CN116239574A - STING small molecule agonist, preparation method and application thereof - Google Patents

STING small molecule agonist, preparation method and application thereof Download PDF

Info

Publication number
CN116239574A
CN116239574A CN202211524229.6A CN202211524229A CN116239574A CN 116239574 A CN116239574 A CN 116239574A CN 202211524229 A CN202211524229 A CN 202211524229A CN 116239574 A CN116239574 A CN 116239574A
Authority
CN
China
Prior art keywords
compound
formula
alkyl
ring
cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211524229.6A
Other languages
Chinese (zh)
Inventor
郑明月
侯辉
蒋华良
张素林
杨瑞瑞
单彬
李睿
张柯柯
施健妹
李叙潼
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Institute of Materia Medica of CAS
Original Assignee
Shanghai Institute of Materia Medica of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Institute of Materia Medica of CAS filed Critical Shanghai Institute of Materia Medica of CAS
Publication of CN116239574A publication Critical patent/CN116239574A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/04—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/433—Thidiazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965—Non-condensed pyrazines
    • A61K31/497—Non-condensed pyrazines containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50—Pyridazines; Hydrogenated pyridazines
    • A61K31/501—Pyridazines; Hydrogenated pyridazines not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/02—Nasal agents, e.g. decongestants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/14—Drugs for dermatological disorders for baldness or alopecia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/06—Antigout agents, e.g. antihyperuricemic or uricosuric agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10—Antimycotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D237/00—Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings
    • C07D237/02—Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings
    • C07D237/06—Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members
    • C07D237/10—Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D237/24—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/04—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D407/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00
    • C07D407/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00 containing two hetero rings
    • C07D407/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurology (AREA)
  • Diabetes (AREA)
  • Neurosurgery (AREA)
  • Pulmonology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Dermatology (AREA)
  • Oncology (AREA)
  • Epidemiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Rheumatology (AREA)
  • Hematology (AREA)
  • Cardiology (AREA)
  • Communicable Diseases (AREA)
  • Endocrinology (AREA)
  • Pain & Pain Management (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Psychology (AREA)
  • Psychiatry (AREA)
  • Urology & Nephrology (AREA)
  • Emergency Medicine (AREA)
  • Vascular Medicine (AREA)
  • Obesity (AREA)

Abstract

The invention provides a STING small molecule agonist, a preparation method and application thereof. Specifically, the invention provides a compound shown in a formula I, which has STING agonistic activity, and can obviously up-regulate the expression level of IFN-beta, CXCL10 and IL-6mRNA in THP-1 cells and RAW264.7 cells, thereby achieving the purpose of treating malignant tumor and infectious diseases.

Description

STING small molecule agonist, preparation method and application thereof
PRIORITY INFORMATION
The present invention requests priority from chinese patent application filed at 12 months 7 of 2021 to the chinese national intellectual property office under application number 2021114831123 entitled "STING small molecule agonist, method of preparation and use thereof", and is incorporated herein by reference in its entirety.
Technical Field
The invention relates to the technical field of medicines, in particular to a STING small molecule agonist, a preparation method and application thereof.
Background
Pattern recognition receptors (pattern recognition receptors, PRRs) can detect pathogen-associated molecular patterns (pathway-associated molecular patterns, PAMPs) and lesion-associated molecular patterns (damage-associated molecular patterns, DAMPs) and initiate downstream responses to pro-inflammatory cytokines and type I IFNs, thus constituting a first line of defense of the host immune system. When pathogens invade the body, viral envelope proteins, viral DNA or RNA, complexes on bacterial surfaces (e.g., lipopolysaccharide, wool proteins), etc. are recognized as conserved PAMPs by PRRs of host cells and stimulate immune cell activation and immune factor production through a variety of signaling pathways, mediating anti-infective innate immune responses. Intracellular nucleic acids are also known as PAMPs and are recognized by PRRs of host cells.
Interferon gene stimulators (stimulator of interferon genes, STING) are important adaptor proteins in DNA signaling pathways, playing an important role in recognition of cytoplasmic DNA and immune defenses. STING, under the catalysis of cyclic GMP-AMP synthetase cGAS, can directly sense bacterial and viral cyclic dinucleotide CDNs, including c-di-GMP, c-di-AMP, and c-di-GAMP, thereby activating the host immune response. In addition to immune responses to pathogens, STING signaling systems can monitor the release of dead or tumor cells to cytoplasmic double stranded DNA (dsDNA) by cGAS. After detection of cytoplasmic DNA by STING, cGAS synthesizes a second messenger cGAMP using 2',5' -phosphodiester linkage and 3', 5' -phosphodiester linkage, thereby activating STING pathway. In addition, leakage of cytosolic mitochondrial DNA (mtDNA) caused by instability of mitochondrial DNA can also cause activation of adjacent phagocytes STING. Binding of CDNs to the pocket of STING dimers promotes the dimerization of STING and transfer from the endoplasmic reticulum to perinuclear vesicles via the Golgiapatus (GA), and the release of recognition signals to the C-terminus of STING, promoting its polymerization. At the same time, TBK1 is recruited to the highly conserved C-terminus of STING, leading to TBK1 autophosphorylation and STING tail-end phosphorylation. Phosphorylated STING tails continue to recruit dry IRF3, which is subsequently phosphorylated by TBK 1. Phosphorylated IRF3 dimers eventually enter the nucleus, activating transcription of IFNs and pro-inflammatory cytokine genes.
In many cells such as fibroblasts, macrophages and DC cells, the process of inducing IFNs expression by various viruses or dsDNA-releasing species is entirely dependent on STING. Studies have shown that STING is essential in host resistance to retroviruses such as HIV, SIV and MLV. The antiviral mechanism of action of STING is due to IFNs, secretion of pro-inflammatory cytokines and chemokines, and immune responses to specific stimuli of the adaptive pathogens.
Cross-presentation of tumor antigens by antigen presenting cells to cd8+ T cells plays a critical role in antitumor activity. Activation of cd8+ T cells requires IFNs to be produced by DC cells, whereas ifnβ signaling requires participation of an innate immunosensor. Studies have shown that cGAS-STING signaling pathway is involved in the expression of ifnβ and is associated with tumor-derived DNA uptake. Activation of STING signaling pathway in tumor cells induces secretion of chemokines CCL5 and CXCL10, thereby promoting recruitment and activation of NK cells and T cells in tumor cells. The cGAS-STING pathway is involved in the cellular senescence process by inducing IFNs and senescence-associated anti-tumor mechanisms that secrete phenotypic factors. In addition, intratumoral injection of CDNs or CDNs analogs in a mouse model of colon, brain, skin, pancreatic, breast and B cell malignancy reduced tumor volume while increasing survival in the model mice. Thus, activating STING pathway has shown great potential for the prevention and treatment of infectious diseases or in the field of anti-tumor immunity.
The STING agonists reported at present are mainly CDN analogues such as ADU-S100 and MK-1454, but the compounds have complex structures and great chemical synthesis difficulty. In addition, because of the rapid clearance rate and poor membrane permeability, the therapeutic application is limited to intratumoral injection, and the clinical application is greatly limited. In recent years, developed small molecule agonists such as DMXAA and CMA are both murine specific STING agonists, and both lack effective binding to human STING due to species differences, and in 2018 diABZI was reported as a first class of non-nucleotide STING-effective agonists. In 2020, SR-717 and MSA-2 were reported sequentially, both of which induced STING to produce a closed conformation and produced STING-dependent antitumor effects.
STING agonists reported to date are all in the early clinical development line and the structural types of non-nucleotide compounds lack diversity. Therefore, there is a need to further develop novel small molecule STING agonists that are simple in structure and easy to synthesize.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide a novel small molecule STING agonist, a preparation method and application thereof.
According to one aspect of the present invention there is provided a compound, a pharmaceutically acceptable salt thereof, or an enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof, wherein the compound is selected from formula I and formula II:
Figure BDA0003972448150000021
Wherein:
w is selected from O or NH;
x is selected from O, S, -n=c (R 4 ) -or-C (R) 5 )＝C(R 6 )-；
R 1 Selected from-C (O) OR 7 、-C(O)NHR 8 Cyano, 3-8 membered heterocyclyl containing 1-3 heteroatoms selected from N, O, S, C6-C10 aryl, 3-10 membered heteroaryl containing 1-3 heteroatoms selected from N, O, S,
Figure BDA0003972448150000031
R 2 、R 3 、R 4 、R 5 And R is 6 Each independently selected from: H. d, halogen, hydroxy, amino, carboxy, C1-C6 alkyl, C3-C8 cycloalkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl, C6-C10 aryl; wherein the substituted substituent is selected from the group consisting of C1-C6 alkyl, C3-C8 cycloalkyl;
alternatively, R 2 And R is R 3 Together with the carbon atoms to which they are attached form a saturated or unsaturated 5-6 membered ring, in particular a benzene ring;
or R is 3 And R is R 4 Or R is 6 Together with the carbon atoms to which they are attached form a saturated or unsaturated 5-6 membered ring, in particular a benzene ring;
R 7 and R is 8 Each independently selected from: H. d, C1C 1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, C6-C10 aryl, 3-8 membered heterocyclyl containing 1-3 heteroatoms selected from N, O, S, 3-10 membered heteroaryl containing 1-3 heteroatoms selected from N, O, S, benzyl unsubstituted or substituted by C1-C6 alkoxy, carboxy;
n is 0,1;
X 1 、X 2 independently selected from CR 9 、N；
X 3 Selected from S, N = N, O, NH;
R 9 selected from H, D, halogen, hydroxy, amino, carboxy, C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C3-C8 cycloalkoxy, C1-C6 haloalkyl;
the A ring is selected from substituted or unsubstituted C3-12 cycloalkyl, substituted or unsubstituted heterocyclyl containing 1-5 heteroatoms selected from N, O, S, substituted or unsubstituted C6-C14 aryl, substituted or unsubstituted heteroaryl containing 1-5 heteroatoms N, O, S, pyridazinonyl; wherein the substituted substituents are selected from one or more of the following groups: H. d, halogen, hydroxy, amino, carboxy, C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl, C1-C6 alkylamino, hydroxymethyl、CH 3 -(C＝O)-。
In some embodiments, n=0, and the a ring is selected from the following structures:
Figure BDA0003972448150000032
wherein:
W 1 、W 2 and W is 3 Each independently selected from CR b Or NR (NR) c ；
R a 、R b Each independently selected from H, D, halogen, hydroxy, amino, carboxy, C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C3-C8 cycloalkoxy, C1-C6 haloalkyl, -CH 2 OH、CH 3 -(C＝O)-；
R c Is absent or selected from H, D, halogen, hydroxy, amino, carboxy, C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl, -CH 2 OH、CH 3 -(C＝O)-。
Preferably, in formula I, the a ring is selected from the group consisting of:
Figure BDA0003972448150000041
wherein R is 1a 、R 1b 、R 1c 、R 2a 、R 2b 、R 2c 、R 3a 、R 3b 、R 3c 、R 3d 、R 4a 、R 4b 、R 4c 、R 5a 、R 5b 、R 5c 、R 6a 、R 6b 、R 6c 、R 6d Each independently selected from H, D, halogen, C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl, -NH 2 、-OH、-CH 2 OH、CH 3 -(C＝O)-；
Y is selected from O, S or NH.
In some embodiments, the compound of formula I is selected from formula I-1 or formula I-2,
Figure BDA0003972448150000051
the compound of formula II is selected from formula II-1 or formula II-2,
Figure BDA0003972448150000052
therein, X, R 1 、R 2 、R 3 N is defined as above;
the A1 ring is selected from
Figure BDA0003972448150000053
Figure BDA0003972448150000054
A2 ring is selected from
Figure BDA0003972448150000055
Figure BDA0003972448150000061
R 1a 、R 1b 、R 1c 、R 2a 、R 2b 、R 2c 、R 3a 、R 3b 、R 3c 、R 3d 、R 4a 、R 4b 、R 4c 、R 5a 、R 5b 、R 5c 、R 6a 、R 6b 、R 6c 、R 6d Each independently selected from H, halogen, C1-C6 alkyl, C2-C6 alkenyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl, -NH 2 、-OH、-CH 2 OH、CH 3 -(C＝O)-；
Y is selected from O, S or NH.
In some embodiments, the compound of formula I-1 is a compound of formula I-1A,
Figure BDA0003972448150000062
wherein:
R 1 is-C (O) OR 7 ；
R 3 And R is 6 Each independently selected from halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl; or R is 3 And R is 6 Together with the carbon atoms to which they are attached form a saturated or unsaturated 5-6 membered ring, in particular a benzene ring;
R 7 selected from H, C1-C6 alkyl;
n is 0 or 1;
the definition of the A1 ring is as above;
preferably, the A1 ring is selected from the following structures:
Figure BDA0003972448150000063
/>
Figure BDA0003972448150000071
in some embodiments, the compound of formula I-2 is a compound of formula I-2A,
Figure BDA0003972448150000072
wherein:
R 1 is-C (O) OR 7 ；
R 3 And R is 6 Each independently selected from halogen, C1-C6 alkyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl; or R is 3 And R is 6 Together with the carbon atoms to which they are attached form a saturated or unsaturated 5-6 membered ring, in particular a benzene ring;
R 7 selected from H, C1-C6 alkyl;
n is 0 or 1;
the definition of the A2 ring is as described above;
preferably, the A2 ring is selected from the following structures:
Figure BDA0003972448150000081
in some embodiments, the compound of formula II-1 is of formula II-1A, formula II-1B or formula II-1C,
Figure BDA0003972448150000082
wherein: r is R 1 is-C (O) OR 7 ；
R 2 、R 3 、R 4 Each independently selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl; or R is 2 And R is 3 Together with the carbon atoms to which they are attached form a saturated or unsaturated 5-6 membered ring, in particular a benzene ring or cyclohexane;
R 7 selected from H, C1-C6 alkyl;
n，A 1 the definition of the ring is as described above.
The terms in the present invention are defined as follows:
the term "alkyl" refers to straight or branched chain saturated hydrocarbon radicals containing from 1 to 18 carbon atoms, and especially from 1 to 6 carbon atoms. Typical "alkyl" groups include methyl, ethyl, propyl, isopropyl, n-butyl, t-butyl, isobutyl, pentyl, isopentyl, heptyl, 4-dimethylpentyl, octyl, 2, 4-trimethylpentyl, nonyl, decyl, undecyl, dodecyl and the like. The term "C1-C6 alkyl" refers to straight or branched chain alkyl groups comprising 1 to 6 carbon atoms, such as methyl, ethyl, propyl, isopropyl, n-butyl, t-butyl, isobutyl. "substituted alkyl" means that one or more positions in the alkyl group are substituted, especially 1 to 4 substituents, and may be substituted at any position. Typical substitutions include, but are not limited to, one or more of the following groups: such as hydrogen, for example, Deuterium, halogen (e.g., a single halogen substituent or multiple halogen substituents, the latter such as trifluoromethyl or alkyl containing Cl), nitrile, nitro, oxygen (e.g., =o), trifluoromethyl, trifluoromethoxy, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, aromatic ring, ORa, SRa, S (=o) Re, S (=o) 2 Re、P(＝O) 2 Re、S(＝O) 2 ORe、P(＝O) 2 ORe、NRbRc、NRbS(＝O) 2 Re、NRbP(＝O) 2 Re、S(＝O) 2 NRbRc、P(＝O) 2 NRbRc、C(＝O)ORd、C(＝O)Ra、C(＝O)NRbRc、OC(＝O)Ra、OC(＝O)NRbRc、NRbC(＝O)Ore、NRdC(＝O)NRbRc、NRdS(＝O) 2 NRbRc、NRdP(＝O) 2 NRbRc, NRbC (=o) Ra, or NRbP (=o) 2 Re, where Ra, as herein represented, may independently represent hydrogen, deuterium, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, or aromatic ring, rb, rc, and Rd may independently represent hydrogen, deuterium, alkyl, cycloalkyl, heterocycle, or aromatic ring, or Rb and Rc together with the N atom may form a heterocycle; re may independently represent hydrogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, or aromatic ring. Typical substituents described above, such as alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, or aromatic ring, may be optionally substituted.
The term "alkenyl" refers to a straight or branched hydrocarbon radical containing 2 to 18 carbon atoms and at least one carbon-carbon double bond. The term "C2-C6 alkenyl" refers to a straight or branched hydrocarbon group containing 2 to 6 carbon atoms and having at least one carbon-carbon double bond, such as ethenyl, propenyl, 2-propenyl, (E) -2-butenyl, (Z) -2-butenyl, (E) -2-methyl-2-butenyl, (Z) -2-methyl-2-butenyl, 2, 3-dimethyl-2-butenyl, (Z) -2-pentenyl, (E) -1-pentenyl, (E) -2-pentenyl, (Z) -2-hexenyl, (E) -1-hexenyl, (Z) -1-hexenyl, (E) -2-hexenyl, (Z) -3-hexenyl, (E) -1, 3-hexadienyl, 4-methyl-3-pentenyl. "substituted alkenyl" means that one or more positions in the alkenyl group are substituted, especially 1-4 substituents, and may be substituted at any position. Typical substitutions include, but are not limited to, one or more of the following groups: such as hydrogen, deuterium, halogen (e.g., mono-or polyhalo substituents), nitrile, nitro, oxygen (e.g., =o), trifluoromethyl, trifluoromethoxy, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, aromatic ring, ORa, SRa, S (=o) Re, S (=o) 2 Re、P(＝O) 2 Re、S(＝O) 2 ORe、P(＝O) 2 ORe、NRbRc、NRbS(＝O) 2 Re、NRbP(＝O) 2 Re、S(＝O) 2 NRbRc、P(＝O) 2 NRbRc、C(＝O)ORd、C(＝O)Ra、C(＝O)NRbRc、OC(＝O)Ra、OC(＝O)NRbRc、NRbC(＝O)ORe、NRdC(＝O)NRbRc、NRdS(＝O) 2 NRbRc、NRdP(＝O) 2 NRbRc, NRbC (=o) Ra, or NRbP (=o) 2 Re, where Ra, as herein represented, may independently represent hydrogen, deuterium, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, or aromatic ring, rb, rc, and Rd may independently represent hydrogen, deuterium, alkyl, cycloalkyl, heterocycle, or aromatic ring, or Rb and Rc together with the N atom may form a heterocycle; re may independently represent hydrogen, deuterium, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, or aromatic ring. Typical substituents described above, such as alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, or aromatic ring, may be optionally substituted.
The term "alkynyl" refers to a straight or branched hydrocarbon radical containing from 2 to 18 carbon atoms and at least one carbon-carbon triple bond. Typical groups include ethynyl groups. The term "C2-C6 alkynyl" refers to straight or branched hydrocarbon radicals containing 2 to 6 carbon atoms and at least one carbon-carbon triple bond, such as ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 1-hexynyl, 2-hexynyl, 3-hexynyl. "substituted alkynyl" means that one or more positions in the alkynyl group are substituted, especially 1 to 4 substituents, and can be substituted at any position. Typical substitutions include, but are not limited to, one or more of the following groups: such as hydrogen, deuterium, halogen (e.g., a single halogen substituent or multiple halogen substituents), nitrile, nitro, oxygen (e.g., =o), trifluoromethyl, trifluoromethoxy, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, aromatic ring, ORa, SRa, S (=o) Re, S (=o) 2 Re、P(＝O) 2 Re、S(＝O) 2 ORe、P(＝O) 2 ORe、NRbRc、NRbS(＝O) 2 Re、NRbP(＝O) 2 Re、S(＝O) 2 NRbRc、P(＝O) 2 NRbRc、C(＝O)ORd、C(＝O)Ra、C(＝O)NRbRc、OC(＝O)Ra、OC(＝O)NRbRc、NRbC(＝O)Ore、NRdC(＝O)NRbRc、NRdS(＝O) 2 NRbRc、NRdP(＝O) 2 NRbRc, NRbC (=o) Ra, or NRbP (=o) 2 Re, where Ra, as herein represented, may independently represent hydrogen, deuterium, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, or aromatic ring, rb, rc, and Rd may independently represent hydrogen, deuterium, alkyl, cycloalkyl, heterocycle, or aromatic ring, or Rb and Rc together with the N atom may form a heterocycle; re may independently represent hydrogen, deuterium, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, or aromatic ring. Typical substituents may be optionally substituted.
The term "cycloalkyl" refers to a fully saturated cyclic hydrocarbon group comprising 1-4 rings, each containing 3-8 carbon atoms, for example containing 3-18 carbon atoms, especially 3-14 carbon atoms, including without limitation cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or norbornane. "substituted cycloalkyl" means that one or more positions in the cycloalkyl group are substituted, especially 1-4 substituents, and can be substituted at any position. Typical substitutions include, but are not limited to, one or more of the following groups: such as hydrogen, deuterium, halogen (e.g., a single halogen substituent or a multiple halogen substituent, the latter such as trifluoromethyl or an alkyl group containing Cl 3), nitrile, nitro, oxygen (e.g., =o), trifluoromethyl, trifluoromethoxy, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, aromatic ring, ORa, SRa, S (=o) Re, S (=o) 2 Re、P(＝O) 2 Re、S(＝O) 2 ORe、P(＝O) 2 ORe、NRbRc、NRbS(＝O) 2 Re、NRbP(＝O) 2 Re、S(＝O) 2 NRbRc、P(＝O) 2 NRbRc、C(＝O)ORd、C(＝O)Ra、C(＝O)NRbRc、OC(＝O)Ra、OC(＝O)NRbRc、NRbC(＝O)ORe、NRdC(＝O)NRbRc、NRdS(＝O) 2 NRbRc、NRdP(＝O) 2 NRbRc, NRbC (=o) Ra or NRbP (=o) 2 Re, where Ra, as herein represented, may independently represent hydrogen, deuterium, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, or aromatic ring, rb, rc, and Rd may independently represent hydrogen, deuterium, alkyl, cycloalkyl, heterocycle, or aromatic ring, or Rb and Rc together with the N atom mayTo form a heterocycle; re may independently represent hydrogen, deuterium, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, or aromatic ring. Typical substituents described above may be optionally substituted. Typical substitutions also include spiro, bridged or fused ring substituents, especially spiro-cycloalkyl, spiro-alkenyl, spiro-heterocycle (excluding heteroaryl), bridged-cycloalkyl, bridged-cycloalkenyl, bridged-heterocycle (excluding heteroaryl), fused-ring alkyl, fused-ring alkenyl, fused-ring heterocyclyl or fused-ring aryl groups, which cycloalkyl, cycloalkenyl, heterocyclyl and heteroaryl groups may be optionally substituted.
The term "aryl" refers to aromatic cyclic hydrocarbon radicals having 1 to 5 rings, for example containing 6 to 18 carbon atoms, especially 6 to 14 carbon atoms. In particular monocyclic and bicyclic radicals, such as phenyl, biphenyl or naphthyl. The aromatic ring containing two or more aromatic rings (bicyclo, etc.), aryl groups may be linked by a single bond (e.g., biphenyl), or condensed (e.g., naphthalene, anthracene, etc.). "substituted aryl" means that one or more positions in the aryl group are substituted, especially 1 to 3 substituents, and can be substituted at any position. Typical substitutions include, but are not limited to, one or more of the following groups: such as hydrogen, deuterium, halogen (e.g., a single halogen substituent or multiple halogen substituents), nitrile, nitro, oxygen (e.g., =o), trifluoromethyl, trifluoromethoxy, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, aromatic ring, ORa, SRa, S (=o) Re, S (=o) 2 Re、P(＝O) 2 Re、S(＝O) 2 ORe、P(＝O) 2 ORe、NRbRc、NRbS(＝O) 2 Re、NRbP(＝O) 2 Re、S(＝O) 2 NRbRc、P(＝O) 2 NRbRc、C(＝O)ORd、C(＝O)Ra、C(＝O)NRbRc、OC(＝O)Ra、OC(＝O)NRbRc、NRbC(＝O)ORe、NRdC(＝O)NRbRc、NRdS(＝O) 2 NRbRc、NRdP(＝O) 2 NRbRc, NRbC (=o) Ra, or NRbP (=o) 2 Re, where Ra, as herein represented, may independently represent hydrogen, deuterium, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycle, or aromatic ring, rb, rc, and Rd may independently represent hydrogen, deuterium, alkyl, cycloalkyl, heterocycle, or aromatic ring, or Rb and Rc together with the N atom may form a heterocycle; re may independently represent hydrogen, deuterium, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, heterocycleOr an aromatic ring. Typical substituents described above may be optionally substituted. Typical substitutions also include fused ring substituents, especially fused ring alkyl, fused ring alkenyl, fused ring heterocyclyl or fused ring aryl groups, which cycloalkyl, cycloalkenyl, heterocyclyl and heteroaryl groups may be optionally substituted.
The term "heteroaryl" refers to an aromatic cyclic group containing 1 to 4 heteroatoms (preferably 1 or 2), 5 to 14 ring atoms, wherein the heteroatoms are selected from oxygen, nitrogen and sulfur. Heteroaryl is preferably a 5-to 10-membered ring, more preferably a 5-or 6-membered ring, such as pyrrolyl, pyrazolyl, imidazolyl, oxazolyl, oxadiazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, triazinyl, triazolyl, purine, carbazole, indolyl, indazolyl, benzothienyl, benzofuranyl, benzimidazolyl, benzotriazole, benzothiazolyl, benzothiadiazolyl, benzoxazolyl, isomerized quinolinyl, phthalazinyl, quinoxalinyl, quinazolinyl, cinnolinyl, naphthyridinyl, tetrazolyl, and the like. "heteroaryl" may be substituted or unsubstituted, and when substituted, the substituent is preferably one or more groups independently selected from alkyl, deuteroalkyl, haloalkyl, alkoxy, haloalkoxy, alkenyl, alkynyl, alkylthio, alkylamino, halogen, amino, nitro, hydroxy, mercapto, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, cycloalkylthio, oxo, carboxyl, and carboxylate.
The term "heterocyclyl" refers to a non-aromatic cyclic group containing 1 to 4 heteroatoms (preferably 1 or 2), 5 to 14 ring atoms, wherein the heteroatoms are selected from oxygen, nitrogen and sulfur, e.g. dihydropyridinyl, tetrahydropyridinyl (piperidinyl), tetrahydrothienyl, thioxotetrahydrothienyl, 4-piperidonyl, pyrrolidinyl, 2-pyrrolidinonyl, pyrrolinyl, tetrahydrofuranyl, bis-tetrahydrofuranyl, tetrahydropyranyl, bis-tetrahydropyranyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, octahydroisoquinolinyl, azacyclooctatetraenyl, pyranyl, chroenyl, xanthenyl, 2H-pyrrolyl, purinyl, naphthyridinyl, pteridinyl, phenanthridinyl, isochromanyl, chromanyl, imidazolidinyl, imidazolinyl, pyrazolidinyl, pyrazolinyl, piperazinyl, indolinyl, isoindolinyl, quinidinyl, morpholinyl, oxazolidinyl, benzoxazolinyl.
The term "halogen" or "halo" refers to fluorine, chlorine, bromine, iodine.
"haloalkyl" refers to a straight or branched haloalkyl such as "C1-C6 haloalkyl" which refers to a straight or branched haloalkyl having 1 to 6 carbon atoms containing one or more halogen atoms which may be the same or different, including without limitation-CH 2 Cl、-CHCl 2 、-CCl 3 、-CH 2 F、-CHF 2 、-CF 3 、-CH 2 Br、-CHBr 2 、-CBr 3 、CF 3 CH 2 、CCl 3 CH 2 、CBr 3 CH 2 。
The term "alkoxy" refers to a straight or branched chain alkoxy group, such as "C1-C6 alkoxy", which refers to a straight or branched chain alkoxy group having 1 to 6 carbon atoms, including without limitation methoxy, ethoxy, propoxy, isopropoxy, butoxy, and the like. Preferably C1-C4 alkoxy.
The term "alkylamino" refers to an amino-substituted straight or branched alkyl group, such as "C1-C6 alkylamino", which refers to an amino-substituted straight or branched alkyl group having 1 to 6 carbon atoms, including without limitation H 2 N-CH 2 -、H 2 N-CH 2 CH 2 -、H 2 N-CH 2 CH 2 CH2-、H 2 N-CH(CH 3 )CH 2 -and the like.
The term "carboxy" refers to-COOH.
The term "hydroxymethyl" refers to-CH 2 OH。
The term "saturated or unsaturated 5-6 membered ring" includes aromatic rings (e.g., benzene rings), heteroaromatic rings (e.g., benzene rings)
Figure BDA0003972448150000111
) Heterocycles (e.g.)>
Figure BDA0003972448150000121
) SaturatedHydrocarbon rings (e.g., cyclohexane).
Unless otherwise indicated, it is assumed that any heteroatom in an underfilling state has sufficient hydrogen atoms to complement its valence.
The term "pharmaceutically acceptable salt" as used herein refers to non-toxic, physiologically acceptable salts, including organic and inorganic salts such as hydrochloride, hydrobromide, hydroiodide, sulfate or bisulfate, nitrate, phosphate or acid phosphate, perchlorate, formate, acetate, trifluoroacetate, propionate, pyruvate, glycolate, oxalate, malonate, succinate, glutarate, maleate, fumarate, lactate, malate, citrate, tartrate, picrate, glutamate, benzoate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, salicylate, ascorbate, camphorate, camphorsulfonate, and the like.
Or can be at R 7 Forming salts such as lithium, sodium, potassium, etc.
Metabolites of the compounds and pharmaceutically acceptable salts thereof, as well as prodrugs that can be converted in vivo to the structures of the compounds and pharmaceutically acceptable salts thereof, are also included within the scope of the invention as defined in the claims.
The compounds and pharmaceutically acceptable salts thereof referred to herein may form solvates, such as, but not limited to, alcohol, hydrates, and the like. These solvates are also included within the scope of the invention as defined in the claims.
The compounds and pharmaceutically acceptable salts thereof referred to herein may have isomers such as optical isomers (including diastereomers and enantiomers), atropisomers, geometric isomers (cis-trans isomers), conformational isomers, tautomers, and mixtures thereof, and the like, but are not limited thereto. These isomers are also included within the scope of the present invention as defined in the claims.
The compounds referred to herein, and pharmaceutically acceptable salts, solvates thereof, may have polymorphs. These polymorphs are also included within the scope of the present invention as defined in the claims.
In some embodiments, the compound of formula I is selected from the following compounds:
Figure BDA0003972448150000122
/>
Figure BDA0003972448150000131
/>
Figure BDA0003972448150000141
/>
Figure BDA0003972448150000151
/>
Figure BDA0003972448150000161
/>
Figure BDA0003972448150000171
/>
Figure BDA0003972448150000181
/>
Figure BDA0003972448150000191
/>
Figure BDA0003972448150000201
/>
Figure BDA0003972448150000211
based on the crystal structure of the SR-717 and STING compound and the existing STING agonist, the invention combines molecular docking and molecular dynamics simulation, discovers that a class of compounds and the pharmaceutical composition thereof have STING agonistic activity, and compared with a positive compound SR-717, the preferred compound of the invention shows better STING binding capacity, and can obviously up-regulate the expression level of IFN-beta, CXCL10 and IL-6mRNA in human THP-1 cells and mouse RAW264.7 cells, thereby providing a new idea for the research and development of medicaments for treating malignant tumors and infectious diseases.
According to a second aspect of the present invention there is provided a process for the preparation of a compound of formula I, which is one of the following processes:
method 1:
Figure BDA0003972448150000212
the ester compound M1 and the boric acid ester compound M2 are subjected to a suzuki coupling reaction to obtain an intermediate M3, then the intermediate M3 is hydrolyzed to obtain a carboxylic acid compound M4, and the carboxylic acid compound M4 is further subjected to a condensation reaction with M5 or is hydrolyzed to obtain a compound of the formula I after condensation;
method 2:
Figure BDA0003972448150000221
/>
ester compound M1' and amine compound M 2 ' or M 2 Intermediate M obtained by nucleophilic substitution reaction 3 ' hydrolysis to give M 4 ' further carrying out condensation reaction with M5 or hydrolyzing after condensation to obtain a compound shown in a formula I;
Method 3:
Figure BDA0003972448150000222
reacting carboxylic acid compound M1a with oxalyl chloride to obtain acyl chloride M2a, then reacting with amine compound M5 to obtain M3a, performing suzuki coupling reaction on M3a and boric acid ester compound M2, or performing nucleophilic substitution reaction on M2 'or M2' of amine compound to obtain compound of formula I, or performing one-step hydrolysis reaction to obtain compound of formula I;
method 4:
Figure BDA0003972448150000231
reacting a compound M2-1 with trimethylethynyl silicon M2-2 to obtain a compound M2-3, performing cycloaddition reaction on a deprotected compound M2-4 and a compound M2-5 to obtain a compound M2-6, hydrolyzing the compound M2-6 to obtain a compound M2-7, condensing the compound M2-7 and the compound M5 to obtain a compound of formula I, or performing one-step hydrolysis reaction to obtain a compound of formula I;
or M5 in any of the above methods 1-4 is replaced with
Figure BDA0003972448150000232
(M5 a) to give a compound of formula II;
wherein R is 1 、R 2 、R 3 、X、X 1 、X 2 、X 3 、W、W 1 、W 2 、W 3 、R a The definition of the n, A rings is as above.
In some preferred embodiments, the suzuki coupling reaction between the ester compound M1 or M3a and the borate compound is performed under palladium-catalyzed conditions.
The above suzuki coupling reaction is usually carried out at 80-120 ℃, preferably 100-120 ℃, and the reaction is usually completed within about 5-12 hours, preferably 8-12 hours.
In some preferred embodiments, the nucleophilic substitution reaction between the ester compound M1' or M3a and the amine compound is under basic conditions (preferably the base is K 2 CO 3 NaH, N-diisopropylethylamine and triethylamine).
The nucleophilic substitution reaction is usually carried out at 0℃or room temperature, preferably room temperature, and the reaction is usually completed within about 1 to 5 hours, preferably within 2 to 3 hours.
In some preferred embodiments, the hydrolysis reaction described above is performed under alkaline conditions.
The hydrolysis reaction is usually carried out at 0℃or room temperature, preferably at room temperature, and the reaction is usually completed within about 1 to 5 hours, preferably 1 to 3 hours.
In some preferred embodiments, the condensation reaction of M4 or M4' with M5 is at a condensing agent (preferably the condensing agent combination is HATU, HBTU, HOBT/EDCI, TCFH/NMI). Optionally, the subsequent hydrolysis reaction is carried out under alkaline conditions (preferably aqueous alkali LiOH, naOH).
The condensation reaction is generally carried out at room temperature to 120℃and preferably at room temperature to 80℃and is usually completed within about 6 to 12 hours and preferably within 8 hours.
In some preferred embodiments, the reaction of M1a with oxalyl chloride is carried out at 0℃to room temperature, the reaction typically being completed between 1 and 12 hours, preferably within 5 hours.
In some preferred embodiments, the acid chlorides M2a and M5 are generally conducted under basic conditions (preferably the bases are N, N-diisopropylethylamine and triethylamine). The reaction is generally carried out at from 0℃to room temperature, preferably at room temperature. The reaction is usually completed in 1 to 5 hours.
According to a third aspect of the present invention there is provided a pharmaceutical composition comprising a therapeutically effective amount of one or more selected from the group consisting of the compounds of formula I, isomers, prodrugs, solvates, hydrates, pharmaceutically acceptable salts, active metabolites thereof.
The compounds according to the invention can be used alone or in combination with other drugs for the prevention or treatment of tumors, viral infections, immune disorders and inflammatory disorders.
The compounds of the general formula I, in particular the pyridazine compounds and thiadiazole compounds shown in the general formula I-1 or I-2 and pharmaceutically acceptable salts thereof can be independently administered or can be combined with other pharmaceutically acceptable therapeutic drugs. The pharmaceutically acceptable therapeutic agents include, but are not limited to, for example, traditional cytotoxic chemotherapy small molecule drugs such as methotrexate, 5-fluorouracil, doxorubicin, paclitaxel, imatinib, etc.; immunodetection site modulators such as Opdivo and Keytruda, and the like. The components of the pharmaceutical combination can be administered simultaneously or sequentially, as well as in a single formulation or in different formulations. The combinations include a compound of formula I in combination with one or more other acceptable therapeutic agents.
The pharmaceutical composition is in the form of tablets, capsules, pills, injections, pills, powder or granules.
The mode of administration of the compound of the present invention or a pharmaceutical composition thereof is not particularly limited, and representative modes of administration are not limited to oral administration, intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, topical administration, and the like.
According to a fourth aspect of the present invention there is provided the use of a compound of formula I, a pharmaceutically acceptable salt thereof, or an enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof, or a pharmaceutical composition as described above, in the preparation of a STING agonist.
According to a fifth aspect of the present invention, there is provided a compound represented by formula I, a pharmaceutically acceptable salt thereof, or an enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof, or a pharmaceutical composition as described above, for use in the preparation of a medicament for treating STING protein dependent diseases, in particular a medicament for treating tumors, viral infections, immune diseases and inflammatory diseases, which is a novel mechanism of action.
The tumors are selected from the group consisting of the tumors are each independently selected from the group consisting of: non-small cell lung cancer, lung adenocarcinoma, lung squamous carcinoma, breast cancer, prostate cancer, liver cancer, skin cancer, stomach cancer, intestinal cancer, bile duct cancer, brain cancer, leukemia, lymphoma, fibroma, sarcoma, basal cell carcinoma, glioma, renal cancer, melanoma, bone cancer, thyroid cancer, nasopharyngeal cancer, pancreatic cancer, etc.
The immune diseases and inflammatory diseases are selected from rejection of transplanted organs, gout, rhinitis, alopecia, alzheimer's disease, appendicitis, atherosclerosis, asthma, arthritis, allergic dermatitis, behcet's disease, bullous skin diseases, cholecystitis, chronic idiopathic thrombocytopenic purpura, chronic obstructive pulmonary disease, cirrhosis, degenerative joint diseases, dermatitis, dermatomyositis, wet , enteritis, encephalitis, gastritis, nephritis, hashimoto thyroiditis, hepatitis, pituitary, inflammatory bowel disease, irritable bowel syndrome, kawasaki disease, meningitis, multiple sclerosis, myocarditis, myasthenia gravis, mycosis fungoides, myositis, nephritis, osteomyelitis, pancreatitis, parkinson's disease, pericarditis, pernicious anemia, pneumonia, primary biliary sclerosing cholangitis, nodular polyarteritis, silver shoulder disease, fibrosis, lupus erythematosus, tissue graft rejection, thyroiditis, type I diabetes, vitiligo, uveitis, vasculitis, and Walson's macroglobulinemia.
The activity of the compound in the invention at the molecular and cellular level is obviously enhanced compared with that of a positive compound SR-717.
Drawings
FIG. 1 shows the expression levels of mRNA of IFN- β tested in the experimental examples of the present invention;
FIG. 2 shows the expression levels of mRNA of CXCL10 tested in the experimental example of the present invention;
FIG. 3 shows the expression level of mRNA of IL-6 examined in the experimental example of the present invention.
Detailed Description
The following examples and experimental examples further illustrate the present invention without limiting the scope thereof.
The commercially available materials and reagents and the like used in the examples and experimental examples are those conventionally used in the art, except for the specific description, and the experimental method is a conventional experimental method which can be searched using scibinder or Reaxy.
Example 1
Preparation of compound 27 and compound 62:
Figure BDA0003972448150000251
step 1:
imidazole (347 mg,5.1 mmol) was weighed and dissolved in THF (20 mL), after the system temperature was lowered to 0deg.C, naH was added, and after stirring for 30min, 5-bromo-1, 3, 4-thiadiazole-2-carboxylic acid ethyl ester M1 (1.0 g,4.2 mmol) was added and the reaction was maintained at 0deg.C for 1h. After the TLC monitoring reaction, methanol is added to quench the reaction, the solvent is removed under reduced pressure, water is added to the residue, extraction is performed with ethyl acetate, and the compound M2 is obtained by flash column chromatography after concentration.
Step 2:
compound M2 (570 mg,2.5 mmol) was dissolved in CH 3 To OH (12 mL), 2.5M aqueous LiOH (1.2 mL,3.1 mmol) was added after cooling to 0deg.C, and the reaction was allowed to slowly warm to room temperature for about 1h. After TLC monitoring the reaction was completed, 2M aqueous HCl was slowly added dropwise to the system, ph=5-6 was adjusted, the precipitated solid was filtered off, and dried under vacuum at 60 ℃ overnight to give compound M3.
Step 3:
compound M3 (128 mg,0.65 mmol) and methyl 2-amino-4, 5-difluorobenzoate (159 mg,0.85 mmol) were added to a reaction flask and CH was added 3 CN dissolves the substrate, and after cooling to 0 ℃, TCFH and NMI are added in sequence, and the reaction is carried out for about 3 hours after slowly heating to room temperature. After the TLC monitoring the reaction, the reaction was quenched with water, extracted with ethyl acetate, dried and concentrated, followed by flash column chromatography to give compound 27.
Step 4:
compound 27 (913 mg,2.5 mmol) was dissolved in CH 3 To OH (12 mL), 2.5M aqueous LiOH (1.2 mL,3.1 mmol) was added after cooling to 0deg.C, and the reaction was allowed to slowly warm to room temperature for about 1h. After TLC monitoring the reaction was completed, 2M aqueous HCl was slowly added dropwise to the system, ph=5-6 was adjusted, the precipitated solid was filtered off, and dried under vacuum at 60 ℃ overnight to give compound 62.
Example 2
Preparation of compound 26:
Figure BDA0003972448150000261
step 1:
6-Chloropyridazine-3-carboxylic acid Z1 (3 g,18.92 mmol) was weighed into 50mL of anhydrous dichloromethane, oxalyl chloride (1.92 mL,22.71 mmol) was added at 0deg.C, followed by 0.5mL of DMF, the reaction was gradually warmed to room temperature, the reaction was stopped until insoluble matter was completely dissolved, and Z2 was obtained by concentration.
Step 2:
z2 (1 g,5.65 mmol) obtained in step 1 was dissolved in 20mL of dry dichloromethane, and a solution of methyl 2-amino-4, 5-difluorobenzoate (2 g,11.30 mmol) and DPIEA (1.97 mL,11.30 mmol) in dichloromethane was added at 0deg.C and reacted for 5h, followed by filtration to give Z3 without further purification.
Step 3:
z3 (200 mg,0.61 mmoL) obtained in step 2 and pyrrole (81.90 mg,1.22 mmol) were taken and dissolved in 5mL of dry DMF, followed by addition of sodium tert-butoxide (117.32 mg,1.22 mmol) and the system was reacted overnight at 60-80 ℃. The reaction is subjected to column chromatography to finally obtain Z4.
Step 4:
z4 (50 mg,0.14 mmol) in step 3 was dissolved in 2mL THF. Lithium hydroxide monohydrate (8.78 mg,0.21 mmol) was weighed and dissolved in 1mL of water, added to a THF solution, reacted at room temperature for 1h, concentrated under reduced pressure, finally the pH was adjusted to about 2 with 1N HCl, and the precipitated white solid was filtered to obtain compound 26. 1 H NMR(500MHz,DMSO-d 6 )δ14.54(s,1H),8.82(dd,J＝13.7,7.6Hz,1H),8.39(d,J＝9.2Hz,1H),8.32(d,J＝9.2Hz,1H),8.01(dd,J＝11.6,9.4Hz,1H),7.91(t,J＝2.3Hz,2H),6.46(t,J＝2.3Hz,2H).
Example 3
Preparation of compound 1 and compound 6:
Figure BDA0003972448150000271
z3 was synthesized in reference examples 2, steps 1 and 2.
Synthesis of Compound 1:
z3 (100 mg,0.31 mmol) and 1,2, 4-triazole (21.35 mg,0.31 mmol) were weighed and dissolved in dry DMF (2 mL) and reacted at 120℃for 2h. Diluting with water to obtain white solid, and preparing compound 1 by PTLC. 1 H NMR(600MHz,DMSO-d 6 )δ13.09(s,1H),9.81(s,1H),8.82(dd,J＝13.4,7.5Hz,1H),8.59(d,J＝9.0Hz,1H),8.50(s,1H),8.40(d,J＝9.0Hz,1H),8.07(dd,J＝11.1,8.9Hz,1H),3.95(s,3H).
Synthesis of Compound 6:
compound 1 (10 mg,0.03 mmol) was dissolved in DMSO (0.8 mL), a 0.1M aqueous solution of LiOH (0.33 mL,0.04 mmol) was added to the system, the mixture was reacted at room temperature for 3h, then 1N HCl was added to adjust pH to about 2, a white solid appeared, and the mixture was filtered and dried to obtain Compound 6. 1 H NMR(600MHz,DMSO-d 6 )δ13.33(s,1H),9.80(s,1H),8.87(dd,J＝13.5,7.5Hz,1H),8.60(d,J＝9.0Hz,1H),8.50(s,1H),8.41(d,J＝9.0Hz,1H),8.07(dd,J＝11.1,9.0Hz,1H).
Example 4
Preparation of compound 10 and compound 15:
Figure BDA0003972448150000281
z3 was synthesized in reference examples 2, steps 1 and 2.
Preparation of compound 10:
5-fluoroimidazole (20 mg,0.23 mmol) was weighed and dissolved in 1mL of dry DMF, cooled to 0 ℃, then NaH (10.22 mg,0.26 mmol) was added and stirred for 30min at room temperature, finally Z3 (91.4 mg,0.28 mmol) was dissolved in 1mL of DMF and added dropwise to the above system, reacted overnight, the system was diluted with water, the resulting solid was filtered, and compound 10 was obtained by column chromatography. 1 H NMR(400MHz,Chloroform-d)δ13.38(s,1H),8.92(dd,J＝13.0,7.5Hz,1H),8.54(d,J＝9.1Hz,1H),8.25(s,1H),7.96(dd,J＝10.8,8.7Hz,1H),7.74(d,J＝9.1Hz,1H),7.39(dd,J＝8.2,1.8Hz,1H),4.03(s,3H).
Preparation of compound 15:
compound 10 (20 mg,0.05 mmol) was weighed and dissolved in 7mL (V) THF ：V MeOH ：V H2O =3:3:1), followed by addition of 2.5M aqueous LiOH (26 μl,0.06 mmol) and reaction at room temperature for 3h, followed by pH 2-3 adjustment with 1N HCl, filtration of the precipitated white solid, and drying to give compound 15. 1 H NMR(600MHz,DMSO-d 6 )δ14.19(s,1H),13.25(s,1H),8.83(dd,J＝13.5,7.4Hz,1H),8.60(s,1H),8.56(d,J＝9.1Hz,1H),8.44(d,J＝9.2Hz,1H),8.04(dd,J＝12.8,7.3Hz,1H),7.97(d,J＝8.0Hz,1H).
Example 5
Preparation of compound 21 and compound 22:
Figure BDA0003972448150000291
/>
z3 was synthesized in reference examples 2, steps 1 and 2.
Preparation of compound 21:
4-Pyridazine borate (150 mg,0.73 mmol), Z3 (287 mg,0.87 mmol) and potassium acetate (143 mg,1.46 mmol) were weighed out and dissolved in a mixed solvent of 1, 4-dioxane and water (V: V=1:1, 20 mL), and the mixture was degassed by ultrasound for 30min, and finally, tetrakis triphenylphosphine palladium (42 mg,0.04 mmol) was added, replaced with argon 3 times, and reacted at 110℃for 12h. After the reaction, the solvent was concentrated, and the compound 21 was obtained by column chromatography. 1 H NMR(600MHz,DMSO-d 6 )δ13.18(s,1H),10.08(d,J＝2.3Hz,1H),9.53(d,J＝5.3Hz,1H),8.87(dd,J＝13.3,7.5Hz,1H),8.79(d,J＝8.8Hz,1H),8.57(d,J＝8.8Hz,1H),8.52(dd,J＝5.7,2.3Hz,1H),8.12(t,J＝10.0Hz,1H),3.97(s,3H).ESI:372.3(M+H).
Preparation of compound 22:
compound 21 (20 mg,0.05 mmol) was weighed and dissolved in a mixed solvent (V THF ：V MeOH ：V H2O =1:1:1) 3mL, followed by addition of 2.5M aqueous LiOH (26 μl,0.06 mmol) and reaction at room temperature for 2h, followed by pH adjustment of 2-3 with 1N HCl, filtration of the precipitated white solid, and drying to give compound 22. 1 H NMR(600MHz,DMSO-d 6 )δ13.40(s,1H),10.06(s,1H),9.52(d,J＝5.3Hz,1H),8.88(dd,J＝13.4,7.4Hz,1H),8.77(d,J＝8.8Hz,1H),8.57(s,1H),8.50(d,J＝5.0Hz,1H),8.07(t,J＝10.0Hz,1H).
Example 6
Preparation of compounds 34 and 54:
Figure BDA0003972448150000292
step 1: preparation of intermediate Z5
Intermediate Z4 (2 g,11.59 mmol) was weighed and dissolved in 20mL THF followed by sequential addition of trimethylsilylacetylene (8 mL,58.00 mmol), pd (PPh) 3 ) 2 Cl 2 (814 mg,1.16 mmol), cuI (441 mg,2.32 mmol) and triethylamine (1.6 mL,11.59 mmol) were degassed under ultrasound for 30min, left to react at room temperature for 3h, the reaction concentrated and purified to give 2.18g of a pale yellow solid.
The pale yellow solid (2.18 g,9.30 mmol) obtained above was dissolved in 30mL of absolute ethanol, to which K was added 2 CO 3 (2.57 g,18.61 mmol) was reacted at room temperature for 2h. H is added into the system after the reaction is finished 2 O (100 mL) was extracted with DCM (30 mL. Times.3) and the organic layer was concentrated to afford intermediate Z5. 1 H NMR(600MHz,Chloroform-d)δ8.18(d,J＝8.6Hz,1H),7.74(d,J＝8.6Hz,1H),4.09(s,3H),3.58(s,1H).
Step 2: preparation of intermediate Z6
Z5 (1.03 g,6.35 mmol) was weighed into a 100mL vial, 1, 4-dioxane (40 mL) was added for dissolution, and then 1,2,4, 5-tetrazine (573.43 mg,6.99 mmol) was added thereto for reaction at 140℃for 6 hours. Finally purifying to obtain an intermediate Z6. 1 H NMR(600MHz,DMSO-d 6 )δ10.03(d,J＝1.2Hz,1H),9.51(d,J＝5.4Hz,1H),8.70(d,J＝8.8Hz,1H),8.47(dd,J＝5.4,2.4Hz,1H),8.44(d,J＝8.8Hz,1H),4.01(s,3H).
Step 3: preparation of intermediate Z7
The intermediate Z6 (300 mg,1.39 mmol) obtained above was weighed and V was added THF ：V MeOH ：V H2O Dissolving in a solvent of 2:2:1 (10 mL), adding a 2.5M aqueous solution (1.11 mL,2.78 mmol) of LiOH at room temperature, reacting for 1h at room temperature, evaporating a large amount of solvent under reduced pressure, finally adjusting pH to about 2 with 1N HCl, precipitating a large amount of white solid, filtering, and drying a filter cake to obtain an intermediate Z7. 1 H NMR(600MHz,DMSO-d 6 )δ14.09(s,1H),10.03(s,1H),9.51(d,J＝5.3Hz,1H),8.67(d,J＝8.8Hz,1H),8.46(dd,J＝5.4,2.4Hz,1H),8.40(d,J＝8.8Hz,1H).
Step 4: preparation of Compound 34
Intermediate Z7 (80 mg, 395.70. Mu. Mol), methyl anthranilate (71.78 mg, 474.86. Mu. Mol), TCFH (133.23 mg, 474.86. Mu. Mol) and NMI (113.71 mg,1.38 mmol) were weighed out and anhydrous acetonitrile (20 mL) was added to react at 75℃for 10 hours. Final purification gave compound 34 as a pale yellow solid. 1 H NMR(600MHz,DMSO-d 6 )δ13.15(s,1H),10.23–9.88(m,1H),9.53(dd,J＝5.4,1.3Hz,1H),8.86(dd,J＝8.5,1.2Hz,1H),8.79(d,J＝8.8Hz,1H),8.57(d,J＝8.8Hz,1H),8.52(dd,J＝5.4,2.4Hz,1H),8.11(dd,J＝8.0,1.6Hz,1H),7.76(ddd,J＝8.7,7.3,1.7Hz,1H),7.31(ddd,J＝8.1,7.3,1.2Hz,1H),3.96(s,3H).
Step 5: preparation of Compound 54
Compound 34 (50 mg, 149.11. Mu. Mol) was weighed and dissolved in V THF ：V MeOH ：V H2O To 2:2:1 (5 mL), 2.5M aqueous LiOH (120 μl,298.22 μmol) was added under ice bath conditions and reacted at room temperature for 2h. A large amount of solvent was distilled off, the pH was adjusted to about 2 with 1N HCl, a white solid was precipitated, filtered, and the cake was dried in vacuo to give compound 54. 1 H NMR(600MHz,DMSO-d 6 )δ13.76(s,1H),13.38(s,1H),10.09–10.06(m,1H),9.53(dd,J＝5.4,1.2Hz,1H),8.88(d,J＝8.4Hz,1H),8.78(d,J＝8.8Hz,1H),8.56(d,J＝8.8Hz,1H),8.51(dd,J＝5.4,2.4Hz,1H),8.11(dd,J＝7.9,1.7Hz,1H),7.75–7.70(m,1H),7.29(t,J＝7.6Hz,1H).
Other compounds were prepared according to the similar procedure described above, with the following results:
Figure BDA0003972448150000311
/>
Figure BDA0003972448150000321
/>
Figure BDA0003972448150000331
/>
Figure BDA0003972448150000341
/>
Figure BDA0003972448150000351
/>
Figure BDA0003972448150000361
/>
Figure BDA0003972448150000371
/>
Figure BDA0003972448150000381
/>
Figure BDA0003972448150000391
/>
Figure BDA0003972448150000401
/>
Figure BDA0003972448150000411
/>
Figure BDA0003972448150000421
/>
Figure BDA0003972448150000431
/>
Figure BDA0003972448150000441
/>
Figure BDA0003972448150000451
/>
Figure BDA0003972448150000461
/>
Figure BDA0003972448150000471
/>
Figure BDA0003972448150000481
/>
Figure BDA0003972448150000491
/>
Figure BDA0003972448150000501
/>
Figure BDA0003972448150000511
/>
Figure BDA0003972448150000521
experimental example
Materials and methods:
cell strain
Cell lines THP1-BLUE ISG and Raw-Lucia ISG were purchased from Invivogen. Referring to the culture instructions, the cell culture conditions were 2 mmol.L -1 L-Glutamine, 25 mmol.L -1 HEPES, 10% heat-inactivated Gibco FBS (56 ℃ C., 30 min), green streptomycin (100. Mu.g.mL) -1 、100μg·mL -1 ) Is a medium of RPMI 1640.
Reagent(s)
SR-717 is available from Shanghai Haoyuan biological medicine technologies Co., ltd. QUANTI-BLUE was purchased from Invivogen, and qPCR primers were synthesized by Bio-engineering Co., ltd.
Protein expression and purification
Will encode human STING H232 The gene for CTD (carboxy terminal domain, residues 139-378) was inserted into the modified Pet28a vector and a his-sumo tag was added. The recombinant protein is expressed in the strain E.coli BL21 (DE 3). Cells were cultured at 37℃and induced overnight at 18℃with 0.3mM isopropyl- β -D-thiogalactoside (IPTG). Cells were collected by centrifugation at 3000rpm for 30min and sonicated in lysis buffer (20 mM HEPES, pH=7.4, 200mM sodium chloride, 10mM imidazole, 1mM CEP). After centrifugation, the supernatant was loaded onto a Histrapoff column, washed with 50mM imidazole and eluted with 300mM imidazole. The tag was cleaved with ULP-1 enzyme and removed using a Hiscap FF column. The STING protein was further purified using Superdex 75 incrustation molecular sieve. The purified protein was concentrated in buffer (20 mm hepes, ph=7.4, 200mm sodium chloride) and stored at-80 ℃.
Expression and purification of other human and murine STING proteins were referenced above.
Protein thermomigration
The thermal stability of STING proteins was tested using the CFX ManagerTMSoftware real-time PCR system. Compounds and DMSO at the same concentration (as a blank) were incubated with 2 μm STING protein and 5XSYPRO orange (invitrogen) in buffer (20 mM hepes, ph=7.4, 200mM sodium chloride). Fluorescence signal values from 25℃to 95℃were monitored and collected over 47 min. Determination of T of STING proteins using protein thermomigration analysis software m Value, delta T, of difference from control group m The results (DEG C) are shown in Table 1, deltaT m (. Degree.C.) is not 0, and represents that the compound is bound to the protein, and the larger the gap is, the stronger the binding is.
THP-1 BLUE and Raw-Lucia ISG detection
100. Mu.L of well-conditioned cells were treated at 5X 10 5 Each well was plated onto round bottom 96 well cell culture plates, 10. Mu.L of SR-717 and compound at different concentrations was added to each well, three parallel wells were established, 37℃and 5% CO 2 The cell culture incubator is incubated for 24h, 180. Mu.L of QUANTI-BLUE assay reagent is added to 96-well cell culture plates, followed by 20. Mu.L of supernatant per well, the well plate mix is gently tapped, incubated for 30min at 37℃and chemiluminescent values are detected at 650nM (TECAN microplate reader). EC was fitted by plotting the fold gene expression and the corresponding concentration of experimental versus control group using GraphPad Prism 8 50 The value, i.e. the concentration that causes 50% of the maximum effect.
Humanized STING of compounds R232H The results of molecular level and THP1 cell activity are shown in table 1.
TABLE 1
Figure BDA0003972448150000531
/>
Figure BDA0003972448150000541
/>
Figure BDA0003972448150000551
/>
Figure BDA0003972448150000561
/>
Figure BDA0003972448150000571
The results of the activity of the compounds at the molecular level of the different isoforms of human STING are shown in table 2.
TABLE 2
Figure BDA0003972448150000572
Compounds in murine STING WT The results of the molecular level and murine raw264.7 cell activity are shown in table 3.
TABLE 3 Table 3
Figure BDA0003972448150000573
qPCR
The total RNA of the cells was extracted using RNA rapid extraction kit (Nanjinouzan Biotechnology Co., ltd.) in the following general method: after lysing cells with 500. Mu.L of lysate, transferring to a centrifuge column, collecting filtrate, adding 0.5 volume of absolute ethanol, mixing well, transferring to an RNA collection column, centrifuging at 12000rpm for 30s, adding 700. Mu.L of rinse solution 1, centrifuging at 12000rpm for 30s, adding 700. Mu.L of rinse solution 2, centrifuging at 12000rpm for 30s, adding 500. Mu.L of rinse solution 2, and centrifuging at 12000rpm for 2min. The column was transferred to a 1.5mL RNase-free EP tube and 20-100. Mu.L DEPC H was added 2 O was added to the center of the column, and the mixture was centrifuged at 12000rpm for 1min to obtain an RNA solution. The concentration of RNA is detected by using a nucleic acid quantifying module of a TECAN multifunctional enzyme-labeled instrument, and then cDNA solution is obtained by reverse transcription by using a reverse transcription kit.
To examine the mRNA levels of IFN- β, CXCL10, IL6, the study used SYBRgreen qPCR Mix and 96 Kong Shishi fluorescent quantitative PCR apparatus and designed and synthesized a series of primers of the following sequence:
Human ACTB forward primer catgtacgttgctatccaggc (SEQ ID NO. 1),
ctccttaatgtcacgcacgat (SEQ ID NO. 2) as human ACTB reverse primer;
cagcatctgctggttgaaga (SEQ ID NO. 3) as human IFNB forward primer,
cattacctgaaggccaagga (SEQ ID NO. 4) human IFNB reverse primer;
human CXCL10 forward primer ccacgtgttgagatcattgct (SEQ ID NO. 5),
tgcatcgattttgctcccct (SEQ ID NO. 6) as human CXCL10 reverse primer;
human IL6 forward primer ttcggtccagttgccttctc (SEQ ID NO. 7),
human IL6 reverse primer tacatgtctcctttctcagggc (SEQ ID NO. 8).
RT-qPCR was performed using the CFX96 (TM) real-time PCR detection system (BioRad, shanghai, china). The thermal cycle process includes initial denaturation at 95℃for 30s, followed by operation at 95℃for 5s and 60℃for 30s as one cycle, with the number of cycles set at 40.
The expression level of the target gene was analyzed based on the melting curve. Folds=2-DeltaCt is used to represent the relationship of the target gene expression of the experimental group and the control group, the Folds value is the relative gene expression level, and the ordinate value corresponds to the ordinate value of figures 1-3, wherein the control group (blank control) is the DMSO administration group with the same concentration.
The calculation formula of ΔΔct is as follows:
ΔΔCt＝(Ct purpose(s) -Ct Internal reference ) Experimental group- (Ct) Purpose(s) -Ct Internal reference ) Control group
Wherein Ct is the threshold cycle number, which refers to the number of cycles that each fluorescent signal in the reaction tube experiences when reaching a set threshold during the PCR cycle; ct is (Ct) Purpose(s) Indicating that the primers are each set of threshold cycle numbers except ACTB; ct is (Ct) Internal reference Each set of threshold cycle numbers representing the primer ACTB; (Ct) Purpose(s) -Ct Internal reference ) The experimental group represents the difference between the number of threshold cycles corresponding to a specific primer (except ACTB) and the number of threshold cycles corresponding to ACTB in the administration group; (Ct) Purpose(s) -Ct Internal reference ) The control group represents the difference between the threshold cycle number corresponding to the specific primer (excluding ACTB) and the threshold cycle number corresponding to ACTB of the blank control group; ΔΔct represents the difference in the number of threshold cycles of the experimental group relative to the blank control group.
The results are shown in FIGS. 1-3.
From FIGS. 1-3, it can be seen that compounds according to the invention promote the expression levels of mRNA for IFN- β (relative interferon- β), CXCL10 (relative chemokine ligand 10), IL-6 (relative interleukin-6) in human THP cells.
The above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same. While the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those skilled in the art that the foregoing embodiments may be modified and equivalents substituted for some or all of the features thereof without departing from the spirit and scope of the invention; such modifications and substitutions are intended to be within the scope of the following claims.

Claims (10)

1. A compound, a pharmaceutically acceptable salt thereof, or an enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof, wherein the compound is selected from formula I and formula II:
Figure FDA0003972448140000011
wherein:
w is selected from O or NH;
x is selected from O, S, -n=c (R 4 ) -or-C (R) 5 )＝C(R 6 )-；
R 1 Selected from-C (O) OR 7 、-C(O)NHR 8 Cyano, 3-8 membered heterocyclyl containing 1-3 heteroatoms selected from N, O, S, C6-C10 aryl, 3-10 membered heteroaryl containing 1-3 heteroatoms selected from N, O, S,
Figure FDA0003972448140000012
R 2 、R 3 、R 4 、R 5 And R is 6 Each independently selected from: H. d, halogen, hydroxy, amino, carboxy, C1-C6 alkyl, C3-C8 cycloalkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl, C6-C10 aryl; wherein the substituted substituent is selected from the group consisting of C1-C6 alkyl, C3-C8 cycloalkyl;
alternatively, R 2 And R is R 3 Together with the carbon atoms to which they are attached form a saturated or unsaturated 5-6 membered ring, in particular a benzene ring;
alternatively, R 3 And R is R 4 Or R is 6 Together with the carbon atoms to which they are attached form a saturated or unsaturated 5-6 membered ring, in particular a benzene ring;
R 7 and R is 8 Each independently selected from: H. d, C1C 1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, C6-C10 aryl, 3-8 membered heterocyclyl containing 1-3 heteroatoms selected from N, O, S, 3-10 membered heteroaryl containing 1-3 heteroatoms selected from N, O, S, benzyl unsubstituted or substituted by C1-C6 alkoxy, carboxy;
n is 0,1;
X 1 and X 2 Each independently selected from CR 9 、N；
X 3 Selected from S, N = N, O, NH;
R 9 selected from H, D, halogen, hydroxy, amino, carboxy, C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C3-C8 cycloalkoxy, C1-C6 haloalkyl;
the A ring is selected from substituted or unsubstituted C3-12 cycloalkyl, substituted or unsubstituted heterocyclyl containing 1-5 heteroatoms selected from N, O, S, substituted or unsubstituted C6-C14 aryl, substituted or unsubstituted heteroaryl containing 1-5 heteroatoms N, O, S, pyridazinonyl; wherein the substituted substituents are selected from one or more of the following groups: H. d, halogen, hydroxy, amino, carboxy, C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl, C1-C6 alkylamino, hydroxymethyl, CH 3 -(C＝O)-。
2. The compound, pharmaceutically acceptable salt thereof, or enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof according to claim 1, wherein,
n=0, the a ring is selected from the following structures:
Figure FDA0003972448140000021
wherein:
W 1 、W 2 and W is 3 Each independently selected from CR b Or NR (NR) c ；
R a And R is b Each independently selected from H, D, halogen, hydroxy, amino, carboxy, C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C3-C8 cycloalkoxy, C1-C6 haloalkyl, -CH 2 OH、CH 3 -(C＝O)-；
R c Is absent or selected from H, D, halogen, hydroxy, amino, carboxy, C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl, -CH 2 OH、CH 3 -(C＝O)-；
Preferably, in formula I, the a ring is selected from the following structures:
Figure FDA0003972448140000022
Figure FDA0003972448140000031
wherein R is 1a 、R 1b 、R 1c 、R 2a 、R 2b 、R 2c 、R 3a 、R 3b 、R 3c 、R 3d 、R 4a 、R 4b 、R 4c 、R 5a 、R 5b 、R 5c 、R 6a 、R 6b 、R 6c 、R 6d Each independently selected from H, D, halogen, C1-C6 alkyl, C3-C8 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl, -NH 2 、-OH、-CH 2 OH、CH 3 -(C＝O)-；
Y is selected from O, S or NH.
3. The compound, pharmaceutically acceptable salt thereof, or enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof according to claim 1 or 2, wherein,
the compound of formula I is selected from formula I-1 or formula I-2,
Figure FDA0003972448140000032
the compound of formula II is selected from formula II-1 or formula II-2,
Figure FDA0003972448140000033
therein, X, R 1 、R 2 、R 3 N is defined as the corresponding claim;
the A1 ring is selected from
Figure FDA0003972448140000034
Figure FDA0003972448140000041
A2 ring is selected from
Figure FDA0003972448140000042
/>
Figure FDA0003972448140000043
Wherein R is 1a 、R 1b 、R 1c 、R 2a 、R 2b 、R 2c 、R 3a 、R 3b 、R 3c 、R 3d 、R 4a 、R 4b 、R 4c 、R 5a 、R 5b 、R 5c 、R 6a 、R 6b 、R 6c 、R 6d Each independently selected from H, halogen, C1-C6 alkyl, C2-C6 alkenyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl, -NH 2 、-OH、-CH 2 OH、CH 3 -(C＝O)-；
Y is selected from O, S or NH.
4. The compound, pharmaceutically acceptable salt thereof, or enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof according to claim 3, wherein,
the compound of the formula I-1 is a compound of the formula I-1A,
Figure FDA0003972448140000051
wherein:
R 1 is-C (O) OR 7 ；
R 3 And R is 6 Each independently selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl; or R is 3 And R is 6 Together with the carbon atoms to which they are attached form a saturated or unsaturated 5-6 membered ring, in particular a benzene ring;
R 7 selected from H, C1-C6 alkyl;
the definition of n, A1 ring is as the corresponding claim;
the compound of the formula I-2 is a compound of the formula I-2A,
Figure FDA0003972448140000052
wherein:
R 1 is-C (O) OR 7 ；
R 3 And R is 6 Each independently selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl; or R is 3 And R is 6 Together with the carbon atoms to which they are attached form a saturated or unsaturated 5-6 membered ring, in particular a benzene ring;
R 7 selected from H, C1-C6 alkyl;
the definition of n and A2 rings is as defined in the corresponding claims;
the compound of the formula II-1 is a compound of the formula II-1A, a compound of the formula II-1B or a compound of the formula II-1C,
Figure FDA0003972448140000061
Wherein: r is R 1 is-C (O) OR 7 ；
R 2 、R 3 、R 4 Each independently selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkynyl, cyano, C1-C6 alkoxy, C1-C6 haloalkyl; or R is 2 And R is 3 Together with the carbon atoms to which they are attached form a saturated or unsaturated 5-6 membered ring, in particular a benzene ring or cyclohexane;
R 7 selected from H, C1-C6 alkyl;
n，A 1 the ring is defined as in the corresponding claim.
5. The compound, pharmaceutically acceptable salt thereof, or enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof according to claim 4, wherein,
the A1 ring is selected from the following structures:
Figure FDA0003972448140000062
Figure FDA0003972448140000071
Figure FDA0003972448140000072
and/or
The A2 ring is selected from the following structures:
Figure FDA0003972448140000073
6. the compound, pharmaceutically acceptable salt thereof, or enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof according to claim 1, wherein the compound of formula I or II is selected from the following compounds:
Figure FDA0003972448140000074
/>
Figure FDA0003972448140000081
/>
Figure FDA0003972448140000091
/>
Figure FDA0003972448140000101
/>
Figure FDA0003972448140000111
/>
Figure FDA0003972448140000121
/>
Figure FDA0003972448140000131
/>
Figure FDA0003972448140000141
/>
Figure FDA0003972448140000151
/>
Figure FDA0003972448140000161
。
7. a process for the preparation of a compound as claimed in any one of claims 1 to 6, which is one of the following processes:
method 1:
Figure FDA0003972448140000162
the ester compound M1 and the borate compound M2 are subjected to a suzuki coupling reaction to obtain an intermediate M3, then the intermediate M3 is hydrolyzed to obtain a carboxylic acid compound M4, and the carboxylic acid compound M4 is further subjected to a condensation reaction with M5 or is hydrolyzed to obtain a compound of the formula I after condensation;
Method 2:
Figure FDA0003972448140000163
ester compound M1 and amine compound M 2 ' or M 2 Intermediate M obtained by nucleophilic substitution reaction 3 ' hydrolysis to give M 4 ' further carrying out condensation reaction with M5 or hydrolyzing after condensation to obtain a compound shown in a formula I;
method 3:
Figure FDA0003972448140000171
reacting carboxylic acid compound M1a with oxalyl chloride to obtain acyl chloride M2a, then reacting with amine compound M5 to obtain M3a, performing suzuki coupling reaction on M3a and boric acid ester compound M2, or performing nucleophilic substitution reaction on M2 'and M2' of amine compound to obtain compound of formula I, or performing one-step hydrolysis reaction to obtain compound of formula I;
method 4:
Figure FDA0003972448140000172
reacting a compound M2-1 with trimethylethynyl silicon M2-2 to obtain a compound M2-3, performing cycloaddition reaction on a deprotected compound M2-4 and a compound M2-5 to obtain a compound M2-6, hydrolyzing the compound M2-6 to obtain a compound M2-7, condensing the compound M2-7 and the compound M5 to obtain a compound of formula I, or performing one-step hydrolysis reaction to obtain a compound of formula I;
or M5 in any of the above methods 1-4 is replaced with
Figure FDA0003972448140000173
Obtaining a compound of formula II;
wherein R is 1 、R 2 、R 3 、X、X 1 、X 2 、X 3 、W、W 1 、W 2 、W 3 、R a The definition of the n and A rings is as defined in the corresponding claims.
8. A pharmaceutical composition comprising a compound of any one of claims 1-6, a pharmaceutically acceptable salt thereof, or an enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof, and a pharmaceutically acceptable adjuvant.
9. Use of a compound according to any one of claims 1 to 6, a pharmaceutically acceptable salt thereof, or an enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof, or a pharmaceutical composition according to claim 8, for the preparation of a STING agonist.
10. Use of a compound according to any one of claims 1-6, a pharmaceutically acceptable salt thereof, or an enantiomer, diastereomer, tautomer, solvate, polymorph or prodrug thereof, or a pharmaceutical composition according to claim 8, for the manufacture of a medicament for the treatment of STING protein-dependent disorders, in particular for the treatment of tumors, viral infections, immune disorders and inflammatory disorders;
in particular, the tumor is selected from: non-small cell lung cancer, lung adenocarcinoma, lung squamous carcinoma, breast cancer, prostate cancer, liver cancer, skin cancer, stomach cancer, intestinal cancer, bile duct cancer, brain cancer, leukemia, lymphoma, fibroma, sarcoma, basal cell carcinoma, glioma, renal cancer, melanoma, bone cancer, thyroid cancer, nasopharyngeal cancer, pancreatic cancer;
the immune and inflammatory diseases are selected from: rejection of transplanted organs, gout, rhinitis, hair loss, alzheimer's disease, appendicitis, atherosclerosis, asthma, arthritis, allergic dermatitis, behcet's disease, bullous skin disease, cholecystitis, chronic idiopathic thrombocytopenic purpura, chronic obstructive pulmonary disease, cirrhosis, degenerative joint disease, dermatitis, dermatomyositis, wet , enteritis, encephalitis, gastritis, nephritis, hashimoto's thyroiditis, hepatitis, pituitary, inflammatory bowel disease, irritable bowel syndrome, kawasaki disease, meningitis, multiple sclerosis, myocarditis, myasthenia gravis, mycosis fungoides, myositis, nephritis, osteomyelitis, pancreatitis, parkinson's disease, pericarditis, pernicious anemia, pneumonia, primary biliary sclerosing cholangitis, polyarteritis nodosa, psoriasis, fibrosis, lupus erythematosus, tissue graft rejection, thyroiditis, type I diabetes, uveitis, vasculitis, vitiligo, waldenstrom's macroglobulinemia.
CN202211524229.6A 2021-12-07 2022-11-30 STING small molecule agonist, preparation method and application thereof Pending CN116239574A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202111483112 2021-12-07
CN2021114831123 2021-12-07

Publications (1)

Publication Number Publication Date
CN116239574A true CN116239574A (en) 2023-06-09

Family

ID=86631979

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211524229.6A Pending CN116239574A (en) 2021-12-07 2022-11-30 STING small molecule agonist, preparation method and application thereof

Country Status (2)

Country Link
CN (1) CN116239574A (en)
WO (1) WO2023103850A1 (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2470183B1 (en) * 2009-08-26 2015-09-16 Merck Sharp & Dohme Corp. Heterocyclic amide compounds as protein kinase inhibitors
MX2020008771A (en) * 2018-02-21 2020-11-13 Scripps Research Inst Agonists of stimulator of interferon genes sting.
JP7485399B2 (en) * 2019-08-21 2024-05-16 ザ スクリプス リサーチ インスティテュート Monocyclic agonists of stimulator of interferon genes (STING)

Also Published As

Publication number Publication date
WO2023103850A1 (en) 2023-06-15

Similar Documents

Publication Publication Date Title
TWI817189B (en) Bicyclic heterocycles as fgfr4 inhibitors
CA3015484A1 (en) Novel condensed pyrimidine compound or salt thereof
JP5415403B2 (en) 9- (pyrazol-3-yl) -9H-purin-2-amine and 3- (pyrazol-3-yl) -3H-imidazo [4,5-B] pyridin-5-amine derivatives and for the treatment of cancer Their use of
CN109745321B (en) Pharmaceutical composition comprising FGFR4 inhibitor
CN111393404B (en) Benzothiophene compounds, and pharmaceutical composition and application thereof
CN111171049B (en) Tyrosine kinase inhibitors and uses thereof
CA2885392A1 (en) Novel bi-ring phenyl-pyridines/pyrazines for the treatment of cancer
WO2018171602A1 (en) Urea compound as dual inhibitor of ido and tdo
JP2021501215A (en) Amino-substituted nitrogen-containing condensed ring compound, its preparation method and use
CN112194659A (en) Alkyne derivative and preparation method and application thereof
WO2022218247A1 (en) Deuterated compound as cdk4/6 inhibitor
CN110461849B (en) CSF1R inhibitor and preparation method and application thereof
CN110857300A (en) Condensed ring triazole compounds, preparation method and application
CN114181208A (en) Tricyclic AhR inhibitor and application thereof
CN113366008B (en) CD73 inhibitor, preparation method and application thereof
EP3978500B1 (en) Process for the preparation of tricyclic pi3k inhibitor compounds
CN116239574A (en) STING small molecule agonist, preparation method and application thereof
CN111836819A (en) Arylamine-substituted pyrrolopyrimidine compound, and preparation method and application thereof
CN115698005B (en) Fused ring AhR inhibitors
CN110283174B (en) PI3K delta inhibitor and application thereof
TWI794576B (en) A class of fluorine-substituted benzothiophene compounds and their pharmaceutical compositions and applications
WO2022052924A1 (en) Preparation method for class of nitrogen-containing fused ring compounds and use thereof
CN115433207A (en) Macrocyclic heterocyclic compound as EGFR inhibitor and application thereof
CN116867779A (en) KRAS inhibitors for cancer treatment
EP3036227B1 (en) Process for preparing a compound

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination