RBD, which expresses the RBD protein and is constructed in the example 1, is detected by the following specific method:

intracellular RH delta Ku80-RBD insect strains are collected, BALB/c mice (female, 6 weeks) are inoculated intraperitoneally with 100 tachyzoites respectively, 100RH delta Ku80 tachyzoites are inoculated as a control group, and a group of blank control groups are further arranged. Each group of 4 mice, 3 groups of mice were individually kept in the same environment, survival of the mice was recorded daily, and observation time was 10 days.

The results are shown in FIG. 4, where mice vaccinated with RH ΔKu80 and RH Δku80-RBD insect strains all died within day 9, while mice from the placebo group all survived; indicating that there is no significant difference in RH Δku80-RBD toxicity from RH ΔKu80.

3. Rat immunoprotection experiments with RH delta ku80-RBD insect strains

The RH delta ku80-RBD insect strain is adopted to immunize rats, the immune protection efficacy, immunization, toxicity attack, detection and other experimental procedures are shown in the figure 5A, and the specific method is as follows:

(1) Wistar rats (females, 5 weeks) were immunized 10 each ⁴ RH Δku80-RBD tachyzoites (immunized group) with non-immunized mice as control (non-immunized group), each group of mice was kept under the same conditions. After 14 days of immunization, rats in immunized and non-immunized groups were bled for tail vein and immunized a second time, each of the experimental groups was immunized 10 ⁴ RH Δku80-RBD tachyzoites. After 14 days of the second immunization, tail vein blood collection was performed on immunized and non-immunized rats, and serum was isolated and stored at-80 ℃ for later use. (for humoral immunity of example 3).

(2) After 14 days of the second immunization, the immunized and non-immunized groups were sacrificed and the lungs, livers, spleens of the rats were collected. The transcription level of cytokines associated with the immune response of rats after the inoculation of RH delta ku80-RBD was detected by qPCR method. After spleen, lung and liver are stimulated by RH delta ku80-RBD, the relative transcription level of IL-4 and TNF-alpha cytokines is obviously increased compared with the control group. The results are shown in FIG. 6, which shows that RH Δku80-RBD can trigger specific immune responses in the host.

The results of the body weight change test for the rats in the experimental and control groups throughout the immunization period are shown in fig. 5B.

EXAMPLE 3 humoral immune monitoring of RH Δku80-RBD insect strain immunized hosts

The humoral and cellular immune responses of rats immunized with the RH Δku80-RBD strain of example 2 were examined as follows:

1. detection of toxoplasma related IgG antibodies in rat serum

(1) Antigen coating: toxoplasma whole antigen was prepared, 100 μl (5 μg/ml, PBS) was added to 96-well plates, overnight at 4 ℃.

(2) Closing: 300 μl of PBST was added to each well, allowed to stand for 5min, spun dry, washed repeatedly 5 times, and blocked for 1 hour at 1% BSA room temperature.

(3) Primary antibody (rat serum) was added: the mixture was washed 5 times in the same manner as in the step (2), and 100. Mu.L (1:25 dilution) of rat serum was added thereto and incubated at 37℃for 1 hour.

(4) Adding a secondary antibody: washing 5 times in the same step (2), adding HRP-marked goat anti-mouse IgG secondary antibody and incubating for 1 hour at 37 ℃.

(5) Color development: washing 5 times in the same step (2), adding TMB, and developing at 37 ℃ for 15min.

(6) And (3) terminating: the reaction was terminated by adding 2mol/L sulfuric acid solution, and the value of 450nm was immediately read on a microplate reader.

2. Determination of RBD-related IgG antibodies in rat serum

2.1 preparation of experiment:

(1) The kit is taken out of the refrigerated environment and left to equilibrate at room temperature (18-25 ℃) for at least 30min.

(2) Preparing a washing liquid working solution: adding 20 times of concentrated lotion into deionized water or distilled water according to the ratio of 1:19, and uniformly mixing for later use. For example, a bottle of 30mL of 20-fold concentrated wash solution can be configured to 600mL of wash solution.

(3) Preparing enzyme-labeled antibody working solution: 100 mu L of 100 XELIAS antibody is added into 9.9mL of ELIAS antibody diluent, and the mixture is mixed up and down for at least 30 times to prepare the ELIAS antibody working solution. Note that: the enzyme-labeled antibody working solution can be stored at 2-8 ℃ for use in the same day, the working solution dosage can be prepared according to the number of samples to be tested, and 100 mu L of enzyme-labeled antibody working solution is needed for each set of 1 sample or contrast.

(4) Diluting a sample to be tested:

and (3) primary detection: the sample to be measured is diluted with a sample diluent according to a ratio of 1:40, and then diluted according to a ratio of 1:20 on the basis to be used as a first hole, and then subjected to 3-time gradient dilution, wherein 7 gradients are obtained in total.

Subsequent analysis: based on the primary detection result, proper dilution or serial dilution is selected for further analysis of the sample reactivity.

(5) The temperature of the incubator is regulated to 37 ℃ and the incubator is used after the temperature is stable.

2.2 experimental procedure:

(1) Sample adding: the pre-coated strip was mounted on a plate rack, with each test having 3 wells for negative control, 2 wells for positive control, at least 3 wells between the two controls, 100 μl of the corresponding volume was added, and 100 μl of the diluted sample to be tested was added to the reaction wells.

(2) Incubation: cover the sealing plate membrane and incubate at 37℃for 60min.

(3) Washing: removing liquid in the holes, adding diluted washing liquid, removing washing liquid in the holes by not less than 300 mu L of each hole, repeating washing for 5 times, and drying.

(4) Adding enzyme: 100 mu L of enzyme-labeled antibody working solution is added into each well.

(5) Incubation: cover the sealing plate membrane and incubate at 37℃for 30min.

(6) Washing: removing liquid in the holes, adding diluted washing liquid, removing washing liquid in the holes by not less than 300 mu L of each hole, repeating washing for 5 times, and drying.

(7) Color development: 100 mu L of TMB substrate solution is added into each hole, a sealing plate film is covered, and the mixture is incubated for 10min at 37 ℃ in a dark place.

(8) And (3) terminating: the reaction was stopped by adding 50. Mu.L of stop solution to each well.

(9) Reading: the OD of each well was measured at two wavelengths of 450nm and 630nm by microplate reader.

As shown in FIG. 6, the serum IgG concentration of the mice immunized with RH delta ku80-RBD strain is significantly higher than that of the non-immunized group 14 days and 28 days, and the results show that the RH delta ku80-RBD strain can provide better humoral immunity for the host after immunization.

In summary, the invention provides a toxoplasma gondii live vaccine for expressing RBD protein, and determines safe immune dosage and immune program. Through rat experiments, the toxoplasma strain expressing the RBD protein can generate stronger humoral immune response and cellular immune response level after being immunized. The infection of toxoplasma strain and SARS-CoV-2 virus can provide effective protection, and secondary immunity can provide long-term protection effect.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A toxoplasma strain expressing a coronavirus RBD protein, wherein said toxoplasma strain comprises an amino acid sequence encoding a coronavirus RBD protein;

the amino acid sequence is shown as SEQ ID NO. 1.

2. The toxoplasma strain according to claim 1, wherein the nucleic acid sequence encoding the amino acid sequence is as shown in SEQ ID No. 2.

3. A toxoplasma strain according to claim 1 or 2, wherein the toxoplasma strain is a toxoplasma type I, type II or type III strain.

4. A method of constructing a toxoplasma strain according to any one of claims 1 to 3, comprising: the gene encoding RBD protein is introduced into toxoplasma strain by transgenic technology.

5. The method of construction of claim 4, wherein the transgenic technology employs a CRISPR/Cas system.

6. The method of construction according to claim 5, comprising:

7. A vaccine comprising a toxoplasma strain according to any one of claims 1 to 3, or a toxoplasma strain obtainable by a construction method according to any one of claims 4 to 6.

8. The vaccine of claim 7, further comprising an adjuvant.

9. The vaccine of claim 7, further comprising a buffer or culture.

10. Use of a toxoplasma strain according to any one of claims 1 to 3, or a method of construction according to any one of claims 4 to 6, or a vaccine according to any one of claims 7 to 9, in at least one of the following:

(1) Preparing a medicament for preventing or treating toxoplasma infection;

(2) Preparing a medicament for preventing or treating coronavirus infection;

(3) Improving immunity.