CN116212012A - Complex adjuvant and vaccine formulation comprising the same - Google Patents

Abstract

The present invention relates to a compound adjuvant and vaccine formulations comprising the same. The composite adjuvant comprises a CpG oligodeoxynucleotide, QS-21 and a liposome, wherein the CpG oligodeoxynucleotide is CpG7909. According to the present invention, the compound adjuvant can effectively enhance antibody responses and immune responses of various vaccine preparations.

Description

Complex adjuvant and vaccine formulation comprising the same

Technical Field

The present invention relates to the field of vaccines. In particular, the present invention relates to a composite adjuvant which can effectively enhance the antibody response and the immune response of a vaccine preparation, and a vaccine preparation comprising the composite adjuvant.

Background

Shingles is an acute infectious skin disease caused by Varicella-Zoster Virus (VZV). Because the virus is neurotropic, it can be hidden in neurons of spinal nerve postganglion for a long period after infection. When the resistance is low or tired, the virus can grow again and propagate, and move to the skin along nerve fibers, so that the affected nerves and skin generate strong inflammation.

The clinical manifestations of shingles are body-side herpes, typically limited to a skin segment, often accompanied by nerve root pain. Patients experience significant pain and discomfort, which can last weeks, months or even years, reducing quality of life. The incidence rate increases significantly with age.

There are 9 currently established VZV viral surface glycoproteins, gB, gC, gE, gH, gI, gK, gL, gM and gN, respectively. The gE glycoprotein is the glycoprotein with the highest expression level of the VZV, plays a main role in the replication and assembly processes of the virus and also mediates the transmission of the virus among cells. In view of the strong immunogenicity of VZV gE, it has been one of the primary candidate antigens for VZV subunit vaccines and DNA vaccines to induce an immune response against VZV in the body.

It is currently known that gE proteins alone are not able to induce a strong cellular immune response in animal models and that the immune response of gE must be enhanced by means of an adjuvant.

The novel coronavirus (also known as novel coronavirus, or SARS-CoV-2) belongs to subgroup B and is an enveloped single-stranded positive-stranded RNA virus. The genus also includes severe acute respiratory syndrome coronavirus (SARS-CoV) and middle east respiratory syndrome coronavirus (MERS-CoV), both of which infect hosts through binding of Spike (Spike or S) proteins on the surface of viral particles to host cell surface receptors. Specifically, the S protein on the surface of SARS-CoV-2 recognizes the Angiotensin converting enzyme 2 (ACE 2) on the host cell via its Receptor-binding domain (RBD) and mediates viral invasion into the host cell. The SARS-CoV-2S protein induced neutralizing antibody can obviously block the recognition path and reduce the infection capacity of virus. These studies fully demonstrate the important role of S protein neutralizing antibodies in preventing viral entry, providing important guidance for B cell humoral immunity-based vaccine design. At the same time, T cell immunity is critical for the clearance of infected cells and viruses. Because once a minority of the virus escapes the capture of neutralizing antibodies, the infected host cells will become a warm bed for viral replication and even variation, at which point antigen-specific Tc cells are able to recognize the infected host cells, further clearing the virus. Studies have shown that severe covd-19 patients exhibit reduced T cell depletion and functional diversity, which reflects the importance of T cell immunity for disease control.

However, the current aluminum adjuvants have weak immune enhancing effects and mainly generate humoral immunity, and cannot meet the development requirements of various vaccines including herpes zoster vaccines and new crown vaccines. Thus, it is desirable to have new compound adjuvants that can be used in a variety of vaccines to enhance their effectiveness.

Disclosure of Invention

In view of the above, an object of the present invention is to provide a composite adjuvant that can effectively enhance the antibody response and immune response of vaccine formulations.

In a first aspect, the invention relates to a composite adjuvant comprising a CpG oligodeoxynucleotide, QS-21 and a liposome, wherein the CpG oligodeoxynucleotide is CpG7909.

In a second aspect, the present invention relates to a vaccine formulation comprising the complex adjuvant of the invention described above.

According to the present invention, a composite adjuvant that can effectively enhance the antibody response and immune response of a vaccine preparation can be provided. In particular, the complex adjuvants of the invention can specifically enhance T cell responses and neutralizing antibody titers. Thus, the complex adjuvants of the invention can reduce the amount of antigen necessary for vaccine formulations.

Drawings

FIG. 1 shows the results of particle size detection (Z-average: 113.5nm,PDI 0.196) of a composite adjuvant sample according to one embodiment of the present invention.

FIG. 2 shows the results of particle size measurements (Z-average: 96.7nm, PDI 0.164) of a composite adjuvant sample according to another embodiment of the invention.

Figure 3 is a graph showing the induction of binding antibody responses in mice by different recombinant novel coronavirus vaccine formulations according to one embodiment of the present invention.

FIG. 4 is a graph of pseudovirus neutralizing antibody responses induced by mice induced by different recombinant novel coronavirus vaccine formulations, according to one embodiment of the present invention.

FIG. 5 induces IFN-gamma, IL-2, TNF-alpha and IL-4 cytokine secretion levels in lymphocytes produced by mice from different recombinant novel coronavirus vaccine formulations according to one embodiment of the invention.

FIG. 6 shows IFN-. Gamma., IL-2, TNF-. Alpha.and IL-4 positive cell percentages in CD4+ T and CD8+ T lymphocyte subsets produced by BALB/c mice induced by different recombinant novel coronavirus vaccine formulations according to one embodiment of the invention.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, but methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.

For all numerical ranges referred to in this disclosure, it is understood that all specific values within that range are disclosed, as well as subranges defined by any two values within that range. For example, with respect to 1% -10%, it is to be understood that specific values of 1%, 2%, 3%, 3.5%, 4.5%, 10%, etc., as well as subranges of 1% -5%,2% -6%,3.5% -7.5%, etc., are disclosed.

In one aspect, the present invention provides a composite adjuvant comprising a CpG oligodeoxynucleotide, QS-21 and a liposome.

CpG oligodeoxynucleotide (CpG ODN) is an artificially synthesized short single-chain DNA molecule, contains unmethylated cytosine guanine dinucleotide sequences, can simulate the combination of bacterial DNA and activate Toll-like receptor 9 (TLR 9) of mammals including human beings, directly activate B cells and monocytes, indirectly activate various immune effector cells such as NK cells and T cells, strengthen the functions and secretion of cytokines, and induce Th1 type immune response. The CpG ODN used in the present invention is CpG7909, also referred to as CpG2006, ODN7909 or ODN2006.CpG7909 has the following nucleotide sequence: TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID No. 1).

QS-21 is an active ingredient extracted from the bark of Quillaja saponaria Molina (Quillaja Saponaria) and is capable of eliciting a mouse CD8+ cellular immune response, producing IgG1 and IgG2a antibodies, and promoting secretion of Th1 cytokines, interleukin 2 and gamma interferon by Cytotoxic T Lymphocytes (CTLs).

In a preferred embodiment, the content of CpG ODN is 10-30 wt.% relative to the total weight of CpG oligodeoxynucleotide, QS-21 and liposome. In a more preferred embodiment, the CpG ODN is present in an amount of 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 or 30 wt%.

In a preferred embodiment, the amount of QS-21 is 1-5% by weight relative to the combined weight of CpG oligodeoxynucleotide, QS-21 and liposome. In a more preferred embodiment, the QS-21 content is 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5 or 5% by weight.

In a preferred embodiment, the relative weight ratio of CpG ODN to QS-21 is from 5:1 to 20:1. In a more preferred embodiment, the relative weight ratio of CpG ODN to QS-21 is 10:1.

In a preferred embodiment, the liposome comprises Phosphatidylcholine (PC) and Cholesterol (CHOL). In a more preferred embodiment, the liposome consists of Phosphatidylcholine (PC) and Cholesterol (CHOL).

Phosphatidylcholine (PC) is a structure in which choline is combined with two fatty acids via phosphate groups to form an ester bond. Structurally quaternary amines and hydroxyl groups on choline can be separated directly by multiple carbon atoms. The two fatty acids are 12 to 18 carbon atoms in length, with the possible presence of one or more unsaturated double bonds. Among them, preferred is dioleoyl phosphatidylcholine (DOPC) having a structure shown below, which is 18 carbons long and contains 1 unsaturated double bond.

Cholesterol is a lipid widely existing in human body, is an important component of cell membrane, and has functions of stabilizing liposome and reducing permeability of lipid membrane. Cholesterol is composed of a steroid moiety and a long side chain, and different cholesterol derivatives differ from each other. In one embodiment, cholesterol derivatives having a side chain length of 4-8 carbon chains are preferred, in which the steroid moiety structure is the same as in the following formula. In another embodiment, cholesterol having a structure as shown below is preferred.

In a preferred embodiment, the content of phosphatidylcholine is 40-60 wt.% relative to the total weight of CpG oligodeoxynucleotide, QS-21 and liposome. In a more preferred embodiment, the content of phosphatidylcholine is 40, 45, 50, 55 or 60 wt%.

In a preferred embodiment, the cholesterol is present in an amount of 10-15 wt.%, relative to the total weight of CpG oligodeoxynucleotide, QS-21 and liposomes. In a more preferred embodiment, the cholesterol content is 10, 10.5, 11, 12, 12.5, 13, 13.5, 14, 14.5 or 15 wt%.

Those skilled in the art will appreciate that although various examples are provided above for the content of the components CpG ODN, QS-21, phosphatidylcholine (PC), cholesterol (CHOL) and the like in the complex adjuvant of the present invention, they may be appropriately determined by those skilled in the art and are not limited to the specific examples listed above.

In another aspect, the invention provides a vaccine formulation comprising a complex adjuvant according to the invention. In one embodiment, the vaccine formulation is a novel coronavirus vaccine formulation. In a preferred embodiment, the vaccine formulation comprises a novel coronavirus spike protein (S protein). In a more preferred embodiment, the S protein has the following amino acid sequence: (SEQ ID No. 2), or an amino acid sequence having more than 90%, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 99% and 99% identity thereto. In one embodiment, the nucleic acid encoding an S protein having the amino acid sequence of SEQ ID No. 2 has the nucleotide sequence shown in SEQ ID No. 3.

In a further aspect, the present invention provides the use of a composite adjuvant according to the invention in the preparation of a vaccine.

Examples

Specific examples are provided below to further illustrate the invention.

Example 1: preparation of liposome composite adjuvant by ethanol injection method

Dioleoyl phosphatidylcholine (DOPC) and Cholesterol (CHOL) were purchased from Ai Weita (Shanghai) pharmaceutical technologies Inc., QS-21 was purchased from Desert King International (USA), and CpG7909 was purchased from Guangzhou Ruibo biological Co.

Buffer 1 preparation:

respectively weigh Na ₂ HPO ₄ 12H ₂ O 0.6446g、KH ₂ PO ₄ 1.1207g and 1.1702g NaCl are put into a container, 200ml injection water is added, and the mixture is stirred and dissolved to obtain 9mM Na ₂ HPO4、41mM KH ₂ PO ₄ 100mM NaCl, pH 6.1. Labeled buffer 1. Sterilizing and filtering for standby.

Buffer 2 preparation:

respectively weigh Na ₂ HPO ₄ 12H ₂ O 0.1432g、KH ₂ PO ₄ 0.2177g and NaCl 1.755g are put into a container, 200ml of water for injection is added, and stirred and dissolved to obtain 2mM Na ₂ HPO ₄ 、8mM KH ₂ PO ₄ 150mM NaCl, pH 6.1. Labeled buffer 2. Sterilizing and filtering for standby.

Organic phase solution preparation:

accurately weighing 0.400g of DOPC and 0.100g of CHOL in an EP tube, sucking 20ml of absolute ethyl alcohol by a pipette, adding the absolute ethyl alcohol into the EP tube, and ultrasonically dissolving the absolute ethyl alcohol to obtain a mixed solution of 20mg/ml DOPC and 5mg/ml CHOL.

QS-21 solution formulation:

precisely weighing a proper amount of QS-21 and adding dimethyl sulfoxide, and performing ultrasonic dissolution to prepare the QS-21 with the concentration of 2mg/ml.

CpG7909 solution preparation:

0.402g of CpG7909 freeze-dried powder is precisely weighed, dissolved in 50ml of PBS, and detected by an ultra-micro spectrophotometer to have a concentration of 5.242mg/ml.

10ml of CpG7909 solution with the concentration of 5.242mg/ml, 5ml of QS-21 solution with the concentration of 2mg/ml and 75ml of buffer solution 1 are precisely measured in a glass vial, and uniformly stirred and mixed to be used as a water phase.

Precisely 10ml of a mixed solution of DOPC with the concentration of 20mg/ml and CHOL with the concentration of 5mg/ml was measured, added dropwise to the aqueous phase with stirring at 600rpm at room temperature. After all the dropwise addition was completed, stirring was continued for 30 minutes. Namely the liposome composite adjuvant intermediate.

100ml of the liposome composite adjuvant intermediate was homogenized at 600 bar for 10min using a high pressure homogenizer, and the product was collected.

The product obtained in the last step is subjected to ultrafiltration centrifugation by using an Amicon Ultra ultrafiltration tube (molecular weight cut-off of 30 KD), and finally the solvent is changed into buffer solution 2.

Finally, the particle size of the sample is measured, as shown in FIG. 1. The detection was performed using a dynamic light scattering instrument (model Zetasizer nano) manufactured by malvern corporation. The measurements were repeated three times for each sample.

Example 2: preparation of liposome composite adjuvant by using film hydration method

Organic phase solution preparation:

accurately weighing 0.400g of DOPC and 0.100g of CHOL in an EP tube, sucking 20ml of absolute ethyl alcohol by a pipette, adding the absolute ethyl alcohol into the EP tube, and ultrasonically dissolving the absolute ethyl alcohol to obtain a mixed solution of 20mg/ml DOPC and 5mg/ml CHOL.

QS-21 solution formulation:

precisely weighing a proper amount of QS-21 and adding dimethyl sulfoxide, and performing ultrasonic dissolution to prepare the QS-21 with the concentration of 2mg/ml.

CpG7909 solution preparation:

0.402g of CpG7909 freeze-dried powder is precisely weighed, dissolved in 50ml of PBS, and detected by an ultra-micro spectrophotometer to have a concentration of 5.242mg/ml.

10ml of CpG7909 solution with the concentration of 5.242mg/ml, 5ml of QS-21 solution with the concentration of 2mg/ml and 75ml of buffer solution 1 are precisely measured in a glass vial, and uniformly stirred and mixed to be used as a water phase.

10ml of a mixed solution of DOPC at a concentration of 20mg/ml and CHOL at a concentration of 5mg/ml was precisely measured, and after the mixed solution was added to a round-bottomed flask, the solvent was removed by using a rotary evaporator, and then the residual organic solvent was removed by vacuum suction for 1 hour, thereby forming a lipid film.

Slowly adding the water phase into the flask at room temperature for hydration, continuously stirring for 30 minutes, and then performing ultrasonic treatment for 5 minutes to obtain the liposome composite adjuvant intermediate.

100ml of the liposome composite adjuvant intermediate was homogenized at 600 bar for 10min using a high pressure homogenizer, and the product was collected.

The product obtained in the last step is subjected to ultrafiltration centrifugation by using an Amicon Ultra ultrafiltration tube (molecular weight cut-off of 30 KD), and finally the solvent is changed into buffer solution 2.

Finally, the particle size of the sample was measured as shown in FIG. 2.

EXAMPLE 3 vaccine prepared by mixing Liposome composite adjuvant with novel coronavirus S protein antigen induces humoral and cellular immune responses

Recombinant novel coronavirus variant vaccine Spike protein (Spike, hereinafter referred to as S protein) expressed by Chinese hamster ovary cell line (CHO cell) expression system has an amino acid sequence shown in SEQ ID No. 2. 70 SPF-class female BALB/c mice (6-8 weeks old) were grouped. 10 mice per group, 7 groups total. The experimental mice of each group were immunized according to the table below with the immunization site being the muscle of the right hind leg of the mice, the immunization volume being 0.1 ml/mouse (0.05 ml each for the left and right hind legs), 2 total immunizations per mouse, and the immunization interval being 3 weeks. Blood was collected on day 13 (D34) after immunization 2, after which the blood was taken overnight at 4℃and centrifuged at 7000rpm for 10 minutes, serum was isolated, inactivated at 56℃for 30 minutes and stored at-20 ℃. Neutralizing antibody titers in serum were detected by ELISA assay and pseudovirus neutralization assay. At the end of day 14 post 2 immunization (D35), 5 mice were sacrificed per group and vaccine-induced cellular immune responses were detected by ELISPOT and ICS.

TABLE 1 animal experimental grouping information table

Group of	Antigens	Adjuvant
			Negative control: PBS (phosphate buffered saline)	PBS	Without any means for
Experiment group 1: S+AH	5.0μg S	50μg Al(OH) 3
			Experiment group 2: S+AS01 B	5.0μg S	AS01 B Comprises liposome +5 μg MPLA +5 μg QS-21
Experiment group 3: S+Lipo/CpG7909/QS21	5.0μg S	Liposome/50. Mu.g CpG 7909/5.0. Mu.g QS-21
			Experiment group 4: S+Lipo/MPLA/CpG7909	5.0μg S	Liposome/5.0μg MPLA/50μg CpG
Experimental group 5: S+CpG7909	5.0μg S	50μg CpG7909
			Experiment group 6: S+AH/CpG7909	5.0μg S	50μg Al(OH) 3 /50μg CpG7909

Humoral immune reaction detection adopts an Enzyme-linked immunosorbent assay (Enzyme-Linked Immunosorbent Assay, ELISA) and a pseudovirus neutralization assay.

The ELISA method comprises the following steps: the enzyme label plate is coated with the antigen S protein of the used batch, then Mouse serum with different dilutions is added, then Anti-Mouse IgG (H+L) -HRP Conjugate (from Bio-rad cat No. 170-6516) is added for incubation for 1 hour at 37 ℃, and finally TMB substrate (from KPL cat No. 5120-0038) is reacted for 15 minutes, 2M H ₂ SO ₄ The color development was terminated, and the cut-off (cut off) value was set to 0.105 OD450-620 (2.1 times the OD value of the negative control group, 0.05, less than 0.05 by 0.05).

The results of each group binding antibody titer (gmt±95% ci) are shown (fig. 3): the S+Lipo/CpG7909/QS21, S+Lipo/CpG7909/QS21 and S+AH/CpG7909 groups induced high titer serum antibody responses relative to the PBS group and combined with commercial adjuvants (AS 01 _B ) The effect is not obviously different.

Pseudovirus neutralization experimental method: diluting serum to be tested by multiple ratio, and mixing with 100 TCID ₅₀ Pseudoviruses (mutant VSV virus genome is used as skeleton, SASR-CoV-2 spike protein is expressed on the surface of virus particle, and its preparation method is described in Quantification of SARS-CoV-2 neutralizing antibody by a pseudotyped virus-based assay, nat Protoc 2020 Nov; 15 (11): 3699-3715. Doi: 10.1038/s)41596-020-0394-5. Epub 2020 Sep 25. PMID: 32978602.) and 1 hour, the virus-serum mixture was added to BHK-21-hACE2-gluc cells in the logarithmic growth phase (the cells were purchased from university of Wuhan, 2X 10) ⁴ Each cell per well), put into CO at 37 DEG C ₂ After incubation for 24 hours in an incubator, 50 μl of cell lysate (from Promega, cat. E1941) was added to each well for 30 minutes, followed by 50 μl of luciferase substrate (from Perkin Elmer, cat. 6066769), the luminescence was read after 2 minutes of reaction at room temperature in the dark, and the Reed-Muench rule calculated antibody neutralization titer at 50% serum inhibition.

The pseudovirus neutralization titer (gmt±95% ci) results for each group are shown (fig. 4): S+Lipo/CpG7909/QS21 vaccine group induces pseudovirus neutralizing antibody titer generated by mice and AS01 developed by GSK _B The vaccine prepared by the adjuvant combined with the S protein can induce the pseudo virus generated by mice to have comparable neutralizing antibody titer results, and no obvious difference exists between the two groups. And the titer of the pseudo-virus neutralizing antibody of the S+Lipo/CpG7909/QS21 group is obviously higher than that of the other groups with different adjuvant proportions, which proves that the combination of the Lipo/CpG7909/QS21 adjuvant and the S protein can induce the mice to generate stronger humoral immune response.

T cell response assays were performed using the intracellular cytokine staining method (Intracellular Cytokine Staining, ICS) and the Enzyme-linked immunospot assay method (Enzyme-linked immunospot, ELISPOT).

Intracellular cytokine staining method: spleen lymphocytes from mice were isolated and the cell suspension was 1X 10 per well ⁶ Cell numbers were plated in 96-well cell culture plates. At the same time, a library of stimulating polypeptides (consisting of 169 polypeptides covering the full length of the S protein sequence, 18 amino acids in length and 11 overlapping adjacent polypeptides, custom-made, geneScript) 0.1% anti-CD 28 antibody (from BD, cat. No. 553047) and 0.1% Golgi apparatus (from BD, cat. No. 51-2301 KZ) were added to each well at a final concentration, and after mixing, incubated in a 37℃cell incubator for about 6 hours. Cells were collected by centrifugation and assayed with different fluorescein labelled anti-CD 3 mab (from Biolegend, cat. No. 100214), anti-CD 4 mab (from BD, cat. No. 553047) and Aqua (from Invitrogen, cat. No. L34965), respectivelyAntibody staining followed by treatment with cell membrane penetrating fluid, intracellular staining with fluorescein-labeled anti-IL-2 mab (purchased from BD, cat No. 560547), anti-TNF- α mab (purchased from BD, cat No. 557644), anti-IFN- γ mab (purchased from BD, cat No. 560660) and anti-IL-4 mab (purchased from BD, cat No. 554389) specifically examined the ability of post-immune mouse spleen cells to secrete IFN- γ, IL-2, TNF- α and IL-4 by cd4+ T cells and cd8+ T cells stimulated by the S polypeptide pool.

ICS experiment (mean.+ -. SD) results show (FIG. 5): the S+lipo/CpG7909/QS21 group induced IFN-. Gamma.in the mouse CD4+ T lymphocytes and CD8+ T lymphocyte subsets after S protein stimulation, the proportion of IL-2, TNF-. Alpha.and IL-4 positive cells was significantly higher than for all other groups. The vaccine prepared by the liposome composite adjuvant of 'liposome + CpG + QS-21' combined with the S antigen can induce the T cell immune response which is obviously superior to other groups.

ELISPOT method: spleen lymphocytes from mice were isolated and cell suspensions were plated at 5X 10 cells per well ⁵ Cell numbers were plated in 96-well cell culture plates. At the same time, the stimulating polypeptide library and 0.1% anti-CD 28 antibody are added into each well according to the final concentration of 1ug/ml, and the mixture is cultured in a cell culture box at 37 ℃ for 48 hours after being uniformly mixed. Add detection primary antibodies R4-6A2-BAM (available from MABTECH under the trade designation FS-4142-2), 5H4-biotin (available from MABTECH under the trade designation FS-4142-2) and MT11B10-WASP (available from MABTECH under the trade designation FSP-414245-2) and incubate at room temperature for 2 hours; then adding detection secondary antibodies anti-BAM-490, SSA-550 and WASP-640 (both the secondary antibody and the primary antibody are reagents provided in the same kit), incubating for 1 hour at room temperature in the dark, adding Fluorescence enhancer-II (purchased from MABTECH, cat. No. FS-4142-10), developing for 15 minutes at room temperature in the dark, and scanning and counting by an ELISPOT reader (model C.T.L. Analyzer).

The ELISPOT experiment (mean±sd) results show (fig. 6): lymphocytes from the S+Lipo/CpG7909/QS21 and S+Lipo/MPL/QS21 groups each were capable of secreting potent IL-2, IFN-gamma, TNF-alpha and IL-4 cytokines upon stimulation by the S polypeptide, wherein S+Lipo/CpG7909/QS21 had a significant enhancement of IL-4 cytokine secretion, IL-4 cytokine enhancement indicated that the vaccine induced an immune response biased toward the Th2 pathway, and IL-2, IFN-gamma and TNF-alpha cytokine enhancement indicated that the vaccine induced an immune response biased toward the Th1 pathway. The results indicate that the S+Lipo/CpG7909/QS21 group is capable of inducing cytokine secretion that balances the Th1 and Th2 pathways. The bleeding of the 4 cytokines of the other adjuvant group was less than that of the s+lipo/CpG7909/QS21 group.

Although certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those skilled in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention.

Sequence listing

<110> Shanghai ze Biotech Co., ltd

<120> composite adjuvant and vaccine formulation containing the same

<130> CPCH2162033N

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 24

<212> DNA

<213> artificial sequence

<400> 1

tcgtcgtttt gtcgttttgt cgtt 24

<210> 2

<211> 1248

<212> PRT

<213> artificial sequence

<400> 2

Met Glu Phe Gly Leu Ser Trp Leu Phe Leu Val Ala Ile Leu Lys Gly

1 5 10 15

Val Gln Cys Gln Cys Val Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro

20 25 30

Ala Tyr Thr Asn Ser Phe Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val

35 40 45

Phe Arg Ser Ser Val Leu His Ser Thr Gln Asp Leu Phe Leu Pro Phe

50 55 60

Phe Ser Asn Val Thr Trp Phe His Ala Ile His Val Ser Gly Thr Asn

65 70 75 80

Gly Thr Lys Arg Phe Asp Asn Pro Val Leu Pro Phe Asn Asp Gly Val

85 90 95

Tyr Phe Ala Ser Thr Glu Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe

100 105 110

Gly Thr Thr Leu Asp Ser Lys Thr Gln Ser Leu Leu Ile Val Asn Asn

115 120 125

Ala Thr Asn Val Val Ile Lys Val Cys Glu Phe Gln Phe Cys Asn Asp

130 135 140

Pro Phe Leu Gly Val Tyr Tyr His Lys Asn Asn Lys Ser Trp Met Glu

145 150 155 160

Ser Glu Phe Arg Val Tyr Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr

165 170 175

Val Ser Gln Pro Phe Leu Met Asp Leu Glu Gly Lys Gln Gly Asn Phe

180 185 190

Lys Asn Leu Arg Glu Phe Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys

195 200 205

Ile Tyr Ser Lys His Thr Pro Ile Asn Leu Val Arg Asp Leu Pro Gln

210 215 220

Gly Phe Ser Ala Leu Glu Pro Leu Val Asp Leu Pro Ile Gly Ile Asn

225 230 235 240

Ile Thr Arg Phe Gln Thr Leu Leu Ala Leu His Arg Ser Tyr Leu Thr

245 250 255

Pro Gly Asp Ser Ser Ser Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr

260 265 270

Val Gly Tyr Leu Gln Pro Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn

275 280 285

Gly Thr Ile Thr Asp Ala Val Asp Cys Ala Leu Asp Pro Leu Ser Glu

290 295 300

Thr Lys Cys Thr Leu Lys Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln

305 310 315 320

Thr Ser Asn Phe Arg Val Gln Pro Thr Glu Ser Ile Val Arg Phe Pro

325 330 335

Asn Ile Thr Asn Leu Cys Pro Phe Gly Glu Val Phe Asn Ala Thr Arg

340 345 350

Phe Ala Ser Val Tyr Ala Trp Asn Arg Lys Arg Ile Ser Asn Cys Val

355 360 365

Ala Asp Tyr Ser Val Leu Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys

370 375 380

Cys Tyr Gly Val Ser Pro Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn

385 390 395 400

Val Tyr Ala Asp Ser Phe Val Ile Arg Gly Asp Glu Val Arg Gln Ile

405 410 415

Ala Pro Gly Gln Thr Gly Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro

420 425 430

Asp Asp Phe Thr Gly Cys Val Ile Ala Trp Asn Ser Asn Asn Leu Asp

435 440 445

Ser Lys Val Gly Gly Asn Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys

450 455 460

Ser Asn Leu Lys Pro Phe Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln

465 470 475 480

Ala Gly Ser Thr Pro Cys Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe

485 490 495

Pro Leu Gln Ser Tyr Gly Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln

500 505 510

Pro Tyr Arg Val Val Val Leu Ser Phe Glu Leu Leu His Ala Pro Ala

515 520 525

Thr Val Cys Gly Pro Lys Lys Ser Thr Asn Leu Val Lys Asn Lys Cys

530 535 540

Val Asn Phe Asn Phe Asn Gly Leu Thr Gly Thr Gly Val Leu Thr Glu

545 550 555 560

Ser Asn Lys Lys Phe Leu Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala

565 570 575

Asp Thr Thr Asp Ala Val Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp

580 585 590

Ile Thr Pro Cys Ser Phe Gly Gly Val Ser Val Ile Thr Pro Gly Thr

595 600 605

Asn Thr Ser Asn Gln Val Ala Val Leu Tyr Gln Asp Val Asn Cys Thr

610 615 620

Glu Val Pro Val Ala Ile His Ala Asp Gln Leu Thr Pro Thr Trp Arg

625 630 635 640

Val Tyr Ser Thr Gly Ser Asn Val Phe Gln Thr Arg Ala Gly Cys Leu

645 650 655

Ile Gly Ala Glu His Val Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile

660 665 670

Gly Ala Gly Ile Cys Ala Ser Tyr Gln Thr Gln Thr Asn Ser Pro Gly

675 680 685

Gly Ser Gly Ser Val Ala Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser

690 695 700

Leu Gly Ala Glu Asn Ser Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile

705 710 715 720

Pro Thr Asn Phe Thr Ile Ser Val Thr Thr Glu Ile Leu Pro Val Ser

725 730 735

Met Thr Lys Thr Ser Val Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser

740 745 750

Thr Glu Cys Ser Asn Leu Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln

755 760 765

Leu Asn Arg Ala Leu Thr Gly Ile Ala Val Glu Gln Asp Lys Asn Thr

770 775 780

Gln Glu Val Phe Ala Gln Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile

785 790 795 800

Lys Asp Phe Gly Gly Phe Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser

805 810 815

Lys Pro Ser Lys Arg Ser Phe Ile Glu Asp Leu Leu Phe Asn Lys Val

820 825 830

Thr Leu Ala Asp Ala Gly Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly

835 840 845

Asp Ile Ala Ala Arg Asp Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu

850 855 860

Thr Val Leu Pro Pro Leu Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr

865 870 875 880

Ser Ala Leu Leu Ala Gly Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala

885 890 895

Gly Ala Ala Leu Gln Ile Pro Phe Ala Met Gln Met Ala Tyr Arg Phe

900 905 910

Asn Gly Ile Gly Val Thr Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu

915 920 925

Ile Ala Asn Gln Phe Asn Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu

930 935 940

Ser Ser Thr Ala Ser Ala Leu Gly Lys Leu Gln Asp Val Val Asn Gln

945 950 955 960

Asn Ala Gln Ala Leu Asn Thr Leu Val Lys Gln Leu Ser Ser Asn Phe

965 970 975

Gly Ala Ile Ser Ser Val Leu Asn Asp Ile Leu Ser Arg Leu Asp Pro

980 985 990

Pro Glu Ala Glu Val Gln Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln

995 1000 1005

Ser Leu Gln Thr Tyr Val Thr Gln Gln Leu Ile Arg Ala Ala Glu

1010 1015 1020

Ile Arg Ala Ser Ala Asn Leu Ala Ala Thr Lys Met Ser Glu Cys

1025 1030 1035

Val Leu Gly Gln Ser Lys Arg Val Asp Phe Cys Gly Lys Gly Tyr

1040 1045 1050

His Leu Met Ser Phe Pro Gln Ser Ala Pro His Gly Val Val Phe

1055 1060 1065

Leu His Val Thr Tyr Val Pro Ala Gln Glu Lys Asn Phe Thr Thr

1070 1075 1080

Ala Pro Ala Ile Cys His Asp Gly Lys Ala His Phe Pro Arg Glu

1085 1090 1095

Gly Val Phe Val Ser Asn Gly Thr His Trp Phe Val Thr Gln Arg

1100 1105 1110

Asn Phe Tyr Glu Pro Gln Ile Ile Thr Thr Asp Asn Thr Phe Val

1115 1120 1125

Ser Gly Asn Cys Asp Val Val Ile Gly Ile Val Asn Asn Thr Val

1130 1135 1140

Tyr Asp Pro Leu Gln Pro Glu Leu Asp Ser Phe Lys Glu Glu Leu

1145 1150 1155

Asp Lys Tyr Phe Lys Asn His Thr Ser Pro Asp Val Asp Leu Gly

1160 1165 1170

Asp Ile Ser Gly Ile Asn Ala Ser Val Val Asn Ile Gln Lys Glu

1175 1180 1185

Ile Asp Arg Leu Asn Glu Val Ala Lys Asn Leu Asn Glu Ser Leu

1190 1195 1200

Ile Asp Leu Gln Glu Leu Gly Lys Tyr Glu Gln Tyr Ile Lys Trp

1205 1210 1215

Pro Gly Ser Gly Tyr Ile Pro Glu Ala Pro Arg Asp Gly Gln Ala

1220 1225 1230

Tyr Val Arg Lys Asp Gly Glu Trp Val Leu Leu Ser Thr Phe Leu

1235 1240 1245

<210> 3

<211> 3750

<212> DNA

<213> artificial sequence

<400> 3

atggagttcg gcctgagctg gctgttcctg gtggccatcc tgaagggcgt gcagtgtcag 60

tgcgtgaacc tgaccacaag gacccagctg ccacctgcct ataccaactc tttcacaagg 120

ggcgtgtact atcctgacaa ggtgtttcgg tccagcgtgc tgcactccac acaggatctg 180

tttctgccat tctttagcaa cgtgacctgg ttccacgcta tccacgtgtc cggcaccaat 240

ggcacaaaga gattcgacaa tcctgtgctg cccttcaacg atggcgtgta cttcgcctcc 300

accgagaaga gcaacatcat ccgcggctgg atctttggca ccacactgga ctctaagaca 360

cagtccctgc tgatcgtgaa caatgctacc aacgtggtca tcaaggtgtg cgagttccag 420

ttttgtaatg atcccttcct gggcgtgtac tatcataaga acaataagag ctggatggag 480

tctgagtttc gggtgtattc ttccgccaac aattgtacat ttgagtacgt gtctcagcct 540

ttcctgatgg acctggaggg caagcagggc aatttcaaga acctgaggga gttcgtgttt 600

aagaatatcg atggctactt caagatctac agcaagcaca cccccatcaa cctggtgcgg 660

gacctgcctc agggcttctc tgccctggag cccctggtgg atctgcctat cggcatcaac 720

atcaccaggt ttcagacact gctggccctg catcggtcct acctgacacc cggcgacagc 780

tcttccggat ggaccgctgg agctgctgcc tactatgtgg gctatctgca gcctaggacc 840

ttcctgctga agtacaacga gaatggcacc atcacagacg ctgtggattg cgccctggac 900

cctctgagcg agaccaagtg tacactgaag tcttttaccg tggagaaggg catctatcag 960

acatctaatt tcagagtgca gccaaccgag tccatcgtgc gctttcctaa tatcacaaac 1020

ctgtgcccat ttggcgaggt gttcaacgct acccggttcg ccagcgtgta cgcttggaat 1080

aggaagcgga tcagcaactg cgtggccgac tattctgtgc tgtacaactc cgcctccttc 1140

tccaccttca agtgctatgg cgtgtccccc acaaagctga atgacctgtg ctttaccaac 1200

gtgtacgctg attcgttcgt gatcaggggc gacgaggtgc ggcagatcgc tcctggacag 1260

acaggcaaga tcgctgacta caattataag ctgccagacg acttcaccgg ctgcgtgatc 1320

gcctggaaca gcaacaatct ggattctaaa gtgggcggca actacaatta tctgtacaga 1380

ctgtttcgca agagcaatct gaagcccttc gagagggaca tctccacaga gatctaccag 1440

gccggcagca ccccttgcaa tggcgtggag ggctttaact gttatttccc actgcagtct 1500

tacggcttcc agcccaccaa cggcgtgggc tatcagcctt accgggtggt ggtgctgtct 1560

tttgagctgc tgcacgctcc agctacagtg tgcggaccca agaagtccac caatctggtg 1620

aagaacaagt gcgtgaactt caacttcaac ggactgaccg gaacaggcgt gctgaccgag 1680

agcaacaaga agttcctgcc atttcagcag ttcggcagag acatcgccga taccacagac 1740

gctgtgcgcg acccacagac cctggagatc ctggatatca caccctgctc cttcggcggc 1800

gtgagcgtga tcacaccagg aaccaataca tctaaccagg tggccgtgct gtatcaggac 1860

gtgaactgta ccgaggtgcc tgtggctatc cacgccgatc agctgacccc aacatggagg 1920

gtgtactcta ccggctccaa cgtgtttcag acaagggctg gatgtctgat cggagctgag 1980

catgtgaaca atagctatga gtgcgacatc ccaatcggcg ccggcatctg tgcttcctac 2040

cagacccaga caaacagccc aggaggaagc ggatctgtgg cttcccagag catcatcgct 2100

tataccatgt ccctgggcgc cgagaatagc gtggcttaca gcaacaatag catcgctatc 2160

ccaaccaact tcacaatctc cgtgaccaca gagatcctgc ccgtgtctat gaccaagaca 2220

tccgtggact gcacaatgta tatctgtggc gattccaccg agtgcagcaa cctgctgctg 2280

cagtacggct cgttttgtac ccagctgaat agagccctga caggcatcgc tgtggagcag 2340

gataagaaca cacaggaggt gttcgcccag gtgaagcaga tctacaagac cccacccatc 2400

aaggactttg gcggcttcaa tttttctcag atcctgccag atccctccaa gcccagcaag 2460

agatctttta tcgaggacct gctgttcaac aaggtgaccc tggctgatgc cggcttcatc 2520

aagcagtatg gcgattgcct gggcgacatc gctgctaggg acctgatctg tgcccagaag 2580

tttaatggcc tgaccgtgct gcctccactg ctgacagatg agatgatcgc tcagtacaca 2640

tccgccctgc tggccggcac catcacatct ggatggacct tcggcgctgg agctgccctg 2700

cagatccctt ttgccatgca gatggcttat cgcttcaacg gcatcggcgt gacccagaat 2760

gtgctgtacg agaaccagaa gctgatcgcc aatcagttta actccgctat cggcaagatc 2820

caggactctc tgagctctac agcctccgcc ctgggcaagc tgcaggatgt ggtgaatcag 2880

aacgctcagg ccctgaatac cctggtgaag cagctgtcca gcaacttcgg cgccatctct 2940

tccgtgctga atgatatcct gagcagactg gacccccctg aggctgaggt gcagatcgac 3000

agactgatca caggccgcct gcagagcctg cagacctacg tgacacagca gctgatcagg 3060

gctgccgaga tccgggcttc tgccaacctg gctgccacca agatgtctga gtgcgtgctg 3120

ggccagtcca agcgcgtgga cttttgtggc aagggctatc acctgatgtc tttccctcag 3180

tccgccccac acggcgtggt gtttctgcat gtgacctacg tgcccgctca ggagaagaac 3240

ttcaccacag ctcctgccat ctgccacgat ggcaaggccc attttccaag agagggcgtg 3300

ttcgtgtcta acggcaccca ttggtttgtg acacagcgca atttctacga gccccagatc 3360

atcaccacag acaatacctt cgtgtccggc aactgtgacg tggtcatcgg catcgtgaac 3420

aataccgtgt atgatcccct gcagcctgag ctggactctt ttaaggagga gctggataag 3480

tacttcaaga atcatacctc ccctgacgtg gatctgggcg acatcagcgg catcaatgcc 3540

tctgtggtga acatccagaa ggagatcgac aggctgaacg aggtggctaa gaatctgaac 3600

gagtccctga tcgatctgca ggagctgggc aagtatgagc agtacatcaa gtggccaggc 3660

agcggctata tcccagaggc tccaagagac ggacaggctt acgtgcgcaa ggatggcgag 3720

tgggtgctgc tgtctacctt cctgtgatga 3750

Claims (10)

1. A composite adjuvant comprising a CpG oligodeoxynucleotide, QS-21 and a liposome, wherein the CpG oligodeoxynucleotide is CpG7909.

2. The compound adjuvant according to claim 1, wherein the content of CpG oligodeoxynucleotide is 10-30 wt% with respect to the total weight of CpG oligodeoxynucleotide, QS-21 and liposome.

3. The compound adjuvant of claim 1, wherein the content of QS-21 is 1-5 wt% relative to the total weight of CpG oligodeoxynucleotide, QS-21 and liposome.

4. A complex adjuvant according to any one of claims 1-3, wherein the liposome comprises phosphatidylcholine and cholesterol.

5. The compound adjuvant according to claim 4, wherein the content of phosphatidylcholine is 40-60 wt% relative to the total weight of CpG oligodeoxynucleotide, QS-21 and liposome.

6. A compound adjuvant according to claim 4 or 5, wherein the cholesterol is present in an amount of 10-15 wt% relative to the total weight of CpG oligodeoxynucleotide, QS-21 and liposome.

7. A compound adjuvant according to claim 4, wherein the phosphatidylcholine is dioleoyl phosphatidylcholine.

8. A vaccine formulation comprising the complex adjuvant of any one of claims 1-6.

9. The vaccine formulation of claim 8, wherein the vaccine formulation is a new coronavirus vaccine formulation.

10. The vaccine formulation of claim 9, wherein the novel coronavirus vaccine formulation comprises a novel coronavirus spike protein having the amino acid sequence of SEQ ID No. 2.

Images