CN116286889A - Tetrahydrofolic acid dependent dicamba demethylase gene dmt06 and application thereof - Google Patents

Abstract

The invention discloses a Tetrahydrofolate (THF) -dependent dicamba demethylase genedmt06And the use thereof,amplification of THF-dependent dicamba demethylase Gene from dicamba degradation enrichmentdmt06The nucleotide sequence of the dicamba demethylase is shown as SEQ ID NO.1, and the amino acid sequence of the coded dicamba demethylase is shown as SEQ ID NO.2. The THF-dependent dicamba demethylase gene provided by the inventiondmt06The demethylase efficiently expressed in E.coli BL21 (DE 3) has dicamba demethylase activity and degradation activity significantly higher than that of the reported dicamba demethylases Dmt and Dmt50.

Description

Tetrahydrofolic acid dependent dicamba demethylase genedmt06And applications thereof

Technical Field

The invention relates to the technical field of dicamba demethylase genes, in particular to a tetrahydrofolic acid (THF) -dependent dicamba demethylase genedmt06And applications thereof.

Background

In the past, present and future, pesticides play a significant role in agricultural production, but unscientific use of pesticides leads to exceeding pesticide residues in water, soil and atmosphere, and serious harm to natural environment and human health. The pesticide consumption in China is more than 30 ten thousand tons (raw pesticide), the pesticide utilization rate is only 20-30%, and the rest residues enter the ecological environment, so that pesticide residues in soil and agricultural products in China are generally out of standard. In the treatment method for the residual pesticide, the bioremediation, especially the microbial remediation, is safe and effective, has moderate cost and no secondary pollution, is suitable for large-area non-point source pollution remediation, and is the main stream and development direction of soil organic pollutant remediation technology. Herbicide resistance transgenes are an effective way to address herbicide phytotoxicity, whereas genes resistant to herbicides are generally derived from microbial degradation genes.

Dicamba (3, 6-dichloro-2-methoxybenzoic acid) is a broad-spectrum efficient herbicide, can kill glyphosate resistant weeds, and is a good herbicide-resistant transgenic target herbicide. The degradation of dicamba in the environment is currently mainly microbial degradation, and various degradation strains of dicamba have been screened at present. The initial step of microbial degradation of dicamba is demethylation to yield 3, 6-dichlorosalicylic acid (3, 6-dichlorosalicyclic acid, 3, 6-DCSA) without herbicidal activity. Two types of dicamba demethylases have been reported: (1) Mono-oxygenase dicamba demethylase DMO (dicambammonoxy)genase), cloned fromStenotrophomonas maltophiliaDI-6, a three-component monooxygenase that relies on NADH to provide reducing power. (2) Tetrahydrofolate dependent (THF) demethylase: yao et al (2016) and Chen et al (2019) fromRhizorhabdus dicambivoransCloning of two THF-dependent dicamba demethylase genes in Ndbn-20dmtAnddmt50. Dmt and Dmt50 have very high demethylating activity as DMO; however, compared with DMO, the obvious disadvantage of Dmt and Dmt50 is that the activity is severely feedback-inhibited by the product 5-methyl-tetrahydrofolate (5-methyl-THF), which greatly limits the application value. The dicamba resistant crop is successfully constructed by the Monsanto company by utilizing a dicamba demethylase gene DMO from a bacterial source, and the planting area in 2018 is approximately 3 hundred million mu. With the development of dicamba blends and the continuous and deep research of dicamba-resistant transgenic crop technology, the worldwide demand of dicamba must be greatly increased. At present, few western biotechnology is a huge dominant property system of transgenic technology, and our country also lacks herbicide-resistant gene (enzyme) resources with independent property, which severely restricts the cultivation of new varieties of herbicide-resistant transgenic crops in our country. Therefore, the novel efficient dicamba demethylase and the gene resource thereof are obtained, have good application value in the aspects of the construction of dicamba resistant crops and the bioremediation of dicamba pollution, and have positive significance in promoting the innovation of agricultural and environmental biotechnology in China.

The obtained dicamba demethylase gene has the following main functions in the process of treating pesticide residues, and (one) the enzyme preparation is prepared by adopting a modern microbial fermentation technology and an enzyme purification technology to realize in-situ soil restoration. Secondly, the degradation genes are introduced into crops to construct corresponding herbicide resistance transgenic crops through modern biotechnology, so that the research on dicamba demethylase genes is very important in theory and practical application value.

Disclosure of Invention

In view of the above problems, an object of the present invention is to provide a novel and highly efficient THF-dependent dicamba demethylase genedmt06Solves the problems of low activity and product inhibition of the existing dicamba demethylase.

The technical scheme for solving the problems is as follows:

THF-dependent dicamba demethylase genedmt06(THF-dependent dicamba demethylase Gene)dmt06Short for shortdmt06) The nucleotide sequence is SEQ ID NO.1.

Further, the saiddmt06Amplification from dicamba degradation enrichment solution: soil samples are collected from drain outlets of agricultural factories for producing dicamba for a long time, an enriched liquid capable of efficiently degrading the dicamba is obtained through subculture, and two schemes of cloning dicamba demethylase genes from the enriched liquid are adopted: purifying, screening and identifying degradation strains: carrying out gradient dilution on the enrichment solution with degradation effect, selecting a flat plate with proper dilution gradient, picking single bacterial colonies, culturing a large amount of picked single bacteria, and then respectively identifying the effect of degrading dicamba. And (3) carrying out 16S rRNA gene sequencing on the single bacteria with the dicamba degrading capability, and finally identifying the strain with the dicamba degrading capability. And then genome sequencing to obtain genome sketch of the degradation strain, and comparing the reported dicamba gene sequence with the newly obtained genome sketch of the dicamba degradation strain to find dicamba demethylase genes in the degradation strain. And secondly, obtaining dicamba degradation strains finally through a mode of passage, single colony separation and degradation effect identification, finding a conservation region by comparing sequences of reported dicamba demethylase genes, amplifying the conservation region of the dicamba demethylase genes in the enrichment liquid by taking total DNA of the enrichment liquid of the dicamba degradation as a template through designing a merge primer, and amplifying gene fragments before and after the conservation region through SEFA-PCR to finally obtain new dicamba demethylase genes.

Dicamba demethylase Dmt06 (dicamba demethylase Dmt06 abbreviated as Dmt 06) is prepared fromdmt06The nucleotide sequence is encoded.

Further, the amino acid sequence of the Dmt06 is SEQ ID NO.2.

An efficient recombinant expression vector, wherein the expression vector contains the above-mentioned componentsdmt06。

PreferablyThe high-efficiency recombinant expression vector passes throughdmt06Inserted between the NdeI and HindIII sites of pET-29a (+).

A genetically engineered bacterium comprising the abovedmt06。

Preferably, the expression strain of the genetically engineered bacterium is escherichia coli BL21 (DE 3).

Another object of the invention is to providedmt06And Dmt06 and genetic engineering bacteria.

THF-dependent dicamba demethylase genedmt06The application scene of the application comprises: the application in constructing dicamba-resistant transgenic crops and in degrading or removing dicamba residues in the environment.

The application of the dicamba demethylase Dmt06 comprises the following application scenes: the application of the herbicide dicamba in degradation and the application of the herbicide dicamba in degradation or removal of residual dicamba in the environment.

The application of the genetically engineered bacterium comprises the following application scenes: application in degrading or removing dicamba residue in the environment.

Due to the adoption of the technical scheme, compared with the prior art, the invention has the following advantages:

(1) The invention clones a novel THF-dependent dicamba demethylase genedmt06Blastp on-line amino acid sequence analysis and homology comparison were performed in NCBI (the UniProtKnowledgeBase/SwissProtdatabases) to find that the gene is a novel gene, and the total length (from the start codon to the stop codon) is 1422bp, and 473 amino acids can be encoded.

(2) The specific enzyme activity of the dicamba demethylase Dmt06 provided by the invention for degrading dicamba reaches 165nmol/min/mg, which is obviously higher than that of Dmt (114 nmol/min/mg) and Dmt50 (146 nmol/min/mg).

(3) The THF-dependent dicamba demethylase gene provided by the inventiondmt06The method can also be used for constructing recombinant strains for degrading dicamba, is used for removing the dicamba in soil and water, and has very important theoretical and application values.

Drawings

FIG. 1 is an ultraviolet scan spectrum of enriched liquid degradation dicamba (solid line represents sample taken at 0h, dotted line represents sample taken at 6h, and dotted line represents sample taken at 12 h);

FIG. 2 is an HPLC detection spectrum of enriched liquid degradation dicamba (A: dicamba standard, B:3,6-DCSA standard, C: sample collected at 6h, D: sample collected at 12h, E: sample collected at 18 h);

FIG. 3 is a graph of the detection of THF dependent demethylase gene amplified from total DNA of the enrichment (A: amplified fragments from total DNA of the enrichment using degenerate primers, wherein M: DNA Marker,1: amplified products using primers dF1 and dR 1; B: SEFA-PCR to obtain the target fragment upstream and downstream genes, wherein M: DNA Marker,1: first round PCR of the upstream gene, 2: first round PCR of the downstream gene, 3: second round PCR of the upstream gene, 4: second round PCR of the downstream gene);

FIG. 4 is a SDS-PAGE gel of purified Dmt06 (M: protein Marker;1:E.coli BL21 (pET 29 a) induces crude enzyme; 2:E.coli BL21(pET29a-dmt06) Inducing crude enzyme solution; 3: purified Dmt 06);

FIG. 5 is an HPLC detection spectrum of Dmt06 dicamba degradation (A: dicamba standard, B:3,6-DCSA standard, C: sample taken 5min, D: sample taken 10 min);

fig. 6 is an MS profile of Dmt06 versus the product produced during dicamba conversion;

FIG. 7 is a graph showing the effect of pH on the enzyme activity of Dmt 06;

FIG. 8 is a graph showing the effect of temperature on the enzyme activity of Dmt 06;

FIG. 9 is a graph showing the effect of metal ions and chemical reagents on the enzyme activity of Dmt 06.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention and fig. 1 to 9. It will be apparent that the described embodiments are some, but not all, embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The microbial sources used in the following examples are as follows: the E.coli high expression vector pET-29a (+) is purchased from Novegen, and the expression host bacterium E.coli BL21 (DE 3) is purchased from Shanghai Ying Jun Biotechnology Co.

Example 1

Cloning of dicamba demethylase Gene

1.1 enrichment domestication of degradation strains

The enriched matrix for enriching dicamba degradation strains is obtained from biochemical sludge of Yannong chemical industry for producing dicamba for a long time, farmland soil for using dicamba for a long time, and the like. Taking 5.0g of soil sample, adding into 100 ml low-chlorine basic salt culture medium, adding 500mg/L dicamba, and 180r min at 30deg.C ^-1 Culture 5d was transferred to the same medium at an inoculum size of 5% and transferred continuously. The time sampling is carried out, whether the enrichment liquid after passage has degradation effect or not is detected by an ultraviolet scanner, and the detection result shows that one enrichment liquid can efficiently degrade dicamba. In the first passage, 11 d degrades 70% of 500mg/L dicamba, with increasing passage times, the degradation capacity of dicamba gradually increases, and after 6 passage culture, the enriched liquid can degrade 500mg/L dicamba basically at 12h, and the degradation condition is detected by ultraviolet scanning as shown in figure 1.

Gradient diluting the enriched liquid with degradation effect to obtain 10 ^-4 ~10 ^-7 0.1mL of each diluted enrichment solution is coated on a solid culture medium flat plate added with 500mg/L dicamba, after culturing for 5 days at 30 ℃, single colonies which are grown are picked up, the single colonies are further purified by a streaking method, and the single colonies which are picked up and purified are inoculated in a low-chlorine basic salt culture medium containing 500mg/L dicamba, and the temperature is 30 ℃ and 180r min ^-1 Shaking culture 3 d, and the degradation effect is verified by ultraviolet scanning. Through purification screening, more than 100 strains are screened, and through single-strain purification and degradation experiments, strains capable of degrading dicamba are not found finally.

The formula of the low-chlorine basic salt culture medium is as follows: 1.3g, K ₂ HPO ₄ ；0.87 g，KH ₂ PO ₄ ；0.66 g，(NH4) ₂ SO ₄ ；0.097 g，MgSO ₄ ；0.025 g，MnSO ₄ ·H ₂ O；5 mg，FeSO ₄ ·7H ₂ O；1.26 mg，CaSO ₄ ·6H ₂ O, adding deionized water to 1L, and pH 7.0; the solid medium was added with 15.0. 15.0 g agar.

1.2 evaluation of degradation Effect and metabolite analysis

The degradation effect verification method comprises the following steps: the qualitative experiment mainly adopts detection ultraviolet scanning spectrum with the wavelength range of 200 nm-350 nm, and the culture solution sampled at fixed time is centrifuged to remove thalli, and the supernatant is directly used for ultraviolet scanning. Quantitative detection, high Performance Liquid Chromatography (HPLC) detection and sample treatment method: the lyophilized dry product of the enriched culture liquid of 1mL was dissolved in 1mL methanol (chromatographic purity), filtered through a filter membrane (pore size 0.22 μm) and detected by high performance liquid chromatography. Liquid chromatography conditions: the mobile phase is acetonitrile, methanol and water, acetic acid (31.7:7.5:58.4:2.4, V/V), zorbax C218 ODS Spherex reverse phase column (5 μm,4.6 mm. Times.250 mm, agilent, USA), the column temperature is room temperature, the ultraviolet detector measuring wavelength is 275 nm (to detect dicamba) and 319 nm (to detect 3, 6-DCSA), the sample feeding amount is 20. Mu.L, the flow rate is 0.8 mL.min ^-1 . The external standard method is quantified according to peak area. Identification of metabolites by HPLC-MS, conditions: the mobile phase is acetonitrile, methanol, water, acetic acid (31.7:7.5:58.4:2.4, V/V), agilent XDB-C ₁₈ 5cm, 0.46 cm,1.8 mm reverse phase column, flow rate 0.25 mL min ^-1 . MS analysis used ESI mode with detector Agilent G6410B Triple Quad Mass Spectrometer.

The high performance liquid phase detection results are shown in fig. 2, and the experimental results show that the enrichment solution can degrade dicamba and generate a product peak, the peak outlet position of the enrichment solution is the same as that of a 3,6-dichloro salicylic acid (3, 6-DCSA) standard product, and the peak of the 3,6-DCSA gradually disappears along with the extension of time. HPLC detection results show that the first step in dicamba degradation is demethylation to produce the intermediate 3, 6-dichlorosalicylic acid (3, 6-DCSA), and the concentrate is ultimately able to completely degrade dicamba (FIG. 2).

Example 2

dmt06Cloning and functional verification of (C)

2.1 verification of coarse enzymatic Activity of enriched liquid for efficient degradation of dicamba

And (3) re-passaging the dicamba high-efficiency degradation enrichment liquid, carrying out centrifugation at 6000 rpm to collect thalli in the enrichment liquid after degradation of 12h, discarding supernatant to collect thalli, washing thalli by adopting a proper amount of precooled MSM culture medium, resuspending thalli by adopting 5mL of PBS (phosphate buffered saline) precooled in advance, placing the bacterial suspension in ice for precooling, crushing thalli cells by using 180 Hz ultrasonic waves for 10min, carrying out the whole process in an ice bath, centrifuging the crushing liquid at 4 ℃ for 10min at 13000 rpm, obtaining supernatant which is crude enzyme liquid, and detecting the concentration of protein in the crude enzyme liquid by adopting a BCA method. 300. The components in the mu L crude enzyme liquid enzymatic reaction system are as follows: 100 mM PBS (pH 7.4) buffer, 2.0 mM NADH or THF,0.5 mM dicamba, 50 μl crude enzyme. The reaction system is placed in a water bath kettle at 30 ℃ for reaction for 5min, and then heated in the water bath kettle at 100 ℃ to terminate the reaction. The residual amount of dicamba was measured by HPLC and its activity was calculated, and one enzyme activity unit (U) was defined as the amount of enzyme required to convert 1 nmol of dicamba by reaction at pH 7.4 at 30℃for 1.0 min. The experimental results are shown in Table 1, indicating that the dicamba demethylase in this enriched pool is THF dependent, rather than NADH independent monooxygenase.

TABLE 1 detection of crude enzyme dicamba demethylase Activity in enrichment

2.2 Cloning from dicamba enrichmentdmt06

2.2.1 Extraction of total DNA from genome of enriched liquid

And (3) obtaining a high-efficiency degradation enrichment solution of the 6 th generation dicamba through passage, centrifuging at 12000 rpm for 10min, collecting thalli, and washing the thalli twice by adopting sterile water. The total DNA of the enrichment solution is extracted by adopting an improved high-salt extraction method, and is dissolved in TE buffer solution (pH 8.0) and preserved at-20 ℃, and the specific method is referred to the fine-programming molecular biology experimental guideline of F.Osbur et al.

2.2.2 dmt06Is cloned from (A)

The known dicamba demethylase (DesA, ligM, dmt and Dmt 50) amino acid sequences were downloaded and aligned, and degenerate primers, 2 forward primers and 2 reverse primers (as in table 2) were designed based on the conserved regions of the 4 THF-dependent demethylase genes reported. Forward primer: dF1, dF2 and reverse primer: dR1 and dR2, respectively adopting dF1 and dR1, dF1 and dR2, dF2 and dR1, dF2 and dR2 as primers, using total DNA of the enrichment solution as a template, and amplifying a conserved region of a demethylase gene fragment from the total DNA of the enrichment solution by PCR。

PCR amplification system:

primer star enzyme (5U/. Mu.l) 0.5. Mu.l

5× PCR Buffer II (Mg ²⁺ Plus) 10 μl

dNTP mix (2.5 mM each) 2. Mu.l

Template DNA 10 ng

Forward primer (20. Mu.M) 1. Mu.l

Reverse primer (20. Mu.M) 1. Mu.l

Sterilizing distilled water to 50 μl

PCR amplification procedure:

a.98 ℃ denaturation for 3 min;

denaturation at 98℃for 0.5 min, annealing at 53℃for 0.5 min, extension at 72℃for 1 min, 30 cycles;

c, extending at 72 ℃ for 10min, and cooling to room temperature.

The result of PCR amplification experiment on the conserved region shows that the primers dF1 and dR1 can amplify a segment of gene segment of about 600 bp, the amplification result is shown in figure 3, which accords with the theoretical result, the conserved segment of the amplified target gene is purified and connected to a T carrier through TA cloning, and is transformed intoE.coliDH5 alpha, then extracting plasmid and sending to the engineering Co Ltd for sequencing, comparing the detected sequence with the reported dicamba demethylase sequence, and comparing the fragment withdmt50The sequence similarity of the regions 191-818 and bp of the genes reaches 74.3 percent. By using the SEFA-PCR technology disclosed by the laboratory, the upstream and downstream sequences (Wang, S.M., he, J., cui, Z.L., li, S.P. Self-formed adaptor PCR: a simple and)efficient method for chromosome walking, appl, environ, microbiol, 2007, 73, 5048-5051.) the upstream fragment was amplified using primers uSP1, uSP2, uSP3, using primers: dSP1, dSP2, dSP3 (as in Table 2) amplified the downstream fragment of the conserved region. The complete dicamba demethylase gene is finally obtained through splicing and is named asdmt06(i.e., tetrahydrofolate dependent dicamba demethylase Gene)dmt06）。dmt061422bp, coding 473 amino acids, amino acid sequence alignment in NCBI was founddmt06Most closely to the THF-dependent methyltransferase and aminomethyltransferase family protein sequences,dmt06and come fromActinomadura parvosataOne annotation of subsp, kistnae is that the sequence similarity of possible aminomethyltransferases (not functionally verified) amounts to 100%,dmt06homology to the known functional proteins dicamba demethylase Dmt50 and Dmt was 72.3% and 46.2%.

2.2.3 dmt06Construction of expression vectors

(1) PCR amplificationdmt06

The total DNA of the enrichment solution is used as a template, and 2X Phanta Master Mix and a primer pET-dmt06F and pET-dmt06Specific amplification of the THF-dependent dicamba demethylase Gene by R (as Table 2)dmt064 mu L of PCR product is taken for agarose gel electrophoresis, and after EB dyeing for 8 min, the size and the specificity of the fragment are detected by an ultraviolet analyzer through photographing.

TABLE 2 primers and corresponding nucleotide sequences

Primer(s)	Nucleotide sequence
		dF1	5’-CTC(G)TTCG(A)ACCAGT(A)CC(G)CACCACATG-3’
dF2	5’-TCGGCGACT(G)GC(G)ATCCTG(T)TAC(T)TA(G)-3’
		dR1	5’-GGC(A)TGGATC(G)C(G)CC(G)TACCCG(C)CTG(C)GCCG-3’
dR2	5’-TC(G)AAGTTC(T)GAC(T)CAC(T)GACTTCATCGG-3’
		uSP1	AGTACACGATGCAGTCGCCGACCACGT
uSP2	AACCCGGCGAAGGTGTTGATGCCGA
		uSP3	CTTTCAGGAACAGCTNNNNNNNNNGGTGGG
dSP1	AGTGGAGCTGTCCGGCCCGTAC
		dSP2	GACACCGTACGGTCGGCCATTCTC
dSP3	AGAAGTACGGAATCGNNNNNNNNNGCACCC
		pET-dmt06-F	TAAGAAGGAGATATACATATGGGAGAAGGACGGTCCCTTCA
pET-dmt06-R	AGTGCGGCCGCAAGCTTCGGCGACCCGGCGGCCGTCGCC

(2) Construction of recombinant plasmid by double enzyme digestion, enzyme ligation and transformation of plasmid

The PCR product is purified by adopting a gel recovery kit, and the specific method is referred to the kit instruction. The plasmid pET29a (+) is extracted by using a kit and purified, and the purified plasmid is subjected to double digestion by using corresponding fast digestion enzymes.

And (3) enzyme cutting system:

10×Buffer 5 μl

Nde I 2 μl

Hind

2 μl

DNA ≤1 μg

sterilized distilled water was added to 50. Mu.l

The reaction was carried out in a water bath at 37℃for 30 min. The digested product was subjected to 0.75% agarose gel electrophoresis and gel-cut recovery.

pET29a (+) is used as an expression vector, and a homologous recombination method is adopted for vector construction. In designing the primer, the 5' end of the forward primer is added with the primerNdeI cleavage site, comprising the reverse primer at the 5' -endHind

And (3) enzyme-linking the recovered fragments with the enzyme-digested carrier at enzyme-digested sites. Reference is made to One Step Cloning kit.

The following reaction system (10 μl) was formulated in an ice-water bath:

linearized plasmid pET29a (+) 1.0. Mu.L

dmt06Gene fragment 2.0. Mu.L

Exnase II 1.0 μL

5×CE II Buffer 2.0 μL

ddH ₂ O 4.0 μL

Mixing, water-bathing at 37deg.C for 30 min, cooling in ice-water bath for 5min, and transferring homologous recombination product into large intestine rodBacterial expression strainE.coliBL21 (DE 3) competent cells. Selecting recombinant expression strain monoclonal to 50 mg L ^-1 Km 3 mL liquid LB test tube, 37 ℃,180rpm culture 8h, bacterial liquid delivering to the biological technology Co., ltd for sequencing, obtaining the strain sequencing verification correct expression strainE.coli BL21-pET-dmt06。

2.3 Expression purification and functional verification of Dmt06

2.3.1 Induction, expression and purification of Dmt06

Verification of the correct expression Strain by sequencingE.coli BL21-pET-dmt06Is transferred to 5mL and added with 50 mg.L ^-1 Shake culturing in Km LB test tube at 37deg.C and 180rpm to logarithmic phase, inoculating into LB liquid medium of 100 mL at 1% inoculum size, culturing at 37deg.C and 180rpm to OD _600nm And (3) sucking 1mL until the temperature reaches 0.4-0.6, and preserving at 4 ℃ for later use. After the bacterial liquid is precooled to 16 ℃, adding 50 mu mol.L of final concentration ^-1 Is induced at 180rpm at 16℃for 10 h. 12000 And (3) centrifuging at an rpm for 5min to collect thalli, washing the thalli twice by using PBS, re-suspending the thalli by using 10 mL of 50mM PBS (pH 7.4) precooled, carrying out ultrasonic crushing for 5-10 min under an ice bath condition, centrifuging the crushed liquid at a temperature of 4 ℃ for 30 min at 12000 rpm, and reserving a supernatant, wherein the supernatant is the crude enzyme liquid of the thalli. Co is adopted ²⁺ The recombinant protein Dmt06 is purified by an affinity chromatography column, the band singleness and the protein size of the purified protein are detected by SDS-PAGE, the detection results are shown in figure 4, the sizes of demethylases are about 55kDa, the sizes are consistent with the theoretical value (52.3 kDa), and the purified protein has high content and single band. After SDS-PAGE, the purified target proteins were pooled and dialyzed, and the pure enzyme concentration of Dmt06 was quantified by BCA (BCA Protein Assay Kit, shanghai Biotechnology Co., ltd.).

2.3.2 Functional verification of recombinant expression protein Dmt06

The essential components of the Dmt06 dicamba methyltransferase reaction system included 2.0 mM THF, 0.5. 0.5 mM dicamba and 0.1. 0.1 mg purified Dmt06, and were made up to 300 μl with buffer. After the enzyme reaction is terminated, the precipitate in the reaction solution is removed by filtration with a 0.22 mu m filter membrane, and the reaction solution is colored by a high performance liquid chromatographyThe spectrum (HPLC) detection shows that the purified Dmt06 can degrade dicamba, the new metabolite is generated during the reaction process, the retention time is 6.25 min, which is consistent with the retention time of the 3,6-DCSA standard, the peak position of the 3,6-DCSA standard is the same, and the mass spectrum detection shows that the product is at M/z 204.95 (M-H) ^- There is a significant molecular ion peak at m/z 106.95 and a fragment peak with characteristics consistent with 3,6-DCSA. Thus, the product was identified as 3,6-DCSA. The above results indicate that Dmt06 is a demethylase that catalyzes the conversion of dicamba to 3,6-DCSA. Under optimal conditions, 0.1 mg of Dmt06 was incubated for 5min to determine that the specific activity of Dmt06 on dicamba was 165nmol/min/mg, which was significantly higher than that of the reported dicamba demethylase Dmt (114 nmol/min/mg, yao, l., yu, l., zhang, j, xie, x, t, tao, q, yan, x, hong, q, qiu, j, g, he, j, ding, d.r. A tetrahydrofolate-dependent methyltransferase catalyzing the demethylation of dicamba in)Sphingomonas sp. strain Ndbn-20. Appl. Environ. Microbiol. 2016, 82, 5621-5630.) and Dmt50 (146 nmol/min/mg, chen, l., yao, s.g., chen, t., tao, q., xie, x.t., xiao, x, ding, d.r., he, q., he, j. Coexpression of methyltransferase gene)dmt50 and methylene tetrahydrofolate reductase gene increases Arabidopsis thalianadicamba resistance. J. Agric. Food. Chem. 2019, 67, 1443-1452.）。

Example 3

Dmt06 enzymatic Property study

3.1 Effect of pH on Dmt06 Activity and stability

The pH range of Dmt06 was studied in three different buffer systems: 20 mM HAc-NaAc buffer (pH 3.6-5.8), 50mM PBS buffer (pH 5.5-8.5) and 20 mM glycine-NaOH buffer (pH 8.6-10.6). The conversion rate of dicamba is detected by HPLC by adding a proper amount of Dmt06 pure enzyme into buffer systems with different pH values respectively, the enzyme activity under the condition of 50mM PBS pH 7.4 is taken as 100%, the relative enzyme activity is calculated, and the detection result shows that Dmt06 detects the demethylating activity of dicamba within the range of 10-50 ℃, and the optimal pH value is 7.4 (figure 7).

3.2 Effect of temperature on Dmt06 Activity and stability

The temperature range of Dmt06 was examined at 50mM PBS buffer (pH 7.4) at different temperatures (4 ℃, 10 ℃,20 ℃, 25 ℃,30 ℃, 35 ℃, 40 ℃,50 ℃,60 ℃ and 70 ℃), the reaction was sampled at regular intervals to measure the enzyme activity, and the relative enzyme activities at other temperatures were calculated with the enzyme activity at 30 ℃ being 100%. For the thermal stability study, dmt06 was pre-incubated in water baths at different temperatures (30 ℃ -70 ℃) for 120 min, and then the residual activity was determined. The results of the detection are shown in FIG. 8, and the activity of Dmt06 was detected in the temperature range of 10-50 ℃. The optimal reaction temperature for Dmt06 is 35 ℃. In the heat stability study, dmt06 retained more than 70% of the activity after 120 min incubation at 50 ℃ and less than 20% of the activity after 120 min incubation at 60 ℃. The results show that Dmt06 is stable at 50 ℃, but becomes unstable when the temperature is increased to 60 ℃.

3.3 Effect of Metal ions and chemical Agents on Dmt06 Activity

In the Dmt06 reaction system under the optimum reaction conditions, various metal ions (Li ⁺ , Na ⁺ , Mg ²⁺ , Hg ²⁺ , Mn ²⁺ , Ni ²⁺ , Co ²⁺ , Ca ²⁺ , Zn ²⁺ , Cr ²⁺ , Ba ²⁺ , Al ³⁺ , Cd ²⁺ And Ag ⁺ ) The relative enzyme activities of each test group were calculated by defining the enzyme activities of 5.0mM EDTA, SDS without any addition of metal ions and other chemical reagents as 100%. The results of the experiment are shown in FIG. 9, in which Dmt06 activity was subjected to 1.0 mM Hg ²⁺ 、Co ²⁺ 、Zn ²⁺ 、Cd ^{2 +} 、Ag ⁺ And 5.0mM SDS severely inhibited, 1.0 mM Mn ²⁺ 、Ni ²⁺ 、Cu ²⁺ 、Ba ²⁺ And Al ³⁺ Moderately inhibited, 1.0 mM Li ⁺ 、Na ⁺ 、K ⁺ 、Mg ²⁺ 、Ca ²⁺ 、Fe ²⁺ 、Fe ³⁺ And 5.0mM EDTA had no significant effect on the activity of dicamba demethylase Dmt 06.

3.4 Substrate profile of Dmt06

In the pure enzyme reaction system of dicamba demethylase, 0.5 to mM of other methyl aromatic compounds and herbicide are respectively added: vanillic acid, syringic acid, isoproturon and alachlor were reacted for 30 min and the added substrate was checked for degradation by HPLC. Through an enzymatic degradation experiment, detection shows that the Dmt06 can not catalyze the methyl transfer of vanillic acid, syringic acid, isoproturon and alachlor, and the Dmt06 has a very narrow substrate spectrum.

While the invention has been described in connection with certain embodiments, it is not intended that the invention be limited thereto; for those skilled in the art to which the present invention pertains and the related art, on the premise of based on the technical scheme of the present invention, the expansion, the operation method and the data replacement should all fall within the protection scope of the present invention.

Claims (9)

1. THF-dependent dicamba demethylase genedmt06The nucleotide sequence of the polypeptide is SEQ ID NO.1.

2. A THF-dependent dicamba demethylase gene of claim 1dmt06The dicamba demethylase Dmt06 coded by the nucleotide sequence is characterized in that the amino acid sequence is SEQ ID NO.2.

3. A recombinant expression vector comprising the THF-dependent dicamba demethylase gene according to claim 1dmt06。

4. A highly efficient recombinant expression vector according to claim 3, characterized by the THF dependent dicamba demethylase genedmt06Inserted into pET-29a (+)NdeI andHindand III sites.

5. A genetically engineered bacterium comprising the THF-dependent dicamba demethylase gene of claim 1dmt06。

6. The genetically engineered bacterium of claim 5, wherein the genetically engineered bacterium has an expression strain of escherichia coli BL21 (DE 3).

7. A THF dicamba demethylase gene according to claim 1dmt06Is characterized in that the application scene comprises: the application in constructing dicamba-resistant transgenic crops and in degrading or removing dicamba residues in the environment.

8. Use of dicamba demethylase Dmt06 according to claim 2, characterized in that its application scenario comprises: the application of the herbicide dicamba in degradation and the application of the herbicide dicamba in degradation or removal of residual dicamba in the environment.

9. The genetically engineered bacterium of claim 5, wherein the application comprises: application in degrading or removing dicamba residue in the environment.

Images