CN116327912A

CN116327912A - Herpes zoster vaccine composition

Info

Publication number: CN116327912A
Application number: CN202111586711.8A
Authority: CN
Inventors: 张超; 鲁阳; 朱钱钧; 张玲莉; 杨蕴琦; 郭慧丽; 王紫琰; 胡冬冬; 钱大伟; 刘海平; 刁美君; 沈巧英; 周晨亮; 刘革
Original assignee: Shanghai Zerun Biotech Co Ltd
Current assignee: Shanghai Zerun Biotech Co Ltd
Priority date: 2021-12-23
Filing date: 2021-12-23
Publication date: 2023-06-27
Also published as: WO2023116374A1

Abstract

The present invention relates to a herpes zoster vaccine composition comprising varicella zoster virus antigen and a composite adjuvant, wherein the composite adjuvant comprises a CpG oligodeoxynucleotide, QS-21 and a liposome, wherein the CpG oligodeoxynucleotide is CpG7909. According to the present invention, the composition can induce a strong antibody response and a T cell immune response for preventing varicella-zoster virus infection.

Description

Herpes zoster vaccine composition

Technical Field

The present invention relates to the field of vaccines. In particular, the invention relates to a herpes zoster vaccine composition.

Background

Varicella-zoster virus (VZV) is one of eight human herpesviruses, also known as human herpesvirus type 3. Varicella-zoster virus is very contagious and widely distributed throughout the world, but only one viral serotype has been found to date, and VZV infects humans only in nature. After VZV infection in humans, primary infections often lead to varicella in childhood, after which the virus can remain dormant in the brain ganglion and dorsal root ganglion of the human for a long period of time. When the body ages or otherwise has reduced immunity or impaired immune function, VZV may reactivate and cause shingles and other complications.

The herpes zoster clinically appears as unilateral vesicular rash, the patient can have obvious pain and discomfort, symptoms can last for weeks or months, and in severe patients, the herpes zoster can last for years, so that the quality of life is reduced, and in rare cases, the herpes zoster can not appear. Complications occur in about 25% of people with shingles and increase with age. The most common serious complications are postherpetic neuralgia (post-herpetic neuralgia, PHN), i.e. pain which persists after the acute phase of the herpes, with a incidence of 10% -30% in patients with herpes zoster, which can last for months or even years, severely affecting the quality of life of the patient; next to ocular shingles (herpes zoster ophthalmicus, HZO), there is a 10% -20% incidence in shingles patients; other complications include motor nerve injury and other nervous system complications such as meningitis, etc.

Since shingles is a disease induced by reactivation of latent VZV, its main cause of onset is the break of the latent state of the virus due to a decrease in host immunity or immunodeficiency. In general, the main causes of the decline in immunity are from an increase in age, a defect in immune function, or immunosuppression. Thus, the older the age, the higher the incidence of shingles and PHN, and the severity and duration of the associated pain also increases with age. The annual incidence of shingles in the 40-49 year old population is about (2-3)/1000, with a rapid increase in annual incidence from 50 years old, with more than 65% of cases of shingles occurring in adults 50 years and older. The risk of shingles in humans during life is about 25% -30%, but this risk increases to 50% in people over 80 years old. Herpes zoster also has a high incidence and recurrence rate in patients who need to take immunosuppressive drugs, who have had their immune function impaired due to tumor chemotherapy or infection with human immunodeficiency virus.

The herpes zoster is not brought into the national legal reporting infectious disease category of class A and class B in China at present, and epidemiological data is not enough. Part of the researches report that the comprehensive annual incidence rate of the herpes zoster in the group over 50 years old in 2011-2013 in Guangdong area of China is about 4.3/1000; the incidence rate of the herpes zoster in the 2012-2013 period of Beijing area rapidly rises from the age of 40 years, the age of 60-69 years is mainly high-incidence age, the comprehensive annual incidence rate of the herpes zoster in the population over 50 years is about 4.7/1000 people, and the incidence rate of females is higher than that of males. From the above study data, the disease condition of herpes zoster in China is not optimistic, and the disease burden of the herpes zoster is aggravated especially with the aging of the population in China. In other areas of the world, the onset of shingles is slightly different from China, but is equally optimistic. In asia-pacific regions, the incidence peaks in korea, japan and the like are around 70 years, while the incidence peaks in australia, new zealand and the like are around 80 years. And korea is a country where the incidence rate is relatively high in the entire asia-pacific area, and the highest annual incidence rate of shingles exceeds 20/1000. In Europe and the United states, the highest annual incidence of shingles in the elderly is mainly around 10/1000.

The herpes zoster and postherpetic neuralgia increase the times of patient's visits and hospitalization, seriously affect the quality of life of the patient, and bring great social and economic burden. The existing research estimates that the average medical cost of domestic herpes zoster patients in 2010-2012 reaches 840 yuan, and the total medical cost of domestic herpes zoster patients in 2010-2012 reaches 13.14 hundred million yuan each year. Thus, in the face of such severe disease burden, there is an urgent need for more and better disease treatment and prevention drugs, particularly prophylactic vaccines, to reduce the incidence of shingles.

There are 9 currently established VZV viral surface glycoproteins, gB, gC, gE, gH, gI, gK, gL, gM and gN, respectively. The gE glycoprotein is the glycoprotein with the highest expression level of the VZV, plays a main role in the replication and assembly processes of the virus and also mediates the transmission of the virus among cells. In view of the strong immunogenicity of VZV gE, it has been one of the primary candidate antigens for VZV subunit vaccines and DNA vaccines to induce an immune response against VZV in the body.

It is currently known that gE proteins alone are not able to induce a strong cellular immune response in animal models and that the immune response of gE must be enhanced by means of an adjuvant.

However, the current aluminum adjuvants have weak immune enhancement effect, and mainly generate humoral immunity, which cannot meet the development requirement of herpes zoster vaccine.

Disclosure of Invention

In view of the above, an object of the present invention is to provide a herpes zoster vaccine composition which can effectively enhance antibody response and T cell immune response.

The present invention relates to a herpes zoster vaccine composition comprising varicella zoster virus antigen and a composite adjuvant, wherein the composite adjuvant comprises a CpG oligodeoxynucleotide, QS-21 and a liposome, wherein the CpG oligodeoxynucleotide is CpG7909.

According to the present invention, there can be provided a herpes zoster vaccine composition which induces a strong antibody response and T cell immune response in the body.

Drawings

FIG. 1 shows the results of particle size detection (Z-average: 113.5nm,PDI 0.196) of a composite adjuvant sample according to one embodiment of the present invention.

FIG. 2 shows the results of particle size measurements (Z-average: 96.7nm, PDI 0.164) of a composite adjuvant sample according to another embodiment of the invention.

FIG. 3 shows a gel image of non-denaturing PAGE of the gE protein in the supernatant of CHO cell fermentation (FIG. 3A) and a SDS-PAGE image of the purified gE protein (FIG. 3B).

Figure 4 shows the antibody response induced by immunized mice after the recombinant gE protein was combined with different complex adjuvant components.

Figure 5 shows T cell responses induced by immunized mice after the recombinant gE protein was combined with different complex adjuvant components.

Figure 6 shows the antibody response induced by immunized mice after different doses of recombinant gE protein and different component dose-ratios of the compound adjuvant combined preparation.

Figure 7 shows T cell responses induced by immunized mice after different doses of recombinant gE protein and different component dose-ratios of the compound adjuvant combined preparation. Detecting CD4+ T cell reaction results by A flow cytometry; the B FluoSpot method detects T cell reaction results.

FIG. 8 compares the antibody response induced by vaccines and commercial Shegnix vaccines in mice after combination of recombinant gE protein with different complex adjuvants.

FIG. 9 compares the T cell response induced by vaccines and commercial Shegnix vaccines in mice after combination of recombinant gE protein and different complex adjuvants.

FIG. 10 compares the antibody response induced in cynomolgus monkeys by recombinant herpes zoster vaccine of the invention and commercial Shegrix vaccine.

FIG. 11 compares T cell responses induced in cynomolgus monkeys by recombinant herpes zoster vaccine of the invention and commercial Shegrix vaccine.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, but methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.

For all numerical ranges referred to in this disclosure, it is understood that all specific values within that range are disclosed, as well as subranges defined by any two values within that range. For example, with respect to 1% -10%, it is to be understood that specific values of 1%, 2%, 3%, 3.5%, 4.5%, 10%, etc., as well as subranges of 1% -5%,2% -6%,3.5% -7.5%, etc., are disclosed.

The present invention provides a herpes zoster vaccine composition comprising a varicella zoster virus antigen and a composite adjuvant, wherein the composite adjuvant comprises a CpG oligodeoxynucleotide, QS-21 and a liposome, wherein the CpG oligodeoxynucleotide is CpG7909.

CpG oligodeoxynucleotide (CpG ODN) is an artificially synthesized short single-chain DNA molecule, contains unmethylated cytosine guanine dinucleotide sequences, can simulate the combination of bacterial DNA and activate Toll-like receptor 9 (TLR 9) of mammals including human beings, directly activate B cells and monocytes, indirectly activate various immune effector cells such as NK cells and T cells, strengthen the functions and secretion of cytokines, and induce Th1 type immune response. The CpG ODN used in the present invention is CpG7909, also referred to as CpG2006, ODN7909 or ODN2006.CpG7909 has the following nucleotide sequence: TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID No. 2).

QS-21 is an active ingredient extracted from the bark of Quillaja saponaria Molina (Quillaja Saponaria) and is capable of eliciting a mouse CD8+ cellular immune response, producing IgG1 and IgG2a antibodies, and promoting secretion of Th1 cytokines, interleukin 2 and gamma interferon by T lymphocytes. However, QS-21 alone has significant haemolytic toxicity when used as an adjuvant.

In a preferred embodiment, the concentration of CpG ODN is in the range of 0.25 to 2mg/mL of the composite adjuvant. In a more preferred embodiment, the concentration of CpG ODN is 0.25, 0.5, 0.75, 1, 1.25, 1.5, 1.75 or 2mg/mL of the compound adjuvant.

In a preferred embodiment, the concentration of QS-21 ranges from 25 to 200 μg/mL of the compound adjuvant. In a more preferred embodiment, the concentration of QS-21 is 25, 50, 75, 100, 125, 150, 175 or 200 μg/mL of the composite adjuvant.

In a preferred embodiment, the relative weight ratio of CpG ODN to QS-21 is from 5:1 to 20:1. In a more preferred embodiment, the relative weight ratio of CpG ODN to QS-21 is 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1.

The inventors found that by formulating QS-21 in combination with a liposome carrier, the adsorption of QS-21 to the liposome carrier can significantly reduce the potential in vivo hemolytic toxicity side effects.

In a preferred embodiment, the liposome comprises Phosphatidylcholine (PC) and Cholesterol (CHOL). In a more preferred embodiment, the liposome consists of Phosphatidylcholine (PC) and Cholesterol (CHOL).

Phosphatidylcholine (PC) is a structure in which choline is combined with two fatty acids via phosphate groups to form an ester bond. Structurally quaternary amines and hydroxyl groups on choline can be separated directly by multiple carbon atoms. The two fatty acids are 12 to 18 carbon atoms in length, with the possible presence of one or more unsaturated double bonds. Among them, preferred is dioleoyl phosphatidylcholine (DOPC) having a structure shown below, which is 18 carbons long and contains 1 unsaturated double bond.

Cholesterol is a lipid widely existing in human body, is an important component of cell membrane, and has functions of stabilizing liposome and reducing permeability of lipid membrane. Cholesterol is composed of a steroid moiety and a long side chain, and different cholesterol derivatives differ from each other. In one embodiment, cholesterol derivatives having a side chain length of 4-8 carbon chains are preferred, in which the steroid moiety structure is the same as in the following formula. In another embodiment, cholesterol having a structure as shown below is preferred.

In a preferred embodiment, the concentration range of phosphatidylcholine is 0.5-4 mg/mL of the compound adjuvant. In a more preferred embodiment, the concentration of phosphatidylcholine is 0.5, 1, 1.5, 2, 2.5, 3, 3.5 or 4mg/mL of the complex adjuvant.

In a preferred embodiment, the concentration range of cholesterol is 0.125-1 mg/mL of the compound adjuvant. In a more preferred embodiment, the concentration of cholesterol is 0.125, 0.25, 0.375, 0.5, 0.625, 0.75, 0.875 or 1mg/mL of the compound adjuvant.

In a preferred embodiment, the varicella zoster virus antigen is varicella zoster virus glycoprotein gE, more preferably an extracellular region fragment of gE. In a most preferred embodiment, the varicella zoster virus antigen is a gE extracellular region fragment with the amino acid sequence as shown in SEQ ID No. 1. In one embodiment, the varicella zoster virus antigen comprises an amino acid sequence having 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity with the amino acid sequence as set forth in SEQ ID No. 1. In one embodiment, the nucleic acid encoding a gE extracellular region fragment having the amino acid sequence of SEQ ID No.1 has the nucleotide sequence shown in SEQ ID No. 3.

It will be appreciated by those skilled in the art that the amount of varicella-zoster virus antigen to be used in the herpes zoster vaccine composition is not particularly limited as long as it can function as a herpes zoster vaccine composition. In one embodiment, the varicella-zoster virus antigen is present in the zoster vaccine composition at a concentration ranging from 20 to 400 μg/mL. In a preferred embodiment, the varicella zoster virus antigen is present in the zoster vaccine composition at a concentration of from 50 to 200 μg/mL. In another embodiment, the varicella-zoster virus antigen is present in the shingle vaccine composition at a concentration of, for example, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 μg/mL.

As a non-limiting example, the herpes zoster vaccine composition of the invention may be obtained by dissolving varicella-zoster virus antigen in a compound adjuvant. For example, varicella-zoster virus antigen as a lyophilized powder may be dissolved in 0.5mL of a compound adjuvant liquid, mixed well, and formulated for injection in unit dose form. In one embodiment, the varicella zoster virus antigen is present in an amount of from 10 to 200 μg per dose, more preferably from 25 to 100 μg per dose.

It will be appreciated by those skilled in the art that although the contents of the components and the like in the herpes zoster vaccine composition of the present invention are described in detail hereinabove, they may be appropriately determined by those skilled in the art without being limited to the specific examples enumerated above.

Examples

Specific examples are provided below to further illustrate the invention.

Example 1: preparation of liposome composite adjuvant by ethanol injection method

Dioleoyl phosphatidylcholine (DOPC) and Cholesterol (CHOL) were purchased from Ai Weita (Shanghai) pharmaceutical technologies Inc., QS-21 was purchased from Desert King International (USA), and CpG7909 was purchased from Guangzhou Ruibo biological Co.

Buffer 1 preparation:

respectively weigh Na ₂ HPO ₄ 12H ₂ O 0.6446g、KH ₂ PO ₄ 1.1207g and 1.1702g NaCl are put into a container, 200ml injection water is added, and the mixture is stirred and dissolved to obtain 9mM Na ₂ HPO4、41mM KH ₂ PO ₄ 、100mM NaCl、Buffer at pH 6.1. Labeled buffer 1. Sterilizing and filtering for standby.

Buffer 2 preparation:

respectively weigh Na ₂ HPO ₄ 12H ₂ O 0.1432g、KH ₂ PO ₄ 0.2177g and NaCl 1.755g are put into a container, 200ml of water for injection is added, and stirred and dissolved to obtain 2mM Na ₂ HPO ₄ 、8mM KH ₂ PO ₄ 150mM NaCl, pH 6.1. Labeled buffer 2. Sterilizing and filtering for standby.

Organic phase solution preparation:

accurately weighing 0.400g of DOPC and 0.100g of CHOL in an EP tube, sucking 20ml of absolute ethyl alcohol by a pipette, adding the absolute ethyl alcohol into the EP tube, and ultrasonically dissolving the absolute ethyl alcohol to obtain a mixed solution of 20mg/ml DOPC and 5mg/ml CHOL.

QS-21 solution formulation:

precisely weighing a proper amount of QS-21, adding buffer solution 1, and dissolving by ultrasonic to prepare the QS-21 with the concentration of 2mg/ml.

CpG7909 solution preparation:

0.402g of CpG7909 freeze-dried powder is precisely weighed, dissolved in 50ml of PBS, and detected by an ultra-micro spectrophotometer to have a concentration of 5.242mg/ml.

10ml of CpG7909 solution with the concentration of 5.242mg/ml, 5ml of QS-21 solution with the concentration of 2mg/ml and 75ml of buffer solution 1 are precisely measured in a glass vial, and uniformly stirred and mixed to be used as a water phase.

Precisely 10ml of a mixed solution of DOPC with the concentration of 20mg/ml and CHOL with the concentration of 5mg/ml was measured, added dropwise to the aqueous phase with stirring at 600rpm at room temperature. After all the dropwise addition was completed, stirring was continued for 30 minutes. Namely the liposome composite adjuvant intermediate.

100ml of the liposome composite adjuvant intermediate was homogenized at 600 bar for 10min using a high pressure homogenizer, and the product was collected.

The product obtained in the last step is subjected to ultrafiltration centrifugation by using an Amicon Ultra ultrafiltration tube (molecular weight cut-off of 30 KD), and finally the solvent is changed into buffer solution 2.

Finally, the particle size of the sample is measured, as shown in FIG. 1. The detection was performed using a dynamic light scattering instrument (model Zetasizer nano) manufactured by malvern corporation. The measurements were repeated three times for each sample.

Example 2: preparation of liposome composite adjuvant by using film hydration method

Organic phase solution preparation:

QS-21 solution formulation:

precisely weighing a proper amount of QS-21, adding the buffer solution 1, and carrying out ultrasonic dissolution to prepare the QS-21 with the concentration of 2mg/ml.

CpG7909 solution preparation:

10ml of a mixed solution of DOPC at a concentration of 20mg/ml and CHOL at a concentration of 5mg/ml was precisely measured, and after the mixed solution was added to a round-bottomed flask, the solvent was removed by using a rotary evaporator, and then the residual organic solvent was removed by vacuum suction for 1 hour, thereby forming a lipid film.

Slowly adding the water phase into the flask at room temperature for hydration, continuously stirring for 30 minutes, and then performing ultrasonic treatment for 5 minutes to obtain the liposome composite adjuvant intermediate.

Finally, the particle size of the sample was measured as shown in FIG. 2.

Example 3: expression and identification of gE proteins

The varicella-zoster virus (VZV) surface glycoprotein gE antigen is an extracellular amino acid sequence (SEQ ID No. 1) from varicella-zoster virus Ellen strain (GenBakn sequence number: JQ 972913.1) after truncation of surface glycoprotein E. After codon optimization for mammalian CHO cell codon preference based on amino acid sequence, synthesis of gE protein cDNA sequence (SEQ ID No. 3) was committed to Suzhou Jinwei Biotech Co. The synthesized cDNA sequences are respectively inserted into eukaryotic expression vectors, and are subjected to sequencing identification.

And (3) carrying out enzyme tangential digestion on the constructed expression vector plasmid carrying the target gE protein gene, and then electrically transfecting the expression vector plasmid into eukaryotic mammal CHO-K1 cell strains. After the screening of the blast cell strain, the screening of the monoclonal cell strain, the evaluation of the monoclonal cell strain and the evaluation of the stability of the monoclonal cell strain, the stable CHO-K1 cell strain capable of stably expressing the target gE protein antigen is obtained.

In the cell strain construction process, in order to verify the expression of the target gE protein, a small amount of fermentation supernatant is taken for gE protein expression detection. According to the description of a kit (Shanghai Biotechnology, cat. No. C601104), the fermentation supernatant was subjected to gel running detection by using Precast-Glgel 4-15% non-denaturing electrophoresis Hepes preformed gel. The results showed that the target protein gE had a dimer structure and the molecular weight was about twice the theoretical size (FIG. 3A).

After screening, the monoclonal cell strain is gradually amplified and cultured to shake flask and reactor scale for fermentation. Collecting the supernatant after fermentation, obtaining purified gE glycoprotein through anion chromatography, hydrophobic chromatography and ultrafiltration liquid exchange, and finally carrying out SDS-PAGE gel running identification on the obtained target protein. The results showed that the protein of interest gE product was of higher purity, approximately 70kDa in molecular weight, and was expected to be consistent (FIG. 3B). In addition, the target protein gE is glycoprotein, and the CHO cell expression system can maintain the glycosylation modification of the protein to the maximum extent, so that the band of the target protein gE presents a certain dispersion shape in a PAGE gel diagram.

Example 4: immunogenicity and adjuvant necessity study of gE protein

We performed an immunogenicity study on the antigen protein of interest gE and evaluated the necessity of a complex adjuvant component and the effect of each component on vaccine immunogenicity by combining different adjuvant components.

We selected 1/10 of the proposed human dose for vaccine immunogenicity studies in C57BL/6 mice. The vaccine was formulated with 5 μg recombinant gE protein separately in combination with the compound adjuvant and its components separately to immunize C57BL/6 mice (supplied by "Shanghai national institute of family planning science laboratory animal manager"). All mice were immunized twice on day 0, 21 days with a volume of injection of 0.1mL each. Blood was collected on day 31, serum was separated, and antibody titer was measured. After blood collection, spleen of the mouse is collected, lymphocytes are separated, and T cell immune response detection is carried out. The specific grouping information is shown in the following table.

TABLE 1 grouping of mice in vivo immunogenicity laboratory animals

The antibody titer was detected by ELISA. Specifically, collected mouse peripheral blood separation serum is firstly stored to-20 ℃ for standby. gE protein stock solution was diluted with coating buffer (ORIGENE, cat# ZLI-9063) and coated on a 96-well ELISA plate overnight, and then blocked with PBS blocking solution added with 5% skimmed milk powder (De-skimmed milk powder, cat# 5381) for 2 hours. After incubation at 37℃with serum to be tested, HRP-labeled secondary antibody (Bio-Rad, cat. No. 170-6515) was added and incubation continued for 45 minutes. Washing the plate, adding prepared commercial color development solution (Sera Care, cat No. 5120-0038 and 5120-0049) for developing color at 37deg.C for 10-15 min, and adding 50 μl of 2M H ₂ SO ₄ The stop solution stops the color development. The OD450/620 values were read using a multifunctional microplate reader (MOLECULAR, model SpectraMax iD 3). The OD value of 0.105 is taken as a cut-off value, when the OD value is more than or equal to 0.105 at a certain dilution of a serogroup, the positive result is obtained, and when the OD value is less than 0.105, the last dilution is the antibody titer of the serum.

T cell immune response detection is to detect the positive spots of cytokines IL-2, IFN-gamma and TNF-alpha generated by mouse spleen lymphocytes after gE protein stimulation by using a FluoSpot method. Specifically, a mouse spleen single cell suspension was first prepared. The neck-broken sacrificed mice were transferred to a super clean bench for aseptic dissection to remove the spleens of the mice, and spleen cell suspensions were obtained by flooding and filter screen filtration. Red blood cells in the cell suspension were removed by addition of red blood cell lysate (BOSTER, cat. AR 1118). After washing with complete medium (10% FBS (Gibco, 10091-148) +RPMI 1640 medium (Gibco, 10091-148)), a small amount of suspension was counted by a cytometer (Life Technologies, model Countess II) and used. After a piece of FluoSpot plate was taken, each well was wetted with 35% ethanol solution, coated with primary antibody solution overnight according to the instructions of the kit (Mabtech, cat. No. FSX-41A-1-10+FSX-42B-1-10+FSX-45W-1-10+3654-4-1-10) and then blocked with serum-containing complete medium at room temperature for at least 30 minutes. Appropriate amounts of cell suspension and gE protein pool stimulator and anti-CD 28 antibody solution were added to each of the corresponding stimulation wells according to a pre-designed group stimulation pattern, placed in a cell incubator, and stimulated at 37℃for about 24-36 hours. After the stimulation is finished, the secondary antibody and the tertiary antibody are sequentially added according to instructions, and then 50 μl of color development liquid is added into each hole to develop color for 15 minutes at room temperature in a dark place. And then the developing solution is discarded, a rubber pad at the bottom of the 96-well plate is removed, and the PVDF film at the bottom of the well is dried in the ventilation place. Spot count data of secreted cytokines IFN-gamma, TNF-alpha and IL-2 in each well were read with a FluoroSpot reader of CTL and analyzed.

The results are shown in fig. 4 and 5. The antibody response and the T cell response of the compound adjuvant control group are not significantly different from those of the PBS negative control group, which indicates that the compound adjuvant has no antibody and cytokine stimulation activity. The mice immunized by the combined preparation of the recombinant gE protein and the single liposome can only induce extremely low-level antibody and T cell immune response, which proves that the liposome has no obvious adjuvant stimulating activity. The antibody and T cell reaction induced by the vaccine immunized mice after the recombinant gE protein and the liposome are combined with separate CpG7909 or QS-21 preparations are obviously lower than that of the vaccine prepared by the recombinant gE protein combined with the composite adjuvant. This demonstrates that the compound adjuvant has significant superiority and necessity for higher immunogenicity of recombinant herpes zoster vaccine.

Example 5: recombinant herpes zoster vaccine immune dose exploration

We have searched for the dose ratios of the antigen gE protein of the vaccine and the complex adjuvant components CpG7909 and QS-21, and explored the optimal vaccine dose ratios by immunogenicity studies in mice.

We selected to study vaccine immunogenicity in C57BL/6 mice at 1/10 of the human dose, and multiple dose-matched groupings were made on gE protein, cpG7909 and QS-21, respectively. All mice were immunized twice on day 0, 21 hind leg muscle, injected at a volume of 0.1ml each, collected on day 31, serum isolated, and assayed for antibody titer. After blood collection, spleen of the mouse is collected, lymphocytes are separated, and T cell immune response detection is carried out. The specific grouping information is shown in the following table.

TABLE 2 grouping of mice in vivo immunogenicity laboratory animals

The antibody titer was measured by ELISA method as in example 4.T cell immune response was detected using flow cytometry and FluoroSpot methods (as in example 4).

Flow cytometry can detect antigen-specific cd4+ T cell immune responses that secrete specific cytokines. Specifically, a mouse spleen single cell suspension was first prepared. The neck-broken sacrificed mice were transferred to a super clean bench for aseptic dissection to remove the spleens of the mice, and spleen cell suspensions were obtained by flooding and filter screen filtration. Red blood cells in the cell suspension were removed by addition of red blood cell lysate (BOSTER, cat. AR 1118). After washing with complete medium (10% FBS (Gibco, 10091-148) +RPMI 1640 medium (Gibco, 10091-148)), a small amount of suspension was counted by a cytometer and used. A96-well cell culture plate was taken, plated with 1 to 3 million cells/well per well, and simultaneously, gE protein pool stimulator, anti-CD 28 antibody solution (Mabtech, cat. No. FS-4142-10) and Golgi inhibitor solution (BD, cat. No. 554714) were added to each well, and placed in a cell incubator and stimulated at 37℃for about 6 hours. After the stimulation, LIVE/DEAD Aqua Dye (Invitrogen, cat# L34966), FITC anti-mouse CD4 (BD, cat# 553047) and PB anti-mouse CD3 (bioleged, cat# 100214) antibodies were added respectively for 30 minutes at a dark temperature as required by the concentration of the antibody instructions. Then, the cells were fixed and broken for 20 minutes with BD cyto-fix/cytoperm Fixation/Permeabilation kit (BD, cat# 554714), and then PE-Cy7 anti-mouse IL-2 (BD, cat# 560538), APC anti-mouse IFN-gamma (BD, cat# 554413), and PE anti-mouse TNF-alpha (BD, cat# 554419) antibodies were added, respectively, and stained for 30 minutes in a dark place at low temperature. Finally, the supernatant was centrifuged off and the cells were washed with PBS. The washed cells were resuspended in PBS and the proportion of cd4+ T living cells secreting different cytokines was detected by a FACS Canto II Flow Cytometer flow cytometer and analyzed for data.

As shown in fig. 6 and 7, the results demonstrate that different doses of antigen combined with different doses of the composite adjuvant can induce higher antigen-specific antibodies and T cell immune responses in mice. Wherein the high and low dose QS-21 components have no significant dose-dependent effects, but the high dose of antigen has a certain correlation with the higher level of immune response.

Example 6: vaccine after combined preparation of gE protein and different compound adjuvants and commercial shintrix vaccine in mouse immunogenicity comparison

We first imitated another composite adjuvant AS01B according to published data and compared the level of immune response in mice of vaccines prepared with the composite adjuvant of the invention with the imitated AS01B adjuvant by combining the same recombinant gE protein. The same recombinant herpes zoster vaccine shintrix purchased commercially on the market was also compared.

We selected 1/10 of the proposed human dose for vaccine immunogenicity studies in C57BL/6 mice. Since the pathogenesis of VZV disease depends on pre-incubation infection of VZV before stimulation, a pre-immune attenuated live vaccine was designed for mice in this experiment to mimic the natural pathogenesis, thereby more reasonably evaluating the efficacy of the product. All mice were immunized with 1 dose of live varicella attenuated vaccine by subcutaneous injection at a volume of 0.5mL per dose 28 days prior to immunization of the candidate vaccine composition. Two candidate vaccine compositions and control samples were immunized against the leg muscle on days 0 and 21, the injection volume was 0.05mL each, blood was collected on day 31, serum was isolated, and antibody titer detection was performed. After blood collection, spleen of the mouse is collected, lymphocytes are separated, and T cell immune response detection is carried out. The specific grouping information is shown in the following table:

TABLE 3 grouping of mice in vivo immunogenicity laboratory animals

The antibody titer was measured by ELISA method as in example 4.T cell immune response was detected by the FluoSpot method, as in example 4, but limited to the kit (Mabtech, cat. No. FS-4142-10), and only two cytokines, IL-2 and IFN-gamma, were detected.

The results are shown in fig. 8 and 9. The results show that the recombinant herpes zoster vaccine prepared by the composite adjuvant has no significant difference in the level of antibody response induced in mice relative to the vaccine prepared by the imitated AS01B composite adjuvant on the premise of using the same recombinant gE protein, but can induce a higher level of T cell response. In addition, the recombinant herpes zoster vaccine prepared by the composite adjuvant has no significant difference in the level of antibody response induced in mice relative to the commercial recombinant herpes zoster vaccine shintrix, but can induce higher level T cell response as well, and shows better vaccine immunogenicity.

Example 7: comparison of immunogenicity of the herpes zoster vaccine of the invention with commercial shintrix vaccine in monkeys

To evaluate the level of immune response of the herpes zoster vaccine composition of the invention, we conducted comparative immunogenicity studies in monkeys with commercially available recombinant herpes zoster vaccine of the same class as that marketed by GSK company, shingrix (Chinese name: xin An Lishi).

We selected that the human-like dose was used for vaccine immunogenicity studies in cynomolgus monkeys (from the orthographic biomedical sciences of the military) while 4 cynomolgus monkeys (female 2 male 2) were preimmunized by subcutaneous injection of 5-fold human-like doses of varicella attenuated live vaccine 4 weeks in advance in each group in an injection volume of 2.5mL each in order to better mimic the natural pathogenesis. The 1 dose of the herpes zoster vaccine of the invention (50 μg gE/liposome/500 μg CpG7909/50 μg QS-21) and the commercial Sringrix vaccine were injected in two separate intramuscular immunizations 4 and 12 weeks after the pre-immunization. Blood was collected 2 weeks after the end of the last immunization, serum and Peripheral Blood Mononuclear Cells (PBMC) were separated, and gE antigen-specific antibody detection and T cell response detection were performed, respectively.

ELISA was used for antibody titer detection as in example 4, except that the secondary antibodies were replaced with the corresponding monkey secondary antibodies (Bethyl Laboratories, cat. No. A140-102P). The T cell immune reaction was detected by the FluoSpot method as in example 4, except that the detection kit was replaced with a corresponding monkey detection kit (Mabtech, cat. FSP-212822-10). PBMC were isolated using Ficoll density gradient centrifugation.

The results are shown in fig. 10 and 11. The results show that compared with commercial recombinant herpes zoster vaccine shinrix, the vaccine has the advantages that the induced antibody response level and the T cell response level in the cynomolgus monkey body are slightly lower than those of the commercial shinrix vaccine, but have no significant difference, and show better vaccine immunogenicity.

Although certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those skilled in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention.

<110> Shanghai ze Biotech Co., ltd

<120> herpes zoster vaccine composition

<130> CPCH2162953N

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 546

<212> PRT

<213> artificial sequence

<400> 1

Met Gly Thr Val Asn Lys Pro Val Val Gly Val Leu Met Gly Phe Gly

1 5 10 15

Ile Ile Thr Gly Thr Leu Arg Ile Thr Asn Pro Val Arg Ala Ser Val

20 25 30

Leu Arg Tyr Asp Asp Phe His Ile Asp Glu Asp Lys Leu Asp Thr Asn

35 40 45

Ser Val Tyr Glu Pro Tyr Tyr His Ser Asp His Ala Glu Ser Ser Trp

50 55 60

Val Asn Arg Gly Glu Ser Ser Arg Lys Ala Tyr Asp His Asn Ser Pro

65 70 75 80

Tyr Ile Trp Pro Arg Asn Asp Tyr Asp Gly Phe Leu Glu Asn Ala His

85 90 95

Glu His His Gly Val Tyr Asn Gln Gly Arg Gly Ile Asp Ser Gly Glu

100 105 110

Arg Leu Met Gln Pro Thr Gln Met Ser Ala Gln Glu Asp Leu Gly Asp

115 120 125

Asp Thr Gly Ile His Val Ile Pro Thr Leu Asn Gly Asp Asp Arg His

130 135 140

Lys Ile Val Asn Val Asp Gln Arg Gln Tyr Gly Asp Val Phe Lys Gly

145 150 155 160

Asp Leu Asn Pro Lys Pro Gln Gly Gln Arg Leu Ile Glu Val Ser Val

165 170 175

Glu Glu Asn His Pro Phe Thr Leu Arg Ala Pro Ile Gln Arg Ile Tyr

180 185 190

Gly Val Arg Tyr Thr Glu Thr Trp Ser Phe Leu Pro Ser Leu Thr Cys

195 200 205

Thr Gly Asp Ala Ala Pro Ala Ile Gln His Ile Cys Leu Lys His Thr

210 215 220

Thr Cys Phe Gln Asp Val Val Val Asp Val Asp Cys Ala Glu Asn Thr

225 230 235 240

Lys Glu Asp Gln Leu Ala Glu Ile Ser Tyr Arg Phe Gln Gly Lys Lys

245 250 255

Glu Ala Asp Gln Pro Trp Ile Val Val Asn Thr Ser Thr Leu Phe Asp

260 265 270

Glu Leu Glu Leu Asp Pro Pro Glu Ile Glu Pro Gly Val Leu Lys Val

275 280 285

Leu Arg Thr Glu Lys Gln Tyr Leu Gly Val Tyr Ile Trp Asn Met Arg

290 295 300

Gly Ser Asp Gly Thr Ser Thr Tyr Ala Thr Phe Leu Val Thr Trp Lys

305 310 315 320

Gly Asp Glu Lys Thr Arg Asn Pro Thr Pro Ala Val Thr Pro Gln Pro

325 330 335

Arg Gly Ala Glu Phe His Met Trp Asn Tyr His Ser His Val Phe Ser

340 345 350

Val Gly Asp Thr Phe Ser Leu Ala Met His Leu Gln Tyr Lys Ile His

355 360 365

Glu Ala Pro Phe Asp Leu Leu Leu Glu Trp Leu Tyr Val Pro Ile Asp

370 375 380

Pro Thr Cys Gln Pro Met Arg Leu Tyr Ser Thr Cys Leu Tyr His Pro

385 390 395 400

Asn Ala Pro Gln Cys Leu Ser His Met Asn Ser Gly Cys Thr Phe Thr

405 410 415

Ser Pro His Leu Ala Gln Arg Val Ala Ser Thr Val Tyr Gln Asn Cys

420 425 430

Glu His Ala Asp Asn Tyr Thr Ala Tyr Cys Leu Gly Ile Ser His Met

435 440 445

Glu Pro Ser Phe Gly Leu Ile Leu His Asp Gly Gly Thr Thr Leu Lys

450 455 460

Phe Val Asp Thr Pro Glu Ser Leu Ser Gly Leu Tyr Val Phe Val Val

465 470 475 480

Tyr Phe Asn Gly His Val Glu Ala Val Ala Tyr Thr Val Val Ser Thr

485 490 495

Val Asp His Phe Val Asn Ala Ile Glu Glu Arg Gly Phe Pro Pro Thr

500 505 510

Ala Gly Gln Pro Pro Ala Thr Thr Lys Pro Lys Glu Ile Thr Pro Val

515 520 525

Asn Pro Gly Thr Ser Pro Leu Ile Arg Tyr Ala Ala Trp Thr Gly Gly

530 535 540

Leu Ala

545

<210> 2

<211> 24

<212> DNA

<213> artificial sequence

<400> 2

tcgtcgtttt gtcgttttgt cgtt 24

<210> 3

<211> 1641

<212> DNA

<213> artificial sequence

<400> 3

atgggcaccg tcaataagcc cgtggtgggc gtgctgatgg gctttggcat cattaccgga 60

acactccgga tcaccaaccc tgtcagggcc tccgtgctcc ggtatgacga cttccacatc 120

gatgaggaca agctggacac aaactccgtc tacgagccct actaccacag cgaccatgcc 180

gagagctcct gggtgaacag gggcgaaagc tccaggaagg cctacgacca caactccccc 240

tatatctggc ctaggaacga ctacgacggc tttctggaga acgcccacga gcaccacgga 300

gtctataacc agggcagggg catcgacagc ggcgagaggc tgatgcaacc cacccagatg 360

tccgcccagg aggatctggg cgatgacacc ggaatccacg tgatccctac cctgaacggc 420

gatgacaggc acaagatcgt caatgtggac cagcggcagt acggagatgt gttcaagggc 480

gacctgaatc ccaagcccca gggccagagg ctgatcgagg tgagcgtgga ggagaaccac 540

ccctttaccc tcagggcccc tatccagcgg atctacggcg tgaggtacac cgagacctgg 600

tccttcctgc cctccctgac atgtacaggc gacgccgccc ccgctattca gcacatctgc 660

ctgaagcaca ccacctgctt tcaggacgtg gtcgtggacg tggactgcgc cgagaacaca 720

aaagaagacc agctggccga gatctcctac aggttccaag gcaagaagga agctgaccag 780

ccctggatcg tcgtcaacac atccacactc ttcgacgaac tggaactcga tccccctgaa 840

atcgagcccg gagtgctcaa ggtgctgcgg accgagaagc agtacctcgg cgtgtatatc 900

tggaacatgc ggggcagcga cggaacaagc acatacgcta ccttcctggt gacctggaag 960

ggcgacgaaa agaccaggaa ccctacccct gccgtgacac ctcagcctag gggcgccgag 1020

ttccacatgt ggaactatca ctcccacgtg ttcagcgtcg gcgacacctt cagcctcgcc 1080

atgcacctgc agtacaagat ccacgaggcc cccttcgacc tgctgctgga gtggctgtat 1140

gtccctatcg accctacctg ccaacccatg aggctgtatt ccacctgtct ctaccacccc 1200

aacgctcctc agtgcctcag ccacatgaac tccggctgta ccttcacctc ccctcacctg 1260

gcccaacggg tggcctctac cgtgtatcag aattgcgagc acgccgacaa ctacacagcc 1320

tattgcctgg gcatcagcca catggagcct tcctttggcc tgattctgca cgacggcgga 1380

accaccctga agtttgtgga tacccccgag tccctgagcg gcctgtacgt gttcgtcgtg 1440

tactttaacg gccacgtgga agccgtcgcc tacaccgtcg tgagcaccgt ggaccacttc 1500

gtgaacgcca tcgaagagcg gggctttcct cctacagccg gccagcctcc tgccacaacc 1560

aagcccaaag agatcacacc cgtgaaccct ggcaccagcc ccctcatcag gtatgctgcc 1620

tggacaggag gactggcttg a 1641

Claims

1. A herpes zoster vaccine composition comprising a varicella zoster virus antigen and a complex adjuvant, wherein the complex adjuvant comprises a CpG oligodeoxynucleotide, QS-21 and a liposome, wherein the CpG oligodeoxynucleotide is CpG7909.

2. The composition of claim 1, wherein the concentration of CpG oligodeoxynucleotide ranges from 0.25 to 2mg/mL of the composite adjuvant.

3. The composition of claim 1 or 2, wherein the concentration of QS-21 is in the range of 25-200 μg/mL of the composite adjuvant.

4. A composition according to any one of claims 1 to 3, wherein the liposome comprises phosphatidylcholine and cholesterol.

5. The composition of claim 4, wherein the phosphatidylcholine is present in a concentration range of 0.5-4 mg/mL of the compound adjuvant.

6. The composition of claim 4 or 5, wherein the concentration of cholesterol ranges from 0.125 to 1mg/mL of the compound adjuvant.

7. The composition of any one of claims 4 to 6, wherein the phosphatidylcholine is dioleoyl phosphatidylcholine.

8. The composition of any one of claims 1 to 7, wherein the varicella-zoster virus antigen is varicella-zoster virus glycoprotein gE.

9. The composition of claim 8, wherein the varicella-zoster virus antigen is an extracellular region fragment of varicella-zoster virus glycoprotein gE.

10. The composition of claim 9, wherein the extracellular region fragment has an amino acid sequence as shown in SEQ ID No. 1.