CN116284366A - Quick detection antibody and kit for dermatophytosis and preparation method thereof - Google Patents

Quick detection antibody and kit for dermatophytosis and preparation method thereof Download PDF

Info

Publication number
CN116284366A
CN116284366A CN202310593792.7A CN202310593792A CN116284366A CN 116284366 A CN116284366 A CN 116284366A CN 202310593792 A CN202310593792 A CN 202310593792A CN 116284366 A CN116284366 A CN 116284366A
Authority
CN
China
Prior art keywords
antibody
alpha
dermatophytosis
dermatophyte
detection kit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310593792.7A
Other languages
Chinese (zh)
Inventor
张树文
刘光明
朱嘉盛
余萍
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Liming Biological Products Co ltd
Original Assignee
Nanjing Liming Biological Products Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Liming Biological Products Co ltd filed Critical Nanjing Liming Biological Products Co ltd
Priority to CN202310593792.7A priority Critical patent/CN116284366A/en
Publication of CN116284366A publication Critical patent/CN116284366A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/14—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from fungi, algea or lichens
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56961—Plant cells or fungi
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/37—Assays involving biological materials from specific organisms or of a specific nature from fungi
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2469/00—Immunoassays for the detection of microorganisms
    • G01N2469/10—Detection of antigens from microorganism in sample from host
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a rapid detection antibody for dermatophytosis, a kit and a preparation method thereof, wherein the antibody is an anti-dermatophytosis alpha-1, 6 mannosan antibody, the light chain sequence of the antibody is SEQ ID NO.1, and the heavy chain sequence of the antibody is SEQ ID NO.2. The kit comprises the anti-dermatophyte alpha-1, 6 mannan antibody. The preparation method is that alpha-1, 6 mannans are extracted from dermatophytes as antigens to inject and immunize mice, spleen cells of the immunized mice are fused with SP2/0 cells, mRNA is separated from hybridoma cells, the mRNA is reversely transcribed into cDNA, heavy chain genes and light chain genes of antibodies are respectively amplified, and the anti-dermatophytes alpha-1, 6 mannans antibodies are obtained, and based on the obtained antibodies, the kit is prepared. The kit has good stability, sensitivity, specificity, accuracy and inclusion, is simple and quick, and has wide strain detection range.

Description

Quick detection antibody and kit for dermatophytosis and preparation method thereof
Technical Field
The invention relates to the field of microorganisms, in particular to a rapid detection antibody for dermatophytosis, a kit and a preparation method thereof.
Background
DermatophytesDermatophytes) Is the main causative agent of dermatomycosis, a group of filamentous parasitic fungi that invade mainly the skin, hair and nails of humans or animals, and parasitize or decay keratin tissues of epidermis horns, hair and nail plates, causing tinea capitis, tinea corporis, tinea cruris, tinea manus, tinea pedis and onychomycosis.
Dermatophytes belong to the family of the Phanerochaetes of the order Phanerochaete of the class Cellularomyces of the Deuteromycotina. The dermatophytes can be divided into 3 genera according to the characteristics of megasporophytes, and the trichophyton genera are [ (], trichophyton)Trichophyton) Genus MicrosporumMicrosporum) Genus EpidermophytonEpidermophyton). There are about 45 dermatophytes reported so far, some of which infect animals only, and about 20 or more of which have pathogenic effects on humans. Epidemiological investigation results show that the most common dermatophytes at present are trichophytes rubrum @Trichophyton rubrum). Trichophyton rubrum is a parent dermatophyte, and can cause tinea corporis, tinea cruris, tinea manus, tinea pedis, onychomycosis and tinea pus, and can also cause deep infection and cause dermatophyte granuloma. Microsporidia canis is a more common pathogenic fungus, which is often the causative fungus of tinea capitis, tinea corporis, and a few onychomycosis, as well as other rare mycoses. Microsporidia canis as a parent fungus can exist on animals for a long period of time without causing diseases (especially on cats and dogs), and once infected with humans, microsporidia canis causes damage to skin or hair, endangering human health.
At present, dermatophytes are mainly identified by a morphological method, but detection time is long, result judgment is easily affected by various external factors, and thus, atypical bacteria are easily identified inaccurately.
A Chinese patent invention with the name of test paper strip, kit and preparation method of test paper strip (publication number CN 112014565A) for detecting trichophyton rubrum is aimed at detecting trichophyton rubrum, but cannot detect dermatophytosis caused by dermatophytes of other species.
Disclosure of Invention
In order to improve the accuracy and adaptability of dermatophyte detection, the application provides a dermatophyte disease rapid detection antibody, a kit and a preparation method thereof.
In a first aspect, the application provides a dermatomycosis rapid detection antibody, which adopts the following technical scheme:
a rapid detection antibody for dermatophytosis is an anti-dermatophytosis alpha-1, 6 mannosan antibody, the light chain sequence of which is SEQ ID NO.1, and the heavy chain sequence of which is SEQ ID NO.2.
Wherein, the liquid crystal display device comprises a liquid crystal display device,
SEQ ID NO.1：DNA sequence (393bp)
GGCAAGGCTCCCCGTAAGCAGCTCGCCTCCAAGGCTGCCCGCAAGTCCGCGCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCTGGTACCGTCGCTCTGCGTGAGATCCGTCGCTACCAGAAGAGCACTGAGCTGCTGCCTTCCAGCGTCTGGTATGTCGCCGCCCCCGTCTTCTGAATGCCCGTGAGATCGCCCAGGACTTCAAGTCCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCCCGTCTCCCTCTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCGGTACGTAACATATCTGCTTGACCCCACCCGCGACGCGTCTTGTGGCATACGCTAACAACCTCACAGAAGGACATCGTC
SEQ ID NO.2：DNA sequence (412bp)
AGGTGCTGCTTTCTGGTGCGTCCACCACCGCGACGCTCGACGCGCGACAACATGACCTCGAGCCATCGTTACTGACCTCGACTCTCAGGCAAACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGCACCTCCTATTTCCTGCCTCCTGCCGGCTTGGCACTGACAATCACACAGTTACAACGCCAGCTCGAGCGCATGAACGTCTACAGGTAAGTCAACAGCCACGTCATTGACCATCTGCAGCACGGTTTGCTGCCGTCGCTGGGGCCTTGCTAACGCGTTAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGAAACAACTGGGCCAAGGGTCAT
in a second aspect, the application provides a rapid dermatophytosis detection kit, which adopts the following technical scheme:
a rapid detection kit for dermatophytosis comprises the anti-dermatophytosis alpha-1, 6 mannan antibody.
The main components of the fungal cell wall include chitin, dextran, cellulose, mannan, etc. The fungus has thicker cell wall, tough structure and higher wall breaking difficulty, so that the search of a simple, convenient and rapid diagnosis method with high sensitivity and specificity becomes a key for improving the diagnosis rate of pathogenic fungi. Mannans are highly branched polymers, mostly in the cell wall with alpha-1, 6-mannose as backbone chains. Mannans are secreted on the skin of the host and are substances that reduce the immune response and have the functions of adsorbing pathogenic bacteria and regulating immunity. Galactomannans are polysaccharides that contain a mannose backbone with galactoside groups. Pathogenic fungi are mainly classified into candida, aspergillus and trichophyton. Galactomannans (GM) are antigens specific to the cell wall of aspergillus fungi, mannans (MA) are antigens specific to candida, and dermatophytes such as trichophyton rubrum can also produce mannans and are present in higher levels in the cell wall. Galactomannans have a high specificity for mannans and low cross-immunity to other antigens. The mannans structures of both candida and dermatophytes are greatly different, so alpha-1, 6 mannans can be used as detection targets of dermatophytes.
Preferably, the dermatophytes include trichophytes, microsporophytes or epidermophytes.
Preferably, the trichophyton genus comprises trichophyton mentagrophytes, trichophyton rubrum, trichophyton equine or trichophyton purple; microsporobacteria include microsporobacteria, microsporum ferrugineum, microsporum gypseum, or Microsporum canis; the genus Epidermophyton includes Epidermophyton floccosum.
Preferably, the anti-dermatophyte alpha-1, 6 mannan antibody is expressed in a prokaryotic system or a mammalian system.
Preferably, the anti-dermatophyte alpha-1, 6 mannans antibody is linked to a phagemid vector to construct an antibody library.
The preparation method of the rapid detection kit for dermatophytosis is characterized by extracting alpha-1, 6 mannans from dermatophytes as antigens to perform injection immunization on mice, taking spleen cells of immunized mice to fuse with SP2/0 cells, separating mRNA from hybridoma cells, performing reverse transcription to cDNA, and amplifying heavy chain and light chain genes of antibodies to obtain anti-dermatophytes alpha-1, 6 mannans antibodies; based on the anti-dermatophyte alpha-1, 6 manna antibody, a rapid detection kit for dermatophyte diseases is prepared.
In a third aspect, the present application provides a method for preparing a rapid dermatophytosis detection kit, which adopts the following technical scheme:
a preparation method of a rapid detection kit for dermatophytosis comprises the steps of extracting alpha-1, 6 mannans from dermatophytes as antigens to perform injection immunization on mice, fusing immune mouse spleen cells with SP2/0 cells, separating mRNA from hybridoma cells, performing reverse transcription to cDNA, and amplifying heavy chain and light chain genes of antibodies to obtain anti-dermatophytes alpha-1, 6 mannans antibodies; based on the anti-dermatophyte alpha-1, 6 manna antibody, a rapid detection kit for dermatophyte diseases is prepared.
Preferably, the mice are Balb/c mice.
Preferably, the rapid detection kit for dermatophytosis is prepared by adopting an immunochromatography method, a chemiluminescent immunoassay method or an enzyme linked immunoassay method based on an anti-dermatophytosis alpha-1, 6 mannans antibody.
Preferably, when immunochromatography is employed, the antibody is coupled to latex, fluorescent particles or quantum dots.
In summary, the present application has the following beneficial effects:
1. according to the application, firstly, the alpha-1, 6 mannans are used as antigens to perform injection immunization on mice to obtain the anti-dermatophyte alpha-1, 6 mannans antibodies, and the anti-dermatophyte alpha-1, 6 mannans antibodies are used as the basis to develop a detection kit (comprising a basic layer to a trimethyl detection mechanism) for dermatophyte diseases, so that the prepared kit has good stability, sensitivity, specificity, accuracy and inclusion, can meet the requirements of clinical detection, and is simple and rapid.
2. The application adopts the alpha-1, 6 mannans as antigens to prepare the antibodies, can detect other species of trichophyton, microsporona and epidermophyton fungi besides trichophyton rubrum, and has wider coverage range.
Description of the embodiments
Examples
The rapid detection kit for dermatophytosis of the embodiment is prepared by the following method:
(1) Preparation of anti-dermatophyte alpha-1, 6 mannan antibody:
a) Microsporidia canis (purchased from the collection of microorganism strains, cantonese province, accession number: the isolated alpha-1, 6-mannans from ATCC 10214) were diluted to a final concentration of 2-fold with physiological saline (formulated in an amount of 50. Mu.L per needle) 1-5. Mu.g per needle; taking out the required dosage (50 mu L per needle) under aseptic condition, mixing with Freund's adjuvant (incomplete Freund's adjuvant, polynucleotide, alum, etc.) at a volume ratio of 1:1, and injecting Balb/c mice (purchased from Beijing Anbiqi biotechnology Co., ltd.) into the muscle of the lower leg of the rear leg, wherein each mouse is injected with 100 mu L; immunization of 1 needle was boosted in the same manner on day 14; micro tail blood is collected on the 21 st day for ELISA measurement;
b) Immunized Balb/c mice were taken, eugenolysis was sacrificed, immersed in 75% ethanol for 5min, and clamped with forceps in 75% ethanol with occasional agitation to thoroughly disinfect. 3-5 mL of incomplete culture medium is taken and placed into a homogenizer, the abdominal cavity of the rat is dissected by scissors and forceps, the spleen at the left side of the rat is taken out, the surface fat is sheared off, and the rat is placed into the homogenizer for light grinding. The ground liquid was filtered through a cell screen to remove the cake. The liquid filtered by the cell screen is sucked into a clean sterile centrifuge tube, incomplete culture medium is added, and the supernatant is centrifuged for standby.
SP2/0 cells and immunized mouse spleen cells were resuspended in incomplete medium and the bottom of the centrifuge tube was immersed in warm water at 37 ℃. The incubated 1mL of the fusion agent PEG1450, 60s was taken out and added dropwise to the cell mixture pellet, and after gently mixing the pellet upside down, the supernatant was centrifuged off. The cell pellet was resuspended in 200mL of complete medium solution containing feeder cells and HAT. And (5) fusing to form hybridoma cells, performing expansion culture and freezing.
c) mRNA was isolated from the hybridoma, reverse transcribed into cDNA, and the heavy and light chain genes of the antibody were amplified by RT-PCR, respectively, and the antibody genes were then ligated into phagemid vectors (purchased from Beijing Anbiqi Biotech Co., ltd.) to construct scFv antibody libraries. Using a biopanning step, scFv antibody fragments with high affinity and specificity can be obtained.
After the antibody genes have been sequenced, scFv antibodies may be expressed in prokaryotic systems (e.g., e.coli) or in mammalian systems (i.e., HEK293 cells) by transfection.
(2) Sample treatment fluid preparation: the treatment solution contained 9 mg/mL NaCl, 5mg/mL EDTA and 1. Mu.L/mL Triton X-100.Triton X-100 is a nonionic surfactant, and uses Triton X-100 to destroy lipid bilayer, dissolve cytoplasm and cell membrane, make antigen of sample combine more easily, and improve sensitivity of kit.
(3) The production method of the kit comprises the following steps:
a) The anti-dermatophyte alpha-1, 6 mannan antibody is coupled with red latex: mixing 450 mu L of 0.1M borax solution and 50 mu L of latex particles uniformly, centrifuging at 4 ℃/13000 rpm in a refrigerated centrifuge for 13 minutes, removing supernatant, adding 500 mu L of 0.1M borax solution again, treating for 3 times by using a ultrasonic material dispersing machine, centrifuging to remove supernatant, adding 500 mu L of 0.1M borax solution, performing ultrasonic treatment for 3 times, adding 0.15 mg-0.25 mg of anti-dermatophyte alpha-1, 6 mannan antibody and 15 mu L of 10 mg/mL EDC solution, and uniformly mixing overnight. Adding 15 mu L of 10mM ethanolamine solution, mixing for 30 minutes, centrifuging to remove supernatant, adding 500 mu LTris-casein solution, mixing for 4 hours, centrifuging to remove supernatant, adding 500 mu LTris-casein solution, and performing ultrasonic treatment for 3 times to obtain the dermatophyte alpha-1, 6 mannosan antibody and emulsion coupling solution. DNP-BSA was coupled with blue latex, procedure was followed.
b) Preparation of sample release pad: tris buffer (5 mg/mLcasein,5 mg/mLPVP, 5. Mu.L/mLS-6 Bioterge AS-40, 2. Mu.L/mL 10% NaN was used 3 ) The glass fiber mat was soaked on a shaker for 8 hours, and dried at 37℃for 8 hours to obtain a sample release mat (drop sample).
c) Preparation of latex binding pads: MOPSO buffer (5 mg/mLcasein, 2. Mu.L/mLTween 20, 2. Mu.L/mL 10% NaN was used 3 ) The polyester film was soaked for 1 hour and dried at 37℃for 8 hours to obtain a latex bonding pad.
d) The red latex particle suspension labeled with anti-dermatophyte monoclonal antibody and the blue latex particle suspension labeled with DNP-BSA were purified by using Tris-HCl buffer (5 mg/mLcasein,5 mg/mLPVP, 2. Mu.L/mL 10% NaN) 3 And (3) diluting sucrose and trehalose to a concentration of 0.3% -0.5%, coating the diluted sucrose and trehalose on a polyester film (a latex bonding pad) by a spot spraying machine, drying the diluted sucrose and trehalose at 37 ℃ for 8 hours, sealing the diluted sucrose and trehalose, and placing the diluted sucrose and trehalose at room temperature for standby.
e) With 10mM PBS (2. Mu.L/mL 10% NaN) 3 50 mM EDTA) diluting the anti-dermatophyte monoclonal antibody and the anti-DNP monoclonal antibody to 0.3-0.5 mg/mL and 1mg/mL respectively, and spotting on the nitrate with a spot-coating machineAnd (3) drying the cellulose acetate film at 37 ℃ for 8 hours on a test area and a control area of the cellulose acetate film, wherein the spraying amount is 8 mu L/cm, and sealing the cellulose acetate film and placing the cellulose acetate film at room temperature for standby.
f) Assembling a large card: and (3) bonding and compounding the semi-finished product on the PS plastic sheet. And (3) placing the semi-finished plastic sheet on a splitting machine, and splitting into single test paper.
g) The single test paper is put into a plastic box which is matched with the plastic box, the plastic box and the drying agent are put into a packaging bag, the packaging bag is sealed, and the sealed packaging bag and the sample treatment fluid are packaged into a finished product.
The components involved in the above examples function as follows:
EDC can activate carboxyl on the surface of the latex microsphere and react with amino on the antibody quickly to form an amide bond, so that the antibody is coated on the surface of the latex microsphere.
The ethanolamine may react with carboxyl groups on the latex microspheres to which the antibody is not bound.
S-6 Bioterge AS-40 is a mild anionic surfactant, and has solvent compatibility, and serves AS a wetting agent and a solubilizing agent.
Triton X-100 and Tween 20 are nonionic surfactants, have the function of renaturation antigen, do not damage the structure of protein, can reduce the damage to the original interaction between proteins, and can improve the specific recognition capability. Can dissolve lipid to increase the permeability of antibody to cell membrane. The sensitivity is improved well. The water cannot spread on the surface of low-energy solid (NC film, glass fiber and polyester film), in order to improve the wetting property of the system, a surfactant is usually added into the water, and Tween 20 is added onto the polyester film to reduce the surface tension of the water, so that the water can wet the surface of the polyester film, and the liquid can be uniformly spread on the surface.
Casein (Casein) can specifically adsorb hetero protein (non-specific protein), reduce non-specific binding of hetero protein, and eliminate false positive or false negative.
PVP has solubilization, and can increase the water solubility of certain substances which are basically insoluble in water and active; has dispersing effect, and can make the color substances, suspension and emulsion in solution disperse uniformly and keep stable. In addition to its use as a solubilizing agent and a dispersing agent, PVP with low molecular weight is generally considered to have a specific electron donor structure, and proteins can form hydrogen bonds with N atoms and O atoms of PVP to perform a complex action, so that the proteins are stably dispersed in a fluid. It is a viscosity modifier insensitive to pH changes and addition of dielectrics, and is also a binder for solid particles, promoting fusion and action of latex particles with the sample liquid. During the detection process, the combination of the marker and the components in the dripped sample is facilitated, and the uniform release of the sample is also facilitated. In addition, the PVP and casein can be mixed for use to achieve a good sealing effect.
MOPSO acts as a zwitterionic buffer.
Sucrose and trehalose are used as protective agents, so that the aging speed can be slowed down, and meanwhile, the hydrophilicity can be increased.
Salt substances such as NaCl can reduce signal intensity and eliminate false positive.
Adding a little NaN 3 The preservative is favorable for preservation.
During testing, a swab sample or a dander, a nail dust and a hair sample of a tester are added into a sample treatment liquid, mixed and dripped into a sample adding hole of a detection card, the liquid sample flows into a sample release pad and then flows into a latex binding pad, and the liquid sample is mixed with a murine anti-dermatophyte alpha-1, 6 mannan monoclonal antibody marked by red latex particles, which is pre-coated in the latex binding pad. The mixture is then chromatographed under capillary effect to the other end.
In the case of a positive sample, the red latex-labeled antibody is first combined with dermatophyte antigen in the sample to form a red latex-antibody-antigen complex, and the complex is captured by another murine anti-dermatophyte alpha-1, 6 mannan monoclonal antibody immobilized in the test zone during the chromatographic process passing through the test zone, so as to form a red latex-antibody-antigen-antibody sandwich complex, and a red band appears in the corresponding test zone (T).
The anti-DNP monoclonal antibody is fixed in a quality control region (C) on the membrane, and the DNP-BSA marked by the blue latex particles analyzed in the capturing mixture forms a blue latex-BSA-DNP-DNP monoclonal antibody (fixed on the membrane) complex in the quality control region (C). Thus, a blue band appears in the quality control zone (C) regardless of whether dermatophyte antigen is present in the sample. The blue band appearing in the quality control region (C) is a standard for judging whether there is enough sample and whether the chromatographic process is normal or not, and is also used as an internal control standard of the reagent.
If a negative sample is obtained, the sandwich complex described above cannot be formed in the corresponding test zone (T) and no red bands will appear. The test subjects were shown to have no dermatophyte antigen in the sample or less than the limit of detection, at which time the test subjects may not be uncomfortable due to dermatophyte infection, considering eczema, neurodermatitis or other causes.
If a positive sample is obtained, the sandwich complex will be formed in the corresponding test zone (T) and a red band will appear. The test subjects contained dermatophyte antigens in the samples, suggesting a combination of other test results.
In a specific embodiment, when the antibody is coupled with a gold label (latex), fluorescent particles, even quantum dots, can be used to prepare an immunochromatography kit, and can also be prepared into an immunodetection kit of other methodologies, such as a chemiluminescent immunoassay kit, an enzyme-linked immunodetection kit and the like.
(4) Analytical performance test
a) Minimum detection limit test
(1) Minimum detection limit range screening: diluting the first batch of inactivated culture of Trichophyton rubrum, trichophyton mentagrophytes, microsporum canis and Epidermophyton floccosum with negative matrix to 2×10 4 ng/mL、2×10 3 ng/mL、2×10 2 ng/mL, 20 ng/mL, 2 ng/mL, 0.2 ng/mL. Each concentration gradient was repeatedly tested 3 times with 3 batches of reagent cards.
Figure SMS_1
(2) And (3) establishing a minimum detection limit: the inactivated culture of Trichophyton rubrum, trichophyton mentagrophytes, microsporum canis, and Epidermophyton floccosum is diluted with negative matrix to the lowest concentration positive in the detection result determined in the screening experiment, and then diluted by 2 times, 4 times, and 8 times of times. Each sample was tested in duplicate 20 times with a 95% detected concentration level at the lowest limit of detection.
Figure SMS_2
Figure SMS_3
Figure SMS_4
(3) Verification of the lowest detection limit: the inactivated culture of Trichophyton rubrum, trichophyton mentagrophytes, microsporum canis and Epidermophyton floccosum is diluted with a negative matrix to the minimum detection limit concentration determined in the established experiment. Each sample was tested repeatedly 20 times, and the positive rate should be not lower than 95%.
Figure SMS_5
Conclusion: the minimum detection limit was determined to be 1 ng/mL.
A, B in the above experiments represents different batches.
b) Cross reaction
Diluting the cross-over material with negative matrix to 10 respectively 6 CFU/mL bacterial suspension is used as an experimental group; another 500. Mu.L of negative matrix was used as control. 3 batches of kits were tested 1 time each.
Figure SMS_6
Conclusion: with the above materials at 1.0X10 6 CFU/mL or 1mg/mL concentration did not cross react.
c) Interference testing
Microsporidian canis and interfering substances are diluted into suspension with a negative matrix respectively. Ensuring that the microsporidian concentration of each sample is 5 ng/mL and the interfering substance concentration is 50 mg/mL, which is used as an experimental group; 1 part of 5 ng/mL microsporum canis suspension was prepared separately from the negative substrate as a control.
Figure SMS_7
Conclusion: the above substances have no interference with the detection result at 50 mg/mL.
d) Inclusion test
The trichophyton rubrum, trichophyton mentagrophytes, trichophyton equine, trichophyton purple, microsporona canis, microsporona ferruginea, microsporona gypsum and epidermophyton floccosum were each diluted to 2 ng/mL with a negative matrix and each batch was tested 20 times.
Figure SMS_8
Conclusion: the dermatophytes can be detected at the concentration of 2 ng/mL.
e) Stability test
And (3) placing the dermatophytosis diagnosis kit in a normal temperature (15-30 ℃) storage condition, taking out the kit at the time of day 0, month 3, month 6, month 9, month 12 and month 15 respectively, and detecting quality control products.
Figure SMS_9
Conclusion: the kit can be stably stored for 15 months under the normal temperature condition (15-30 ℃).
f) Clinical trial
Antigen detection and fungal microscopic examination/PCR detection comparison table
Figure SMS_10
Positive compliance = 261/271 x 100% = 96.31% (95% ci: 93.32%)
Negative compliance = 71/75 x 100% = 94.67% (95% ci: 86.90%. About.98.53%)
Total compliance = 332/346 x 100% = 95.95% (95% ci: 93.30% to 97.77%)
Kappa value is 0.8842 (95% CI: 0.8249-0.9434) >0.75, which proves that dawn antigen detection result is highly consistent with fungal microscopic/PCR result.

Claims (10)

1. A rapid detection antibody for dermatophytosis is an anti-dermatophytosis alpha-1, 6 mannosan antibody, the light chain sequence of which is SEQ ID NO.1, and the heavy chain sequence of which is SEQ ID NO.2.
2. A rapid detection kit for dermatophytosis, comprising the anti-dermatophytosis alpha-1, 6 mannan antibody according to claim 1.
3. The rapid detection kit for dermatophytosis according to claim 2, wherein the dermatophytes comprise trichophytosis, microsporobacteria or epidermophytosis.
4. The rapid detection kit for dermatomycosis according to claim 3, wherein the trichophyton genus comprises trichophyton mentagrophytes, trichophyton rubrum, trichophyton equine or trichophyton purple; microsporobacteria include microsporobacteria, microsporum ferrugineum, microsporum gypseum, or Microsporum canis; the genus Epidermophyton includes Epidermophyton floccosum.
5. The rapid dermatophyte disease detection kit according to claim 2, wherein the anti-dermatophyte alpha-1, 6 mannan antibody is expressed in a prokaryotic system or a mammalian system.
6. The rapid dermatophyte disease detection kit according to claim 2, wherein the anti-dermatophyte alpha-1, 6 mannosan antibody is linked to a phagemid vector to construct an antibody library.
7. The method for preparing the rapid detection kit for dermatophytosis according to any one of claims 2 to 6, wherein the method is characterized in that alpha-1, 6 mannans are extracted from dermatophytes as antigens to perform injection immunization on mice, spleen cells of the immunized mice are fused with SP2/0 cells, mRNA is separated from hybridoma cells, reverse transcription is performed to cDNA, and heavy chain and light chain genes of antibodies are amplified respectively to obtain the anti-dermatophyte alpha-1, 6 mannans antibodies; based on the anti-dermatophyte alpha-1, 6 manna antibody, a rapid detection kit for dermatophyte diseases is prepared.
8. The method for preparing a rapid dermatomycosis detection kit according to claim 7, wherein the mice are Balb/c mice.
9. The method for preparing the rapid detection kit for dermatophytosis according to claim 7, wherein the rapid detection kit for dermatophytosis is prepared by adopting an immunochromatography method, a chemiluminescent immunoassay method or an enzyme linked immunoassay method based on an anti-dermatophytosis alpha-1, 6 mannosan antibody.
10. The method for preparing a rapid dermatomycosis detection kit according to claim 9, wherein the antibody is coupled with latex, fluorescent particles or quantum dots when immunochromatography is adopted.
CN202310593792.7A 2023-05-25 2023-05-25 Quick detection antibody and kit for dermatophytosis and preparation method thereof Pending CN116284366A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310593792.7A CN116284366A (en) 2023-05-25 2023-05-25 Quick detection antibody and kit for dermatophytosis and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310593792.7A CN116284366A (en) 2023-05-25 2023-05-25 Quick detection antibody and kit for dermatophytosis and preparation method thereof

Publications (1)

Publication Number Publication Date
CN116284366A true CN116284366A (en) 2023-06-23

Family

ID=86822579

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310593792.7A Pending CN116284366A (en) 2023-05-25 2023-05-25 Quick detection antibody and kit for dermatophytosis and preparation method thereof

Country Status (1)

Country Link
CN (1) CN116284366A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106279349A (en) * 2016-08-31 2017-01-04 广东工业大学 For preparing extracting method and the preparation method of yolk antibody thereof of the dermatophytosis suppressor proteins antigen of yolk antibody
CN106397586A (en) * 2016-08-31 2017-02-15 广东工业大学 Anti-dermatophyte specific yolk antibody, preparation method and application thereof
CN108690881A (en) * 2017-03-30 2018-10-23 欧蒙医学诊断技术有限公司 Measuring method for diagnosing dermatophytosis
CN112014565A (en) * 2020-10-31 2020-12-01 南京黎明生物制品有限公司 Test strip and kit for detecting trichophyton rubrum and preparation method of test strip
CN113820484A (en) * 2021-08-27 2021-12-21 中国医学科学院皮肤病医院(中国医学科学院皮肤病研究所) Preparation method of household test strip for rapidly detecting dermatophytes

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106279349A (en) * 2016-08-31 2017-01-04 广东工业大学 For preparing extracting method and the preparation method of yolk antibody thereof of the dermatophytosis suppressor proteins antigen of yolk antibody
CN106397586A (en) * 2016-08-31 2017-02-15 广东工业大学 Anti-dermatophyte specific yolk antibody, preparation method and application thereof
CN108690881A (en) * 2017-03-30 2018-10-23 欧蒙医学诊断技术有限公司 Measuring method for diagnosing dermatophytosis
CN112014565A (en) * 2020-10-31 2020-12-01 南京黎明生物制品有限公司 Test strip and kit for detecting trichophyton rubrum and preparation method of test strip
CN113820484A (en) * 2021-08-27 2021-12-21 中国医学科学院皮肤病医院(中国医学科学院皮肤病研究所) Preparation method of household test strip for rapidly detecting dermatophytes

Similar Documents

Publication Publication Date Title
CN1954214B (en) Lateral flow format, materials and methods
JP4942753B2 (en) How to isolate an analyte from a sample
JP3143477B2 (en) Method based on the use of bacteriophage for the detection of biological molecules in biological samples
US9709563B2 (en) Passivation of surfaces after ligand coupling
CN110658339B (en) Test paper and kit for detecting African swine fever virus and preparation method thereof
JPH10505418A (en) Detection of molecules related to air permeable particles
WO2019000267A1 (en) Gm hybridoma, monoclonal antibody, kit, preparation method therefor and application thereof
JPWO2015093545A1 (en) Method for detecting coliforms in milk
Estrada-Garcia et al. Monoclonal antibodies to the adhesive cell coat secreted by Pythium aphanidermatum zoospores recognise 200× 103 M r glycoproteins stored within large peripheral vesicles
KR101317417B1 (en) Antigen for detecting of classical swine fever virus, antibody detecting method and test kit using thereof
CN116284366A (en) Quick detection antibody and kit for dermatophytosis and preparation method thereof
JP4486497B2 (en) Method for identifying individual active ingredients in complex mixtures
CN111551746A (en) African swine fever virus N protein IgY antibody detection colloidal gold test paper and method
CN113391074A (en) Up-converting luminescent particle detection card for cysticercosis cellulosae, preparation method and application thereof
Fan et al. Construction of a TRFIC strip for rapid and sensitive detection of Ralstonia solanacearum
CN113834938B (en) Aspergillus flavus early warning molecular reference substance, preparation method and application thereof
DE102020124279B4 (en) Method and kit for detecting toxins and pathogens
WO2000067027A1 (en) Augmented agglutination assay
JP2020180834A (en) Tomato yellow leaf curl virus (tylcv) immunology diagnosis method
US20240027449A1 (en) Diagnostic method and system with improved sensitivity
TW201943727A (en) An application method for applying different labeled single-domain binding proteins combinations to micro-immunoassay and detection method for IgE
BE1027715B1 (en) RAPID IMMUNODIAGNOSTIC METHOD AND TEST FOR COVID-19 INFECTION
CN112646007B (en) Combined protein for detecting mycobacterium tuberculosis and detection reagent
CN113831396B (en) Molecule for indicating toxicity of aflatoxin-producing bacteria and application thereof
US20230221307A1 (en) Conjugated composed of membrane-targeting peptides for extracellular vesicles isolation, analysis and their integration thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20230623

RJ01 Rejection of invention patent application after publication