CN116218873A

CN116218873A - Method for imparting 2, 4-D-butyric acid resistance to plants

Info

Publication number: CN116218873A
Application number: CN202310094040.6A
Authority: CN
Inventors: 王飞; 王丽梅; 王琪琪
Original assignee: Shandong Shunfeng Biotechnology Co Ltd
Current assignee: Shandong Shunfeng Biotechnology Co Ltd
Priority date: 2022-02-18
Filing date: 2023-02-06
Publication date: 2023-06-06

Abstract

The present invention provides a method for imparting/enhancing resistance/tolerance to herbicide 2, 4-D-butyric acid to plants, and in particular, the present invention provides a method for imparting/enhancing resistance/tolerance to herbicide 2, 4-D-butyric acid to plants by inhibiting the expression level or activity of ABCD gene or encoded protein thereof. The present invention for the first time has found that inhibiting the expression of the ABCD2 gene or its encoded protein enhances the resistance/tolerance of plants to the herbicide 2, 4-d butyric acid.

Description

Method for imparting 2, 4-D-butyric acid resistance to plants

Technical Field

The invention belongs to the field of biotechnology and crop genetic breeding, and particularly relates to a method for endowing/enhancing the resistance/tolerance of plants to herbicide 2, 4-D-butyric acid.

Background

In the agricultural production process, weeds can fight against crops and spread some plant diseases and insect pests. The yield and quality of crops are seriously affected, and the economic loss is directly caused. The conventional method for manually removing weeds consumes a lot of labor and has low weeding efficiency. With the advent of herbicides, the use of chemical methods to remove weeds has become an integral step in modern agricultural processes.

Herbicides are synthetic chemicals used to kill and control weed growth. Herbicides can be classified into growth regulators, photosynthesis inhibitors, amino acid biosynthesis inhibitors, fat biosynthesis inhibitors, cell division inhibitors according to the mechanism of action of the herbicide.

2, 4-D-butyric acid, also called 2, 4-D-butyric acid and 2,4-DB, is a phenoxy carboxylic acid hormone type selective herbicide, and is mainly used for preventing and controlling annual broadleaf weeds, cyperaceous weeds and other dicotyledonous weeds in paddy fields. 2,4-D butyric acid is not toxic to plants per se, but is transported to peroxisomes by means of ABCD transporter, and is subjected to beta oxidation in plants to generate 2,4-D with strong herbicidal activity. The transformation capacity varies due to the difference in beta oxidase activity in different plants. For example, rice has low beta oxidase activity in vivo, and can not metabolize 2,4-D butyric acid into 2,4-D, so that the rice cannot be damaged; while some weeds have high beta-oxidase activity and can metabolize 2, 4-D-butyric acid into 2,4-D, so that the weeds are killed.

2, 4-D-butyl ester, 2,4-D, is a herbicide for regulating growth, and is widely used in wheat field and corn field for removing dicotyledonous weeds. The growth regulator has the characteristics of promoting growth at low concentration and inhibiting growth at high concentration, and in addition, dicotyledonous plants and monocotyledonous plants have different sensitivity to the growth regulator, and dicotyledonous plants have higher sensitivity to the growth regulator, so that the 2, 4-drop of the herbicide with the growth regulator is sprayed in the monocotyledonous plants She Nongtian to effectively remove broadleaf weeds without affecting the plants.

The gene editing technology is used for knocking out key enzymes, key genes and gene families in the Arabidopsis fatty acid beta oxidation pathway to inhibit the Arabidopsis fatty acid beta oxidation pathway, so as to find the resistance site of Arabidopsis 2, 4-D butyric acid. In arabidopsis, genes encoding ABCD molecular transporter proteins comprise an ABCD1 gene and an ABCD2 gene, specific sites of the two ABCD transporter genes are knocked out respectively, and the two genes are knocked out simultaneously to obtain the arabidopsis with herbicide 2, 4-dibutyrate resistance.

Disclosure of Invention

The object of the present invention is to provide a method for conferring/enhancing the resistance/tolerance of plants to the herbicide 2, 4-d-butyric acid.

In one aspect, the present invention provides a method of conferring/enhancing resistance/tolerance to the herbicide 2, 4-d-butyric acid in a plant, said method comprising any one or more of the steps of the group consisting of:

(a) Reducing or inhibiting the expression level of the ABCD2 gene in said plant;

(b) Reducing or inhibiting the expression level and/or activity of a protein encoded by the ABCD2 gene in said plant.

In another preferred embodiment, the method further comprises any one or more steps of the group consisting of:

(c) Reducing or inhibiting the expression level of the ABCD1 gene in said plant;

(d) Reducing or inhibiting the expression level and/or activity of a protein encoded by the ABCD1 gene in said plant.

In another preferred example, the plant comprises a crop, a forestry plant, a vegetable, a melon, a flower, a pasture (including turf grass).

In another preferred embodiment, the plant comprises a monocot and a dicot; preferably, the plant is a dicot.

In another preferred embodiment, the plant is derived from one or more plants selected from the group consisting of: plants of Brassicaceae, gramineae, leguminosae, solanaceae, cucurbitaceae, chenopodiaceae, polygonaceae, pedaliaceae, compositae, malvaceae, rosaceae, pedaliaceae, convolvulaceae, dioscoreaceae, umbelliferae, liliaceae, zingiberaceae, etc.

In another preferred embodiment, the plant is derived from one or more plants selected from the group consisting of: arabidopsis, rice, tobacco, tomato, potato, corn, cotton, soybean, alfalfa, sorghum, barley, wheat, millet, sweet potato, quinoa, lettuce, rape, cabbage, spinach, beet, peanut, watermelon, cabbage, strawberry, or a combination thereof.

In another preferred embodiment, the plant is selected from the group consisting of Arabidopsis, rice, tobacco, tomato, potato, maize, cotton, soybean, peanut.

In another preferred embodiment, the amino acid sequence of ABCD2 has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity as compared to SEQ ID No. 1.

In another preferred embodiment, the amino acid sequence of ABCD1 has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity as compared to SEQ ID No. 2.

In another preferred example, the ABCD2 gene comprises cotton gene LOC107946680 (Genbank), or potato gene LOC102581284 (Genbank), or tobacco gene LOC107798686 (Genbank), or tomato gene 101256258 (Genbank), or peanut LOC107458888 (Genbank).

In another preferred example, the ABCD1 gene includes cotton gene LOC107913671 (Genbank), or cotton gene LOC107945455 (Genbank), or cotton gene LOC107925489 (Genbank), or cotton gene LOC107946680 (Genbank), or potato gene LOC102587630 (Genbank), or potato gene LOC102581284 (Genbank), or potato gene LOC102601060 (Genbank), or potato gene 102577604 (Genbank), or tobacco gene LOC107770907 (Genbank), or tobacco gene 107801433 (Genbank), or tobacco gene LOC107801232 (Genbank), or tobacco gene LOC107798686 (Genbank), or floral tobacco gene LOC104217649 (Genbank), or floral tobacco gene 104230823 (Genbank), or tomato gene 101260717 (Genbank), or tomato gene 101256258 (Genbank), or gene 101247740 (Genbank), or tomato gene 102577604 (Genbank), or tobacco gene LOC 3272 (Genbank), or peanut gene 7472 (Genbank), or peanut gene (LOC 112783718 (Genbank), or peanut gene (LOC).

In one embodiment, said reducing or inhibiting the expression and/or activity of the ABCD2 gene or a protein thereof is accomplished by homozygous mutation of the ABCD2 gene, i.e., both alleles of said ABCD2 gene are mutated; preferably, the mutation results in complete or partial loss of ABCD2 function; preferably, the mutation results in a complete loss of ABCD2 function; preferably, the mutation is 1 base after insertion of the nucleotide sequence of the ABCD2 gene relative to the 319 th base of SEQ ID NO.3 (editing strain beta 7-305); preferably, the mutation is 1 base after insertion of the nucleotide sequence of the ABCD2 gene relative to the 2700 th base of SEQ ID NO.3 (editing strain β8-337); preferably, the mutation is 1 base after insertion of the nucleotide sequence of the ABCD2 gene relative to the 2699 th base of SEQ ID NO.3 (editing strain β8-347); preferably, the mutation is a deletion of 10 bases at positions 2690-2699 relative to SEQ ID NO.3 of the nucleotide sequence of the ABCD2 gene (editing line β8-360); preferably, the mutation is a deletion of 29 bases at positions 2674-2702 relative to SEQ ID NO.3 of the nucleotide sequence of the ABCD2 gene (editing line. Beta.8-3-1).

In one embodiment, said reducing or inhibiting the expression and/or activity of the ABCD1 gene or a protein thereof is accomplished by homozygous mutation of the ABCD1 gene, i.e., both alleles of said ABCD1 gene are mutated; preferably, the mutation results in complete or partial loss of ABCD1 function; preferably, the mutation results in a complete loss of ABCD1 function; preferably, the mutation is a deletion of 33 bases at positions 1023-1055 relative to SEQ ID NO.4 of the nucleotide sequence of the ABCD1 gene (editing line. Beta.5-115); preferably, the mutation is such that the nucleotide sequence of the ABCD1 gene is inserted 30 bases after the 1022 th base of SEQ ID NO.4, then 19 bases 1023 to 1041 are deleted, then 1 base is inserted after 1046 and SNP mutation is generated between 1049 base and 1053 base (editing strain. Beta.5 to 108).

In one embodiment, said reducing or inhibiting the expression and/or activity of the ABCD1 gene or a protein thereof is accomplished by heterozygous mutation of the ABCD1 gene, i.e., the 1 allele of ABCD1 is wild-type and the other 1 allele of ABCD1 is mutated; preferably, the mutation results in complete or partial loss of ABCD1 function; preferably, the mutation is 28 bases of 1001-1028 deleted from the nucleotide sequence of the ABCD1 gene relative to SEQ ID NO.4 (editing strain. Beta.5-2-4); preferably, the mutation is that the nucleotide sequence of the ABCD1 gene is inserted with 3 bases and then deleted by 9 bases (editing strain beta 6-204) after the 7357 th base of SEQ ID NO. 4; preferably, the mutation is one base (editing strain β6-186) inserted after the nucleotide sequence of the ABCD1 gene is opposite to base 7358 of SEQ ID No. 4; preferably, the mutation is a deletion of 6 bases at positions 7355-7360 (edited strain β6-197) of the nucleotide sequence of the ABCD1 gene relative to SEQ ID NO. 4.

In one embodiment, the reducing or inhibiting expression and/or activity of the ABCD2 and ABCD1 genes or proteins thereof is accomplished by heterozygous mutation of the ABCD2 and ABCD1 genes. That is, both the ABCD2 and ABCD1 genes are heterozygous mutations; or the ABCD2 gene is a heterozygous mutation and the ABCD1 gene is a homozygous mutation; or the ABCD2 gene is a homozygous mutation and the ABCD1 gene is a heterozygous mutation. Preferably, the mutation results in complete or partial loss of ABCD2 and ABCD1 function; preferably, the mutation is such that the nucleotide sequence of the ABCD2 gene is deleted by 16 bases at 2687-2702 relative to SEQ ID NO.3, while the nucleotide sequence of the ABCD1 gene is inserted by 1 base after the 1022 base relative to SEQ ID NO.4 (editing line 2021-1-8); preferably, the mutation is such that the nucleotide sequence of the ABCD2 gene is deleted at 2699 th base relative to SEQ ID NO.3, while the nucleotide sequence of the ABCD1 gene is deleted at 8 th bases from 1023 to 1030 th base relative to SEQ ID NO.4, (editing line 2021-6-2); preferably, the mutation is such that the nucleotide sequence of the ABCD2 gene is deleted at position 2699 relative to SEQ ID NO.4, while the nucleotide sequence of the ABCD1 gene is deleted at position 1023-1053 of 31 relative to SEQ ID NO.4 (editing line 2021-6-1); preferably, the mutation is such that the nucleotide sequence of the ABCD2 gene is deleted by 27 bases at positions 2699-2725 relative to SEQ ID NO.4, while the nucleotide sequence of the ABCD1 gene is inserted by 1 base relative to position 1022 of SEQ ID NO.4 (editing line 2021-4-1); preferably, the mutation is such that the nucleotide sequence of the ABCD2 gene is deleted at positions 2674-2702 with respect to SEQ ID NO.4, while the nucleotide sequence of the ABCD1 gene is deleted at positions 1023-1027 with respect to SEQ ID NO.4 at 5 bases (editing line 2021-4-5).

In another preferred embodiment, said decreasing or inhibiting means that the expression level E1 of the ABCD2 gene or the encoded protein thereof in said plant is 0-80%, preferably 0-60%, more preferably 0-40%, more preferably 0-30% of the wild type compared to the expression level E0 of the ABCD2 gene or the encoded protein thereof in a wild type plant.

In another preferred embodiment, said decreasing or inhibiting means that the expression level E1 of the ABCD1 gene or the encoded protein thereof in said plant is 0-80%, preferably 0-60%, more preferably 0-40%, more preferably 0-30% of the wild type compared to the expression level E0 of the ABCD1 gene or the encoded protein thereof in a wild type plant.

In another preferred embodiment, said reducing or inhibiting the expression and/or activity of the ABCD2 gene or a protein thereof is accomplished by a method selected from the group consisting of: gene mutation, gene knockout, gene disruption, RNA interference, gene editing techniques, inhibitors of the introduced gene or protein.

In another preferred embodiment, said reducing or inhibiting the expression and/or activity of the ABCD1 gene or a protein thereof is accomplished by a method selected from the group consisting of: gene mutation, gene knockout, gene disruption, RNA interference, gene editing techniques, inhibitors of the introduced gene or protein.

In another preferred embodiment, the genetic mutation is obtained by one or more of the following methods: natural mutation, physical mutagenesis (e.g., ultraviolet mutagenesis, X-ray or Y-ray mutagenesis), chemical mutagenesis (e.g., nitrous acid, hydroxylamine, EMS, nitrosoguanidine, etc.), biological mutagenesis (e.g., virus or bacteria mediated mutagenesis), gene editing, or biosynthesis.

In another preferred embodiment, the mutated region comprises an exon and/or an intron region.

In one embodiment, the above method comprises the steps of:

(1) Providing an agrobacterium carrying an expression vector comprising a sequence targeting the ABCD2 gene and/or the ABCD1 gene;

(2) Contacting plant cells, plant tissue, plant parts with the agrobacterium of step (1);

(3) Screening plant cells, plant tissues, plant parts in which the expression of the ABCD2 gene and/or ABCD1 gene is inhibited.

In another preferred embodiment, the gene editing technique is selected from the group consisting of: CRISPR technology, TALEN technology, ZFN technology, or a combination thereof.

Preferably, the gene editing enzyme of the gene editing technology is Cas protein, also known as CRISPR enzyme or Cas effector protein, the kinds of which include but are not limited to: cas9 protein, cas12 protein, cas13 protein, cas14 protein, csm1 protein, FDK1 protein, MAD protein.

In one embodiment, the gene editing enzyme is a Cas9 protein, and the method further comprises a Scaffold sequence that can specifically bind to the Cas9 protein. The Scaffold sequence, when operably linked to a guide sequence, forms a guide sequence (gRNA). Preferably, the gRNA is operably linked to a second regulatory element.

Such regulatory elements include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcriptional termination signals, such as polyadenylation signals and polyU sequences).

In one embodiment, the editing vector further comprises a resistance gene for ease of screening, including hyg, bar, kana, rif, spec, amp, which resistance gene is well known to those skilled in the art.

In another preferred embodiment, the ABCD2 gene or the plant having an inhibited expression level and/or activity of a protein encoded by the ABCD2 gene has a maximum tolerance to the herbicide 2, 4-d butyric acid of at least 1.1 fold, preferably at least 2 fold, preferably at least 3 fold, preferably at least 4 fold, preferably at least 5 fold, preferably at least 6 fold, preferably at least 10 fold, as compared to a wild type plant.

In another preferred embodiment, the ABCD1 gene or the plant having an inhibited expression level and/or activity of a protein encoded by the ABCD1 gene has a maximum tolerance to the herbicide 2, 4-d butyric acid of at least 1.1 fold, preferably at least 2 fold, preferably at least 3 fold, preferably at least 4 fold, preferably at least 5 fold, preferably at least 6 fold, preferably at least 10 fold, as compared to a wild type plant.

In another aspect, the present invention provides a composition, complex or carrier system for conferring/enhancing resistance/tolerance to the herbicide 2, 4-D-butyric acid in a plant, said composition, complex or carrier system being for reducing or inhibiting the expression level of the ABCD2 gene in said plant, or reducing or inhibiting the expression level and/or activity of a protein encoded by the ABCD2 gene in said plant.

In another preferred embodiment, the composition, complex or vector system is further used to reduce or inhibit the expression level of the ABCD1 gene in the plant, or to reduce or inhibit the expression level and/or activity of a protein encoded by the ABCD1 gene in the plant.

In another preferred embodiment, the composition comprises:

(a) An ABCD2 gene or an inhibitor of a protein encoded by the ABCD2 gene;

(b) An agronomically acceptable carrier.

In another preferred embodiment, the composition comprises:

(a) An inhibitor of the ABCD1 gene or a protein encoded by the ABCD1 gene;

(b) An agronomically acceptable carrier.

In another preferred embodiment, the composition further comprises other substances capable of reducing or inhibiting the expression level of the ABCD2 gene in the plant or reducing or inhibiting the expression level and/or activity of a protein encoded by the ABCD2 gene in the plant.

In another preferred embodiment, the composition further comprises other substances capable of reducing or inhibiting the expression level of the ABCD1 gene in the plant or reducing or inhibiting the expression level and/or activity of a protein encoded by the ABCD1 gene in the plant.

In another preferred embodiment, the amino acid sequence of ABCD2 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity as compared to SEQ ID No. 1.

In another preferred embodiment, the amino acid sequence of ABCD1 has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity as compared to SEQ ID No. 2.

In another preferred embodiment, the use of the composition, complex or carrier system in the preparation of a reagent or kit for conferring/enhancing resistance/tolerance to the herbicide 2, 4-d butyric acid in plants.

In another preferred embodiment, the composition, complex or carrier system is used to confer/enhance the resistance/tolerance of plants to the herbicide 2, 4-d-butyric acid.

In another preferred embodiment, the ABCD2 gene or the plant having suppressed expression level and/or activity of the protein encoded by the ABCD2 gene has an increase in tolerance to the maximum herbicide 2, 4-d butyric acid of at least 1.1-fold, preferably at least 2-fold, preferably at least 3-fold, preferably at least 4-fold, preferably at least 5-fold, preferably at least 6-fold, preferably at least 10-fold, as compared to wild type plants.

In another preferred embodiment, the ABCD1 gene or the plant having suppressed expression level and/or activity of the protein encoded by the ABCD1 gene has an increase in tolerance to the maximum herbicide 2, 4-d butyric acid of at least 1.1-fold, preferably at least 2-fold, preferably at least 3-fold, preferably at least 4-fold, preferably at least 5-fold, preferably at least 6-fold, preferably at least 10-fold, as compared to wild type plants.

In one embodiment, the vector comprises an expression vector, a shuttle vector, an integration vector.

The vector may be of the plasmid, viral, cosmid, phage, etc. type, which are well known to those skilled in the art.

In another preferred embodiment, the carrier system comprises any one or a combination of the following: pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, uppsala, sweden), GEM1 (Promega Biotec, madison, WI, USA) pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174pBluescript II KS, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia).

In another aspect, the present invention provides a method of preparing a plant cell, or plant tissue, or plant part, or plant that is resistant/tolerant to the herbicide 2, 4-D-butyric acid, said method comprising the step of reducing or inhibiting the expression level of the ABCD2 gene in said plant cell, or plant tissue, or plant part, or plant, or reducing or inhibiting the expression level and/or activity of a protein encoded by the ABCD2 gene in said plant cell, or plant tissue, or plant part, or plant.

In another preferred embodiment, the method further comprises reducing or inhibiting the expression level of the ABCD1 gene in the plant cell, or plant tissue, or plant part, or plant, or reducing or inhibiting the expression level and/or activity of a protein encoded by the ABCD1 gene in the plant cell, or plant tissue, or plant part, or plant.

In another aspect, the present invention provides a plant cell, or plant tissue, or plant part, or plant that is resistant to the herbicide 2, 4-d-butyrate, the plant cell, or plant tissue, or plant part, or plant being obtained by reducing or inhibiting the expression and/or activity of the ABCD2 gene or a protein encoded by the ABCD2 gene in a plant.

In another preferred embodiment, the plant cell, or plant tissue, or plant part, or plant is obtained by reducing or inhibiting the expression level and/or activity of the ABCD1 gene or a protein encoded by the ABCD1 gene in a plant.

In another preferred embodiment, the method is used to confer/enhance the resistance/tolerance of a plant to the herbicide 2, 4-D-butyric acid.

In another aspect, the present invention provides a plant that develops resistance/tolerance to the herbicide 2, 4-D-butanoic acid, said plant being propagated from a plant cell, or plant tissue, or plant part that reduces or inhibits the expression and/or activity of the ABCD21 gene or a protein encoded by the ABCD2 gene in the plant.

In another preferred embodiment, the plant is propagated from a plant cell, or plant tissue, or plant part that reduces or inhibits the expression level and/or activity of the ABCD1 gene or a protein encoded by the ABCD1 gene in the plant.

In another preferred embodiment, the plant is obtained by: regenerating the genetically engineered plant tissue, plant cells, plant parts prepared by the method into plant bodies, thereby obtaining genetically engineered plants.

In another aspect, the present invention provides a method of preparing a hybrid plant, the method comprising the step of crossing a plant obtained by propagation of a plant cell, or plant tissue, or plant part, with other plants to prepare a hybrid plant, using a plant cell, or plant tissue, or plant part, resistant/tolerant to the herbicide 2, 4-D butyric acid.

In another aspect, the present invention provides a method of controlling unwanted vegetation at a plant growing locus, the method comprising:

(1) Providing a plant with suppressed expression level and/or activity of the ABCD2 gene or a protein encoded by the ABCD2 gene at the cultivation site; preferably, plants in which the ABCD1 gene or the protein encoded by the ABCD1 gene is expressed and/or the activity is suppressed are also provided at the cultivation site.

(2) Plants are cultivated and an effective amount of the herbicide 2, 4-dibutyric acid is applied at the cultivation site.

In one embodiment, the unwanted plant is a weed.

In another aspect, the present invention also provides a method of controlling weed growth in the vicinity of a plant, comprising:

a) Providing a plant having resistance to the herbicide 2, 4-d-butyric acid as described above;

b) Applying an effective amount of a herbicide to the plant and weeds in the vicinity thereof, thereby controlling weeds in the vicinity of the plant.

In one embodiment, the herbicide 2, 4-D-butyric acid (also known as 2, 4-D-butyric acid, 2, 4-DB) has the formula:

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

General definition:

unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

The term "homology" or "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. Thus, the compositions and methods of the invention also comprise homologs of the nucleotide sequences and polypeptide sequences of the invention. "homology" may be calculated by known methods including, but not limited to: computational Molecular Biology [ computer molecular biology ] (Lesk, a.m. edit) Oxford University Press [ oxford university press ], new york (1988); biocomputing: informatics and Genome Projects [ biological operations: informatics and genome project ] (Smith, d.w. edit) Academic Press [ Academic Press ], new york (1993); computer Analysis of Sequence Data Part I [ computer analysis of sequence data, part I ] (Griffin, A.M. and Griffin, H.G. editions) Humana Press [ Humana Press ], new Jersey (1994); sequence Analysis in Molecular Biology [ sequence analysis in molecular biology ] (von Heinje, g. Edit) Academic Press [ Academic Press ] (1987); sequence Analysis Primer [ sequence analysis primer ] (Grisskov, M. And Devereux, J. Edit) Stockton Press [ Stoketon Press ], new York (1991).

The specific amino acid positions (numbering) within the proteins of the invention are determined by aligning the amino acid sequence of the protein of interest with SEQ ID No.1 or SEQ ID No.2 using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, where the sequences are considered aligned when the alignment is highest. The alignment score can be calculated as described in Wilbur, W.J. and Lipman, D.J. (1983) Rapid similarity searches ofnucleic acid and protein data banks, proc.Natl. Acad.Sci.USA, 80:726-730. Default parameters are preferably used in the ClustalW2 (1.82) algorithm: protein gap opening penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein/DNA endplay= -1; protein/DNAGAPDIST =4. The position of a particular amino acid within a protein of the invention is preferably determined by aligning the amino acid sequence of the protein with SEQ ID No.1 or SEQ ID No.2 using the AlignX program (part of the vectorNTI group) with default parameters (gap opening penalty: 10og gap extension penalty 0.05) suitable for multiple alignments.

The term "coding" refers to the inherent properties of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, as a template for the synthesis of other polymers and macromolecules in biological processes having defined nucleotide sequences (i.e., rRNA, tRNA, and mRNA) or defined amino acid sequences and the biological properties that they produce. Thus, if transcription and translation of an mRNA corresponding to the gene produces a protein in a cell or other biological system, the gene encodes the protein.

The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living bodies are composed of 20 basic amino acids.

The terms "protein," "polypeptide," and "peptide" are used interchangeably herein to refer to a polymer of amino acid residues, including polymers in which one or more amino acid residues are chemical analogs of the natural amino acid residue. The proteins and polypeptides of the invention may be produced recombinantly or by chemical synthesis.

In the present invention, amino acid residues may be represented by single letters or by three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

The term "regulatory element" is also known as a "regulatory element", as used herein, is intended to include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly U sequences), the detailed description of which may be found in goldel (Goeddel), gene expression techniques: methods of enzymology (GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY) 185, academic Press (Academic Press), san Diego (San Diego), calif. (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells as well as those sequences that direct expression of the nucleotide sequence in only certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters may primarily direct expression in a desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or specific cell types (e.g., lymphocytes). In some cases, regulatory elements may also direct expression in a time-dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue or cell type specific. In certain instances, the term "regulatory element" encompasses enhancer elements, such as WPRE; a CMV enhancer; the R-U5' fragment in the LTR of HTLV-I (mol. Cell. Biol., volume 8 (1), pages 466-472, 1988), the SV40 enhancer, and the intron sequence between

exons

2 and 3 of rabbit beta-globin (Proc. Natl. Acad. Sci. USA., volume 78 (3), pages 1527-31, 1981).

The term "promoter" has a meaning well known to those skilled in the art and refers to a non-coding nucleotide sequence located upstream of a gene that is capable of promoting expression of a downstream gene. Constitutive (constitutive) promoters are nucleotide sequences of: when operably linked to a polynucleotide encoding or defining a gene product, it results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence which, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in a cell, essentially only when an inducer corresponding to the promoter is present in the cell. Tissue specific promoters are nucleotide sequences that: when operably linked to a polynucleotide encoding or defining a gene product, it results in the production of the gene product in the cell substantially only if the cell is a cell of the tissue type to which the promoter corresponds.

The term "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein for introduction into the nucleus by nuclear transport, i.e., a protein with an NLS is transported to the nucleus. Typically, NLS contains positively charged Lys or Arg residues exposed at the protein surface. Exemplary nuclear localization sequences include, but are not limited to, NLS from: SV40 large T antigen, EGL-13, c-Myc, and TUS proteins.

The term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).

The term "vector" is intended to encompass an element that allows the vector to integrate into the host cell genome or to replicate autonomously in the cell independent of the genome. The vector may contain any element that ensures self-replication. It typically carries a gene that is not part of the central metabolism of the cell and is typically in the form of double stranded DNA. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. If a vector is used, the choice of vector will depend on methods for transforming host cells that are well known to those skilled in the art. For example, a plasmid vector may be used.

Vectors suitable for use in the present invention include plasmids available from commercial sources such as, but not limited to: pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, uppsala, sweden), GEM1 (Promega Biotec, madison, WI, USA) pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174pBluescript II KS, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, pSVL (Pharmacia) and the like.

The nucleic acid sequences, nucleic acid constructs or expression vectors of the invention may be introduced into host cells by a variety of techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid mediated gene delivery, as well as calcium phosphate transfection, DEAE-dextran mediated transfection, lipofection or electroporation, and the like.

The term "ABCD protein" refers to an ATP-binding cassette transporter (ATP binding cassette transporter). In Arabidopsis, genes encoding the ABCD protein include the ABCD1 gene and the ABCD2 gene.

The ABCD1 gene, also known as peroxisomal ABC transporter 1, acetate non-acting 2, ACN2, arabidopsis thaliana ATP-binding cassette D1, atABCD1, ATP-binding cassette D1, COMATOSE, CTS, PED3, peroxisomal ABC transporter 1, PEROXISOME DEFECTIVE3, PXA1, T5J17.20, t5j17_20, is a peroxisome protein encoding an ATP-binding cassette transporter (PMP subfamily) that has significant homology to human x-linked Adrenoleukodystrophin (ALDP). The gene product can promote germination and inhibit embryo dormancy. ABI3, ABA1, FUS3 and LEC1 have a superior effect on this gene. The fatty acyl-coa accumulated after the mutation of the gene, which indicates the defect of fatty acyl-coa uptake into peroxisome. The ABCD1 gene includes cotton gene LOC107913671 (Genbank), cotton gene LOC107945455 (Genbank), cotton gene LOC107925489 (Genbank), cotton gene LOC107946680 (Genbank), potato gene LOC102587630 (Genbank), potato gene LOC102581284 (Genbank), potato gene LOC102601060 (Genbank), potato gene 102577604 (Genbank), tobacco gene LOC107770907 (Genbank), tobacco gene 107801433 (Genbank), tobacco gene LOC107801232 (Genbank), tobacco gene LOC107798686 (Genbank), floral tobacco gene LOC104217649 (Genbank), floral tobacco gene LOC104230823 (Genbank), tomato gene 101260717 (Genbank), tomato gene 101256258 (Genbank), tomato gene 101247740 (Genbank), tomato gene 101261549 (Genbank), peanut gene LOC107631658 (Genbank), peanut gene LOC112715182 (Genbank), peanut gene LOC112783718 (Genbank), and their homologous genes. In Arabidopsis thaliana, the wild-type gene sequence of ABCD1 is shown as SEQ ID NO. 4, and the encoded amino acid sequence is shown as SEQ ID NO. 2.

The ABCD2 gene, also known as ABC transporter family protein, ATP-binding cassette D2, atPMP1, F20D21.17, f20d21_17, encodes a half-molecule transporter, the function of which is associated with the conversion of fatty acids. The ABCD2 genes include cotton gene LOC107946680 (Genbank), potato gene LOC102581284 (Genbank), tobacco gene LOC107798686 (Genbank), tomato gene 101256258 (Genbank), peanut LOC107458888 (Genbank), and other homologous genes. In Arabidopsis thaliana, the wild-type gene sequence of ABCD2 is shown as SEQ ID NO. 3, and the encoded amino acid sequence is shown as SEQ ID NO. 1.

Sources of ABCD genes include monocot or dicot plants such as the ABCD gene in arabidopsis, rice, cotton, potato, tobacco, tomato, alfalfa, soybean, peanut, or variants thereof. In a preferred embodiment, the nucleotide sequence of the ABCD gene of the invention is shown in SEQ ID NO. 3 or 4.

The ABCD gene of the invention also includes nucleic acids which have a homology of 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferably 90% or more, more preferably 95% or more, most preferably 98% or more, such as 99%, or 100%) with the preferred gene sequence of the invention (SEQ ID NO.:3 or 4), which also confers/enhances the resistance/tolerance of plants to the herbicide 2, 4-d-butyrate.

In the present invention, the nucleotide sequence of SEQ ID NO. 3 or 4 may be substituted, deleted or added in one or more ways to produce a derivative sequence of SEQ ID NO. 3 or 4, which, due to the degeneracy of the codons, even though the homology to SEQ ID NO. 3 or 4 is low, substantially encodes the amino acid sequence as shown in SEQ ID NO. 1 or 2. In addition, the meaning of "the nucleotide sequence in SEQ ID NO. 3 or 4 is substituted, deleted or added with at least one nucleotide derivative sequence" also includes a nucleotide sequence which hybridizes under moderately stringent conditions, more preferably under highly stringent conditions, with the nucleotide sequence shown in SEQ ID NO. 3 or 4. These variants include (but are not limited to): deletions, insertions and/or substitutions of several (typically 1-90, preferably 1-60, more preferably 1-20, most preferably 1-10) nucleotides, and additions of several (typically within 60, more preferably within 30, more preferably within 10, most preferably within 5) nucleotides at the 5 'and/or 3' end.

It is to be understood that although the genes provided in the examples of the present invention are derived from Arabidopsis thaliana, gene sequences derived from other similar plants that have some homology (e.g., more than 70%, such as 75%,80%,85%,90%,95%, or even 98%,99%, or 100% sequence identity) to the sequences of the present invention (preferably, the sequences are shown in SEQ ID NO: 3 or 4) are included within the scope of the present invention as long as one of skill in the art can readily isolate such sequences from other plants after reading the information provided herein. Methods and tools for aligning sequence identity are also well known in the art, such as BLAST.

The invention also includes ABCD protein fragments and analogs having ABCD protein activity. As used herein, the terms "fragment" and "analog" refer to polypeptides that retain substantially the same biological function or activity of the native ABCD proteins of the present invention.

The polypeptide fragment, derivative or analogue of the invention may be: (i) Polypeptides having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, which may or may not be encoded by the genetic code; or (ii) a polypeptide having a substituent in one or more amino acid residues; or (iii) a polypeptide formed by fusion of the mature polypeptide with another compound, such as a compound that increases the half-life of the polypeptide, e.g., polyethylene glycol; or (iv) a polypeptide (such as a leader or secretory sequence or a sequence for purifying the polypeptide or a proprotein sequence, or a fusion protein) formed by fusing an additional amino acid sequence to the polypeptide sequence. Such fragments, derivatives and analogs are within the purview of one skilled in the art in view of the definitions herein.

In the present invention, the polypeptide variants are derived sequences of the amino acid sequence shown as SEQ ID No. 1 or 2, obtained by substitution, deletion or addition of at least one amino acid by several (usually 1 to 60, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10) amino acids, and addition of one or several (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminal and/or N-terminal end. For example, in such proteins, substitution with similar or similar amino acids will not generally alter the function of the protein, nor will addition of one or more amino acids at the C-terminus and/or the terminal end.

The invention also includes analogs of the claimed proteins. These analogs may differ from the native SEQ ID No. 1 or 2 by differences in amino acid sequence, by differences in modified forms that do not affect the sequence, or by both. Analogs of these proteins include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, site-directed mutagenesis or other known biological techniques. Analogs also include analogs having residues other than the natural L-amino acid (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids). It should be understood that the proteins of the present invention are not limited to the representative proteins exemplified above.

The term "2, 4-D-butyric acid", also called 2, 4-D-butyric acid, 2,4-DB, is a phenoxy carboxylic acid hormone type selective herbicide, mainly used for preventing and controlling annual broadleaf weeds and dicotyledonous weeds such as sedge weeds in paddy fields. 2,4-D butyric acid is not toxic to plants per se, but is transported to peroxisomes by means of ABCD transporter, and is subjected to beta oxidation in plants to generate 2,4-D with strong herbicidal activity. The transformation capacity varies due to the difference in beta oxidase activity in different plants. For example, rice has low beta oxidase activity in vivo, and can not metabolize 2,4-D butyric acid into 2,4-D, so that the rice cannot be damaged; while some weeds have high beta-oxidase activity and can metabolize 2, 4-D-butyric acid into 2,4-D, so that the weeds are killed. The chemical formula of the 2,4-D butyric acid is:

As used herein, "tolerance" or "resistance" refers to the ability of a plant to withstand a herbicide under growing conditions, and can be generally characterized by parameters such as the amount or concentration of the herbicide used. Further, "enhancing the resistance/tolerance of a plant to the herbicide 2, 4-D-butyric acid" in the present invention refers to a plant whose tolerance or resistance to the herbicide 2, 4-D-butyric acid is increased compared to a plant comprising a wild parent, whose tolerance concentration is increased by at least 1.1-10 times compared to the tolerance concentration of the parent plant. The optimum degree of "tolerance" or "resistance" improvement described herein is that at an equivalent herbicide usage or concentration, unwanted plants can be reduced or inhibited or killed without affecting the growth or viability of plants containing the invention. "conferring resistance/tolerance to the herbicide 2, 4-D-butyric acid to a plant" in the present invention refers to a plant whose wild parent plant has a certain or lower tolerance to the herbicide 2, 4-D-butyric acid (at an equivalent herbicide concentration), which confers a certain degree of herbicide resistance or tolerance to a plant without resistance or increases the tolerance of a plant with a certain or lower tolerance to a herbicide by inhibiting the expression amount and/or activity of the ABCD gene or the protein encoded by the ABCD gene in a plant.

The term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant calli, plant pieces, plant embryos, pollen, ovules, seeds, leaves, stems, flowers, shoots, seedlings, fruits, kernels, ears, roots, root tips, anthers, and the like.

The term "plant cell" is understood to mean any cell from or found in a plant which is capable of forming, for example: undifferentiated tissues such as callus, differentiated tissues such as embryos, parts of plants, plants or seeds.

The term "plant" is understood to mean any differentiated multicellular organism capable of photosynthesis, including crop plants at any stage of maturity or development, in particular monocotyledonous or dicotyledonous plants, vegetable crops, including artichoke, broccoli, sesame seed, leek, asparagus, lettuce (e.g., head lettuce, leaf lettuce), cabbage (bok choy), yellow arrowroot, melons (e.g., melon, watermelon, columbian melon (crenhaw), white melon, cantaloupe), rape crops (e.g., cabbage, broccoli, chinese cabbage, kohlrabi, chinese cabbage), artichoke, carrot, cabbage (napa), okra, onion, celery, parsley, chick pea, parsnip, chicory, pepper, potato, cucurbit (e.g., zucchini, cucumber, zucchini, melon, pumpkin), radish, dried onion, turnip cabbage, purple eggplant (also known as eggplant), salon, chicory, shallot, chicory, garlic, spinach, green onion, melon, green leafy vegetables (greens), beet (sugar beet and fodder beet), sweet potato, lettuce, horseradish, tomato, turnip, spice; fruit and/or vining crops, such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, oranges, blueberries, boysenberries (boysenberries), redberries, currants, rowfruits, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwi fruits, persimmons, pomegranates, pineapple, tropical fruits, pome fruits, melons, mangoes, papaya, and litchis; field crops, such as clover, alfalfa, evening primrose, white mango, corn/maize (forage maize, sweet maize, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereal crops (barley, oat, rye, wheat, etc.), sorghum, tobacco, kapok, leguminous plants (beans, lentils, peas, soybeans), oleaginous plants (rape, mustard, poppy, olives, sunflower, coconut, castor oil plants, cocoa beans, groundnut), arabidopsis, fibrous plants (cotton, flax, hemp, jute), camphorridae (cinnamon, camphordons), or a plant such as coffee, sugar cane, tea, and natural rubber plants; and/or flower bed plants, such as flowering plants, cactus, fleshy plants and/or ornamental plants, and trees, such as forests (broadleaf and evergreen trees, e.g., conifers), fruit trees, ornamental trees, and nut-bearing trees, and shrubs and other seedlings.

The term "unwanted plants" is understood to mean plants of no practical or utility value that affect the normal growth of the desired plant (e.g., crop) and may include weeds, such as dicotyledonous and monocotyledonous weeds. Dicotyledonous weeds include, but are not limited to, weeds of the following genera: the genus Sinapis (Sinapia), lepidium (Lepidium), lagrangia, herba Polygoni Multiflori (Pallaria), matricaria (Matricaria), matricaria (Anthraria), achyranthes (Galinsoga), chenopodium (Chenopodium), urtica (Urtica), senecio (Senecio), amaranthus (Amaranthus), portulaca (Portulaca), xanthium (Xanthium), inulae (Convolvulus), sweet potato (Ipomoea), polygonum (Polygonum), sesbania (Sesbania), ragweed (Ambrosia), cirsium (Cirsium), fathomson (Carduus), sonchus (Sonchus), solanum (Ropa), artemisia (Rocarrier), matricaria (semen Sesami), lagerbera (Lagerbera), verum (Pacifica), fagus (Pacifica), pacifica (Pacifica) and Pacifica. Monocotyledonous weeds include, but are not limited to, weeds of the following genera: barnyard grass (Echinochloa), green bristlegrass (Setaria), millet (Panicum), crabgrass (Digitaria), timothy grass (Phleum), bluegrass (Poa), festuca (Festuca), eleusine (Eleusine), brachyophyllum (Brachiaria), ryegrass (Lolium), brome (Bromus), oat (Avena), cyperus (Cyperus), sorghum (Sorgum), agropyron (Agropyron), cynodon (Cynodon), yujia (Monochoria), fimbristylis (Papileus), sagittaria (Sagittaria), eleocharus (Sceochatis), scirpus (Scirpus), barnyard grass (Patarum), praecox (Chachium), danocarpus (Sphaeus), danocarpus (Apriopsis), and Agrocarpus (Apriona). The unwanted plants may also include other plants than the plant to be cultivated, such as crops such as parts or small amounts of soybeans that naturally grow in rice cultivation.

The term "gene editing" technology includes CRISPR technology, TALEN technology, ZFN technology. CRISPR technology refers to clustered, regularly interspaced short palindromic repeats (Clustered regularly interspaced short palindromic repeats) from the immune system of a microorganism. Wherein the gene editing tool comprises a guide rna, a Cas protein (e.g., cas9, cpf1, cas12b, etc.). The gene editing tools referred to in TALEN technology are restriction enzymes that can cleave specific DNA sequences, comprising a TAL effector DNA binding domain and a DNA cleavage domain. The gene editing tools referred to in ZFN technology are also restriction enzymes that can cleave specific DNA sequences, including a zinc finger DNA binding domain and a DNA cleavage domain. It is well known to those skilled in the art that editing of the genome in a cell can be accomplished by constructing nucleotides encoding gene editing tools and other regulatory elements in appropriate vectors, and then transforming the cell, and the types of editing include gene knockout, insertion, and base editing.

As used herein, the term "gene editing enzyme" refers to nucleases suitable for use in editing tools such as CRISPR (regular clustered short palindromic repeats Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (transcription activator-like effector nuclease technology Transcription Activator-like (TAL) effector nucleases), ZFN (zinc finger nucleic acid technology, zinc finger nuclease), and the like. Preferably, the gene editing enzyme is a CRISPR enzyme, also known as Cas protein, the types of which include, but are not limited to: cas9 protein, cas12 protein, cas13 protein, cas14 protein, csm1 protein, FDK1 protein. The Cas protein refers to a protein family, and can have different structures according to different sources, such as SpCas9 from streptococcus pyogenes (Streptococcus pyogenes) and SaCas9 from staphylococcus (Staphylococcus aureus); the underlying classification may also be based on structural features (e.g., domains), such as Cas12 families including Cas12a (also known as Cpf 1), cas12b, cas12c, cas12i, and the like. The Cas protein may have double-stranded or single-stranded or no cleavage activity. The Cas protein of the invention can be wild type or mutant thereof, the mutant type of the mutant comprises substitution, substitution or deletion of amino acid, and the mutant can change or not change the enzyme digestion activity of the Cas protein. As known to those skilled in the art, a variety of Cas proteins with nucleic acid cleavage activity, as reported in the prior art, or engineered variants thereof, may perform the functions of the present invention, and are incorporated herein by reference.

As used herein, the terms "guide RNA (guide RNA)," "mature crRNA," "guide sequence" are used interchangeably and have the meaning commonly understood by one of skill in the art. In general, the guide RNA can comprise, consist essentially of, or consist of, a direct repeat (direct repeat) and a guide sequence (also referred to as a spacer sequence (spacer) in the context of endogenous CRISPR systems).

In certain instances, the guide sequence is any polynucleotide sequence that has sufficient complementarity to a target sequence to hybridize to the target sequence and guide the specific binding of the CRISPR/Cas complex to the target sequence. In one embodiment, the degree of complementarity between a guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimally aligned. It is within the ability of one of ordinary skill in the art to determine the optimal alignment. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, the Smith-Waterman algorithm (Smith-Waterman), bowtie, geneious, biopython, and SeqMan in ClustalW, matlab.

The invention has the beneficial effects that:

(1) The present invention provides a method for conferring/enhancing resistance/tolerance to the herbicide 2, 4-D-butyric acid in plants.

(2) The present invention finds use in inhibiting the expression level or activity of the ABCD gene or a protein encoded thereby for conferring/enhancing resistance/tolerance to the herbicide 2, 4-d-butyric acid in plants. Wherein the ABCD gene includes ABCD2 gene and ABCD1 gene.

Sequence information

Sequence number	Description of the invention
		SEQ ID NO.:1	ABCD2 amino acid sequence
SEQ ID NO.:2	ABCD1 amino acid sequence
		SEQ ID NO.:3	ABCD2 nucleotide sequence
SEQ ID NO.:4	ABCD1 nucleotide sequence
		SEQ ID NO.:5	AtABCD1-T1
SEQ ID NO.:6	AtABCD1-T2
		SEQ ID NO.:7	AtABCD2-T1
SEQ ID NO.:8	AtABCD2-T2
		SEQ ID NO.:9	AtABCD1-1F
SEQ ID NO.:10	AtABCD1-1R
		SEQ ID NO.:11	AtABCD1-2F
SEQ ID NO.:12	AtABCD1-2R
		SEQ ID NO.:13	AtABCD2-1F
SEQ ID NO.:14	AtABCD2-1R
		SEQ ID NO.:15	AtABCD2-2F
SEQ ID NO.:16	AtABCD2-2R
		SEQ ID NO.:17	AtABCD1-3F
SEQ ID NO.:18	AtABCD2-3R
		SEQ ID NO.:19	Cas9-jc-F3
SEQ ID NO.:20	Cas9-jc-R3
		SEQ ID NO.:21	Cas9-jc-F4
SEQ ID NO.:22	Cas9-jc-R4
		SEQ ID NO.:23	AtABCD1-jc-1F
SEQ ID NO.:24	AtABCD1-jc-1R
		SEQ ID NO.:25	AtABCD1-jc-2F
SEQ ID NO.:26	AtABCD1-jc-2R
		SEQ ID NO.:27	AtABCD2-jc-1F
SEQ ID NO.:28	AtABCD2-jc-1R
		SEQ ID NO.:29	AtABCD2-jc-2F
SEQ ID NO.:30	AtABCD2-jc-2R

Drawings

FIG. 1 shows mutant forms of the ABCD1 gene transformed with the P0950 vector, including wild-type Col, ABCD1 single mutant strain beta 5-115, ABCD1 single mutant strain beta 5-108, and ABCD1 single mutant strain beta 5-2-4.

FIG. 2 shows a mutant form of the ABCD1 gene transformed with the P0951 vector. Includes wild type Col, ABCD1 single mutant strain beta 6-204, ABCD1 single mutant strain beta 6-186 and ABCD1 single mutant strain beta 6-197.

FIG. 3 shows mutant forms of the ABCD2 gene transformed with the P0952 vector, including wild-type Col, single ABCD2 mutant strain beta 7-305.

FIG. 4 shows mutant forms of the ABCD2 gene transformed with the P0953 vector, including wild-type Col, ABCD2 single mutant line β8-3-1, ABCD2 single mutant line β8-337, ABCD2 single mutant line β8-347, and ABCD2 single mutant line β8-360.

FIG. 5 shows mutant forms of the ABCD1 gene after transformation of double mutant vector P2021, including wild-type Col, mutant forms of ABCD1 of double mutant lines 2021-1-8, mutant forms of ABCD1 of double mutant lines 2021-6-2, mutant forms of ABCD1 of double mutant lines 2021-6-1, mutant forms of ABCD1 of double mutant lines 2021-4-5.

FIG. 6 shows mutant forms of the ABCD2 gene after transformation of double mutant vector P2021, including wild-type Col, mutant forms of ABCD2 of double mutant lines 2021-1-8, mutant forms of ABCD2 of double mutant lines 2021-6-2, mutant forms of ABCD2 of double mutant lines 2021-6-1, mutant forms of ABCD2 of double mutant lines 2021-4-5.

FIG. 7 is a schematic diagram of a gene editing vector used in the present embodiment.

Figure 8 shows the growth of arabidopsis thaliana of different edit lines 10 days after herbicide spraying. As can be seen from fig. 8A, most of wild WT arabidopsis died after 10 days of herbicide application; the wild WT Arabidopsis has good growth condition in a group without herbicide; two groups 2021-6-1 and 2021-6-2 of arabidopsis thaliana can still grow after 10 days of herbicide spraying, but plants are slightly smaller than a group of wild type arabidopsis thaliana without herbicide spraying; after 10 days of herbicide spraying of the arabidopsis thaliana of the two groups of beta 8-3-1 and beta 5-108, the growth is inhibited, and the plants are smaller. As can be seen from fig. 8B and 8C, growth was inhibited 10 days after the wild-type WT arabidopsis was sprayed with the herbicide; the three groups 2021-1-8, 2021-6-2 and 2021-6-1 of arabidopsis thaliana are slightly inhibited after 10 days of herbicide spraying; four groups of Arabidopsis thaliana, beta 5-2-4, beta 8-3-1, beta 5-108 and beta 8-337, were herbicide-sprayed for 10 days, and then were inhibited from growing and were smaller.

Fig. 9A and 9B show the growth of arabidopsis thaliana of different editorial strains 20 days after spraying. As can be seen from fig. 9A and 9B, after 20 days of wild WT arabidopsis spraying, plant growth was significantly inhibited and most plants died; after 20 days of spraying of three groups 2021-1-8, 2021-4-1 and 2021-6-1, the growth is not different from that of the wild type arabidopsis without spraying; four groups of Arabidopsis thaliana, beta 5-108, beta 5-2-4, beta 8-3-1, and beta 8-337, were smaller and growth inhibited after 20 days of herbicide application, but were somewhat larger than wild type plants.

FIGS. 10A and 10B show the phenotypes of the mutants of the different mutation types (wild-type WT, ABCD1 single mutant strain beta 5-108, ABCD1 single mutant strain beta 5-2-4, ABCD2 single mutant strain beta 8-337, ABCD2 single mutant strain beta 8-3-1, double mutant strain 2021-1-8, double mutant strain 2021-6-1, double mutant strain 2021-6-2) cultured in sugarless medium (-sucrose), MS medium (+sucrose) and 2, 4-hydroxybutyrate medium (+2, 4-DB). The results show that the mutant lines after the double-gene mutation of the ABCD1 and the ABCD2 do not depend on exogenous carbon and do not have sugar dependence when germinating; mutant lines of ABCD1 or ABCD2 single gene mutations have weak 2, 4-D-butyrate resistance; the mutant lines after double gene mutation of ABCD1 and ABCD2 have stronger 2, 4-D-butyric acid resistance.

FIGS. 11A and 11B show statistics of root lengths of mutants of different mutation types (wild-type WT, ABCD1 single mutant strain beta 5-108, ABCD1 single mutant strain beta 5-2-4, ABCD2 single mutant strain beta 8-337, ABCD2 single mutant strain beta 8-3-1, double mutant strain 2021-1-8, double mutant strain 2021-6-1, double mutant strain 2021-6-2) cultured in MS medium (% 1-crossover), sugarless medium (No-crossover), 2,4-D butyric acid medium (0.5 mM 2, 4-DB). In the culture medium containing sucrose, the root lengths of beta 5-108, beta 5-2-4, beta 8-337, beta 8-3-1, 2021-1-8, 2021-6-1, 2021-6-2 and wild type seeds are all 1.8-2.6 cm; in MS medium without sucrose, 2021-1-8, 2021-6-1, 2021-6-2 and wild type WT seed root length is between 1.5-2.1 cm; in MS medium containing 2,4-D butyric acid, the elongation of the seed hypocotyl of wild type WT is about 0.1cm, the elongation of the seed hypocotyl of beta 5-108, beta 5-2-4 is between 0.3-0.4cm, the elongation of the seed hypocotyl of beta 8-337, beta 8-3-1 is about 0.2cm, and the elongation of the seed hypocotyl of 2021-1-8, 2021-6-1, 2021-6-2 is about 1.7-2 cm.

Detailed Description

The present invention is further described in terms of the following examples, which are given by way of illustration only, and not by way of limitation, of the present invention, and any person skilled in the art may make any modifications to the equivalent examples using the teachings disclosed above. Any simple modification or equivalent variation of the following embodiments according to the technical substance of the present invention falls within the scope of the present invention.

The invention is further illustrated by the following experimental details in connection with examples. All methods and operations described in these embodiments are provided by way of example and should not be construed as limiting. Methods for manipulation of DNA can be found in volumes Current Protocols in Molecular Biology,

volumes

1 and 2, ausubel f.m. greene Publishing Associates and Wiley Interscience,1989,Molecular Cloning,T.Maniatis et al, 1982, or Sambrook j and Russell d, 2001,Molecular Cloning:a laboratory manual,version 3.

Example 1 preparation of Arabidopsis ABCD Gene editing lines

1. Target design and carrier construction

The genome sequences and the amino acid sequences of the two genes ABCD1 and ABCD2 are obtained through NCBI (https:// www.ncbi.nlm.nih.gov) websites, and target design is carried out on the coding regions of the two genes respectively.

In this example, the ABCD1 gene (ABCD 1 wild type gene sequence shown as SEQ ID No.:4, the encoded amino acid sequence shown as SEQ ID No.: 2) and the ABCD2 gene (ABCD 2 wild type gene sequence shown as SEQ ID No.:3, the encoded amino acid sequence shown as SEQ ID No.: 1) are edited in arabidopsis using Cas9 and sgrnas targeting ABCD1 and ABCD2, and the specific method of operation can be performed in a manner conventional in the art; in this embodiment, a schematic diagram of the constructed gene editing vector is shown in FIG. 7; wherein, ATU6 _pro The mutant is a U6 promoter, gly-tRNA is glycine tRNA, atUBQ1 terminator is terminator, and NLS is nuclear localization signal; vector construction can also be referred to in the reference ("High-efficiency CRISPR/Cas9 multiplex gene editing using the glycine tRNA-processing system-based strategy in maize", weiwei Qi et al, BMC Biotechnology, 2016).

Specifically, in this embodiment, the gRNA was designed using target Design (http:// skl. Scau. Edu. Cn/targetdiesig /), and the ABCD1 gene contains 25 exons and 24 introns, and encodes an ABC (ATP binding cassette) transporter 1, which is a protein required for beta oxidation of fatty acids and 2, 4-hydroxybutyrate to peroxisomes. We designed gRNA at exon 2 and exon 21 of ABCD1, respectively:

AtABCD1-T1: GACGCGAAGAATCAGGCCTC (SEQ ID NO.: 5) and

AtABCD1-T2：GGTAAGTCTTCCACATACAG(SEQ ID NO.:6)。

ABCD2 has 9 exons, 8 introns, encodes ATP-binding cassette transporter 2, we designed gRNA at exon 1 and exon 7 of ABCD2, respectively:

AtABCD2-T1：ACGGCGGCGAGACGAAGCC(SEQ ID NO.:7)

AtABCD2-T2：GTGGAGGAGACGACACCTGG(SEQ ID NO.:8)。

1.1A specific construction method of the single-target carrier comprises the following steps:

1) Respectively using primer pairs

AtABCD1-1F: GATTGACGCGAAGAATCAGGCCTC (SEQ ID NO.: 9), and

AtABCD1-1R：AAACACCATCCACGTGTGATATTC(SEQ ID NO.:10)；

AtABCD1-2F: GATTGGTAAGTCTTCCACATACAG (SEQ ID NO.: 11), and

AtABCD1-2R：AAACTGCCTAATCTCTGTTGCTCC(SEQ ID NO.:12)；

AtABCD2-1F: GATTGACGGCGGCGAGACGAAGCC (SEQ ID NO.: 13), and

AtABCD2-1R：AAACGGCTTCGTCTCGCCGCCGTC(SEQ ID NO.:14)；

AtABCD2-2F: GATTGTGGAGGAGACGACACCTGG (SEQ ID NO.: 15), and

AtABCD2-2R：AAACCCAGGTGTCGTCTCCTCCAC(SEQ ID NO.:16)；

and (5) performing annealing connection.

2) The plasmid 1300-psgR-Cas9BP (P0276) was digested with BsaI, and the gel was digested to recover about 15 Kb.

3) Respectively carrying out T4 connection on the recovered carrier and the annealed product; the final vectors P0950, P0951, P0952, and P0953 are constructed.

1.2 the specific construction method of the double-target carrier is as follows:

1) Primer pair

AtABCD1-3F：

TAGGTCTCTTGCAGACGCGAAGAATCAGGCCTCGTTTTAGAGCTAGAAATAGCA AGT (SEQ ID NO.: 17), and

AtABCD2-3R：

TAGGTCTCTAAACCCAGGTGTCGTCTCCTCCACTGCACCAGCCGGGAATCG(SEQ ID NO.:18)；

amplifying by taking plasmid P0055 as a template, and respectively tapping and recovering fragments of about 200bp as AtABCD1-T1 and AtABCD2-T1;

2) The recovered fragments are digested with BsaI and recovered by using a kit;

3) BsaI digestion is carried out on the skeleton carrier P1957, and 15Kb fragments are recovered;

4) AtABCD1-T1 and AtABCD2-T1 are connected with P1957 to construct a final vector P2021, namely P2021 is the first target targeted to the ABCD1 gene and the 2 nd target of ABCD 2. Playing a role in knocking out two genes simultaneously.

1.3, trans-T1 is transformed, kan plate culture is carried out, 6 bacterial colonies are selected for liquid culture for 2 hours, PCR bacterial liquid detection is carried out, 2 correct monoclone are selected, and bacterial liquid delivery detection is carried out.

1.4 selecting the monoclonal with correct sequencing for propagation, bacterial preservation and plasmid extraction.

2. Genetic transformation

2.1 transformation of Agrobacterium

Transferring the vector in 1 into an agrobacterium strain GV3101 by using a thermal shock method, picking up a monoclonal, culturing by liquid, identifying by PCR, and storing in a refrigerator at-80 ℃ for later use.

2.2 Strain activation

Taking out the bacteria from the-80 refrigerator, streaking on the YEP solid culture medium, carrying out dark culture at 28 ℃ for 1-2 days, enabling bacterial colonies to grow out, taking the bacterial colonies, coating the bacterial colonies on a new YEP flat plate, carrying out dark culture at 28 ℃ and enabling the flat plate bacteria to grow well for 12-24 hours.

2.3 preparation of Agrobacterium infection solution

The monoclonal colony is selected from the newly activated bacterial plate, added into 5ml of resistant culture medium, shake-cultured for 24 hours at a low speed of 28 ℃ on a shaking table, activated agrobacterium liquid is sucked according to the proportion of one thousandth, and added into 300ml of resistant culture medium again, and shake-cultured until the OD value is 0.8-1.5. The cells were collected at room temperature at 4000rpm for 15 min. The cells were resuspended in an equal volume of 5% sucrose aqueous solution. And adding auxiliary reagents such as Silwet L-77 and the like to make the final concentration of the mixture be 0.03 percent.

2.4 infestation of

The Arabidopsis plants are inclined, inflorescences are immersed into a culture dish filled with bacterial liquid, and the Arabidopsis plants are taken out after being immersed for 1 min. The transformed plants were covered with black plastic bags and removed the next day.

3. Mutant screening

The pod, i.e. the T0 generation seed, is harvested after the transformed Arabidopsis thaliana is ripe, the T0 generation seed is put into an EP tube for sterilization treatment, and then is sprinkled into a culture medium containing hygromycin. Because transgenic Arabidopsis seeds will normally grow on the plates, but not the germination of transgenic seeds and root growth will be inhibited by hygromycin, transgenic and non-transgenic seeds can be clearly distinguished on the plates.

Part of seeds can be inhibited by hygromycin, only the seeds of transgenic positive seedlings can grow on all the plates, seedlings which can grow normally and grow out roots are transferred to soil for culture, and the seedlings are obtained and DNA is extracted. Primer pairs were used for plants transformed with the P0950, P0951, P0952, P0953, P2021 vectors

Cas9-jc-F3: CAGAAAGAGCGAGGAAACCA (SEQ ID NO.: 19), and

Cas9-jc-R3：CCTCAAACAGTGTCAGGGTCA(SEQ ID NO.:20)；

cas9-jc-F4: atatcgtgcctcagagctttc (SEQ ID NO.: 21), and

Cas9-jc-R4：aactcgctttccagcttaggg(SEQ ID NO.:22)；

positive seedlings were again determined and pairs of primers were used for these positive seedlings

AtABCD1-jc-1F: TTCGTTTGGGCTCAGATTTC (SEQ ID NO.: 23), and

AtABCD1-jc-1R：CCCGACTATTGGCCGTAA(SEQ ID NO.:24)；

AtABCD1-jc-2F: GGAAAAGCCTGCTCGTCA (SEQ ID NO.: 25), and

AtABCD1-jc-2R：TGCCTACAATACGAACCAAGTC(SEQ ID NO.:26)；

AtABCD2-jc-1F: AAGTTGCTATGGCTATGTGGG (SEQ ID NO.: 27), and

AtABCD2-jc-1R：TACAGAGGGAGGAGCGTGAG(SEQ ID NO.:28)；

AtABCD2-jc-2F: TATATGACAAGGATCACCTACTGG (SEQ ID NO.: 29), and

AtABCD2-jc-2R：ACTGGACCACTCGTGTATCG(SEQ ID NO.:30)；

the corresponding fragments of the ABCD1 and ABCD2 genes were amplified separately. Sequencing the amplified product by a sanger method, confirming the editing form, connecting the PCR product to a T vector if the sequencing result shows double peaks, selecting 5 clones for sequencing, and confirming the editing form.

Arabidopsis thaliana transformed with the P0950 vector gave:

the editing result of the strain beta 5-115 is that 33bp is deleted from 1023-1055nt of ABCD1 gene, and the deletion site is reduced by 11 amino acids.

Editing strain beta 5-108, wherein the editing result is that after 30bp is inserted after 1022nt of the ABCD1 gene, 19bp of 1023-1041nt of the original ABCD1 gene is deleted, then 1bp is inserted after 1046nt of the original ABCD1 gene, SNP mutation is generated between 1049nt and 1053nt of the original ABCD1 gene, wherein the SNP mutation at 1049 causes the coded amino acid to be changed from Gly to Asp, the SNP mutation at 1053 causes no amino acid to be changed, the subsequent amino acid is changed, and a stop codon TGA is formed in a new CDS region 1026-1028nt (1025-1027 nt of the original ABCD1 gene). Will result in premature termination of protein translation;

the editing of strain β5-2-4 resulted in 28bp deletion at 1001-1028nt of the ABCD1 gene, resulting in a subsequent amino acid change and formation of stop codon TGA at the new CDS region 1054-1056nt (1082-1084 nt of the original ABCD1 gene). Will result in premature termination of protein translation;

The specific editing patterns of editing lines beta 5-115, beta 5-108, beta 5-2-4 are shown in FIG. 1, wherein Col is wild type.

Arabidopsis thaliana transformed with vector P0951 gave:

editing strain beta 6-204, wherein the editing result is that 3bp is inserted and 9bp is deleted after 7357nt of the ABCD1 gene, so that one amino acid is inserted and two amino acids are deleted;

the strain β6-186 was edited, and as a result, one base T was inserted after 7358nt of the ABCD1 gene. Resulting in subsequent amino acid changes and formation of stop codon TGA in the new CDS region 7489-7491nt (7488-7490 nt of the original ABCD1 gene) will result in premature termination of protein translation;

editing strain beta 6-197, wherein 6bp is deleted at 7355-7360nt of ABCD1 gene, so that 2 amino acids are deleted;

the specific editing patterns of editing lines β6-204, β6-186, β6-197 are shown in FIG. 2, where Col is wild type.

Arabidopsis thaliana transformed with vector P0952 gave:

the strain β7-305 was edited, and as a result, 1bp was inserted after 319nt of the ABCD2 gene, resulting in a change in the amino acid sequence thereafter, and a stop codon TAG was formed in the new CDS region 365-367nt (364-366 nt of the original ABCD2 gene). Will result in premature termination of protein translation;

The specific editing scheme for editing strain β7-305 is shown in fig. 3, where Col is wild type.

Arabidopsis thaliana transformed with vector P0953 gave:

editing strain β8-337, which has the result of inserting 1bp after 2700nt of ABCD2 gene, resulting in a change in the amino acid sequence thereafter, and forming a stop codon TAA in the new CDS region 2792-2712nt (2791-2711 nt of original ABCD2 gene), would result in premature termination of protein translation;

editing strain β8-347, which has the result of inserting 1bp after 2699nt of ABCD2 gene, resulting in a change in the amino acid sequence thereafter, and forming a stop codon TAA in the new CDS region 2792-2712nt (2791-2711 nt of original ABCD2 gene), would result in premature termination of protein translation;

editing strain beta 8-360, which has the editing result that 10bp is deleted in 2690-2699nt of ABCD2 gene, so that the amino acid sequence is changed, and a stop codon TGA is formed in a new CDS region 2847-2849nt (2857-2859 nt of original ABCD2 gene), so that premature termination of protein translation is caused;

editing strain β8-3-1, which has the result that 29bp of 2674-2702nt of ABCD2 gene is deleted, resulting in the change of the amino acid sequence thereafter, and forming a stop codon TAA in the new CDS region 2680-2682nt (2709-2711 nt of original ABCD2 gene);

The specific editing patterns of editing lines β8-337, β8-347, β8-360, β8-3-1 are shown in FIG. 4, where Col is the wild type.

The arabidopsis transformed with the double-target vector P2021 gave:

double-process editing strain 2021-1-8, which has the editing result that 1bp is inserted after 1022nt of ABCD1 gene, 16 bases are deleted after 2687-2702nt of ABCD2 gene, and simultaneous knockout of two genes is realized;

double-mutation editing strain 2021-6-2 has the editing result that 8 bases are deleted from 1023-1030nt of ABCD1 gene, 2699 th base is deleted from ABCD2 gene, and simultaneous knockout of two genes is realized;

the double-mutation editing strain 2021-6-1 has the editing result that 31 bases are deleted at 1023-1053nt of the ABCD1 gene, the 2699 th base is deleted in the ABCD2 gene, and the double-mutation editing strain is identical with the editing result of the ABCD2 gene of 2021-6-2, so that the simultaneous knockout of two genes is realized;

double-process editing line 2021-4-1 has the editing result that 1 base is inserted into 1022 of ABCD1 gene, 27 bases are deleted from 2699-2725nt of ABCD2 gene, and simultaneous knockout of two genes is realized;

double-process editing strain 2021-4-5 has the editing result that 5 bases are deleted from 1023-1027nt of ABCD1 gene and 29 bases are deleted from 2674-2702nt of ABCD2 gene, so that simultaneous knockout of two genes is realized;

The specific editing patterns of the ABCD1 gene in the editing lines 2021-1-8, 2021-6-2, 2021-6-1, 2021-4-5 are shown in FIG. 5, and the specific editing patterns of the ABCD2 gene are shown in FIG. 6, wherein Col is wild type.

TABLE 1 type of strain editing

/>

Example 2 resistance test to herbicide 2, 4-D-butyric acid

1. Herbicide spraying experiments:

firstly, planting arabidopsis in 10 x 10cm square grids, growing 2 pieces of true leaves of the arabidopsis, and when 4 pieces of green leaves are seen, spraying 3mL 2, 4-d butyric acid with the concentration of 1mg/mL on each square grid, and observing the growth state of the arabidopsis of different editing strains after the spraying is finished.

FIG. 8A shows the growth of Arabidopsis thaliana of different editorial strains 10 days after spraying. After 10 days of herbicide application, the wild WT arabidopsis mostly died. The wild WT arabidopsis grows well in a group without herbicide. Two groups 2021-6-1 and 2021-6-2 of Arabidopsis thaliana could still grow after 10 days of herbicide application, but plants were slightly smaller than the wild type group of Arabidopsis thaliana without herbicide application. After 10 days of herbicide spraying of the arabidopsis thaliana of the two groups of beta 8-3-1 and beta 5-108, the growth is inhibited, and the plants are smaller.

FIGS. 8B and 8C show the growth of Arabidopsis thaliana of different editorial strains 10 days after spraying. After 10 days of herbicide application, the wild WT arabidopsis was inhibited in growth. The growth was slightly inhibited 10 days after the herbicide was applied to the three groups 2021-1-8, 2021-6-2 and 2021-6-1 of Arabidopsis thaliana. Four groups of Arabidopsis thaliana, beta 5-2-4, beta 8-3-1, beta 5-108 and beta 8-337, were herbicide-sprayed for 10 days, and then were inhibited from growing and were smaller.

Fig. 9A and 9B show the growth of arabidopsis thaliana of different editorial strains 20 days after spraying:

FIG. 9A is a comparison of the growth of a single strain of Arabidopsis thaliana of different editorial strains, and FIG. 10B is a comparison of the growth of a plurality of strains of Arabidopsis thaliana of different editorial strains.

As can be seen from fig. 9A, the wild WT arabidopsis plants were smaller and growth was inhibited after 20 days of drug spraying; 2021-1-8 after 20 days of arabidopsis thaliana spraying, the growth situation was not different from that of the wild arabidopsis thaliana without spraying; after 20 days of herbicide application to Arabidopsis thaliana in both groups β8-3-1 and β5-108, the plants were smaller and growth was inhibited, but were larger than those of the wild type spray group.

As can be seen from fig. 9B, after 20 days of wild-type WT arabidopsis spray, plant growth was significantly inhibited, most of the plants died, indicating that wild-type arabidopsis was not herbicide resistant; after 20 days of spraying, 2021-1-8, 2021-4-1 and 2021-6-1 groups of Arabidopsis thaliana, the growth situation is not different from that of the wild type Arabidopsis thaliana without spraying, which indicates that the double mutant lines of ABCD1 and ABCD2 have 2, 4-D butyric acid resistance; four groups of Arabidopsis thaliana, beta 5-108, beta 5-2-4, beta 8-3-1 and beta 8-337, were sprayed with herbicide for 20 days, and the plants were smaller and growth was inhibited, but were larger than the wild type plants, indicating that either the ABCD1 single mutant or the ABCD2 single mutant lines had partial 2, 4-D butyric acid resistance.

In summary, most of wild arabidopsis is dead after 3 days of spraying, and serious phytotoxicity is generated without death and cannot grow normally; the ABCD1 single mutant strain or the ABCD2 single mutant strain Arabidopsis thaliana does not die, but is slowly grown under the influence of phytotoxicity; the arabidopsis thaliana of the double mutant strains of ABCD1 and ABCD2 can not die, a slow growth state appears within 7 days after the medicine spraying, the growth state is slowly restored after 7 days, and the normal growth state can be basically restored after 20 days.

2. Petri dish culture experiment

Many Arabidopsis mutants, which are associated with the beta oxidation process, have growth defects and require the presence of exogenous carbon for proper germination, such as ped mutants, pxa mutants, cts mutants, and the like. The ABCD gene was involved in β oxidation to verify whether there were growth defects following mutation of the ABCD1 gene and ABCD2 gene, in this example, germination was observed in a medium without exogenous carbon.

2, 4-D-butyric acid belongs to systemic herbicide, can be absorbed by the rhizome and leaf of plant and is transmitted up and down in the plant body, the elongation and root length of hypocotyl are inhibited when seeds germinate, and the resistance of mutant can be judged by counting the inhibition degree and inhibition number of root length of arabidopsis in arabidopsis culture medium.

Arabidopsis seeds of different editing types (wild type WT, beta 5-115, beta 5-108, beta 5-2-4, beta 6-204, beta 6-186, beta 6-197, beta 7-305, beta 8-337, beta 8-347, beta 8-360, beta 8-3-1, 2021-1-8, 2021-6-1, 2021-6-2, 2021-4-1, 2021-4-5) were sterilized, then air-dried, and then transferred to a 22℃room for culturing for 7 days after low temperature treatment for 3 days in MS medium, MS medium containing 1% sucrose, MS medium containing 0.5mM 2, 4-dibutyric acid and 1% sucrose, respectively, and germination was observed.

FIGS. 10A and 10B show elongation of the hypocotyl of each group of Arabidopsis seeds under different medium conditions:

in MS medium containing 1% sucrose (i.e., +sucrose), beta 5-108, beta 5-2-4, beta 8-337, beta 8-3-1, 2021-1-8, 2021-6-1, 2021-6-2 were elongated from the seed hypocotyl of wild-type WT, and there was no difference in elongation length for each group, indicating that each group was normal in germination in medium containing exogenous carbon, and that hypocotyl elongation was normal.

In sucrose-free MS medium (i.e., -sucrose), 2021-1-8, 2021-6-1, 2021-6-2 were elongated from the seed hypocotyls of wild-type WT, and there was no difference in elongation length for each group. It shows that the mutant lines after the double gene mutation of ABCD1 and ABCD2 are independent of exogenous carbon and have no sugar dependence when germinating.

In MS medium containing 2,4-D butyric acid and sucrose (i.e. +2, 4-DB), the elongation of the seed hypocotyl of wild-type WT was shorter, as was the root; the elongation of the embryo axis of the beta 5-108 and beta 5-2-4 seeds is shorter, but the length of the elongation is longer than that of the wild type; the elongation of the seed hypocotyls of beta 8-337 and beta 8-3-1 is shorter; the elongation of the seed hypocotyls of 2021-1-8, 2021-6-1, 2021-6-2 is longer, significantly longer than that of the wild type. Indicating that the wild arabidopsis seeds do not have 2, 4-D-butyric acid resistance and influence the germination process; the ABCD1 single mutant strain (beta 5-108, beta 5-2-4) and the ABCD2 single mutant strain (beta 8-337, beta 8-3-1) have weaker 2,4-D butyric acid resistance, and the germination process is inhibited to a certain extent; the double mutant strains of ABCD1 and ABCD2 (. Beta.2021-1-8, 2021-6-1, 2021-6-2) have strong 2, 4-D-butyric acid resistance, and the germination process is not substantially inhibited.

FIGS. 11A and 11B are root length statistics for various groups of Arabidopsis seeds under different medium conditions:

as can be seen from FIG. 11A, in MS medium containing 10mg/ml sucrose (1% sucrose), the seed root lengths of β5-108, β5-2-4, β8-337, β8-3-1, 2021-1-8, 2021-6-1, 2021-6-2 and wild type WT were all between 1.8-2.6cm, indicating that the elongation of the hypocotyls of each group was normal and consistent.

As can be seen from FIG. 11A, the root lengths of the seeds of 2021-1-8, 2021-6-1, 2021-6-2 and wild-type WT were between 1.5-2.1cm in the sucrose-free MS medium (No cross), indicating that the elongation of the hypocotyls of the ABCD1 and ABCD2 double mutant lines was normal in the sucrose-free medium.

In MS medium (0.5 mM 2, 4-DB) containing 2,4-D butyric acid and sucrose, the elongation of the seed hypocotyl of wild-type WT was about 0.1cm, the elongation of the seed hypocotyl of beta 5-108, beta 5-2-4 was between 0.3 and 0.4cm, the elongation of the seed hypocotyl of beta 8-337, beta 8-3-1 was about 0.2cm, and the elongation of the hypocotyl of seeds of 2021-1-8, 2021-6-1, 2021-6-2 was about 1.7-2 cm. Indicating that the wild arabidopsis seeds do not have 2, 4-D-butyric acid resistance and influence the germination process; the ABCD1 single mutant strain (beta 5-108, beta 5-2-4) and the ABCD2 single mutant strain (beta 8-337, beta 8-3-1) have weaker 2,4-D butyric acid resistance, and the germination process is inhibited to a certain extent; the double mutant strains of ABCD1 and ABCD2 (. Beta.2021-1-8, 2021-6-1, 2021-6-2) have strong 2, 4-D-butyric acid resistance, and the germination process is not substantially inhibited.

In addition, the ABCD1 gene and the ABCD2 gene of plants such as rice, tobacco, tomato, potato, corn, soybean, wheat and the like are edited to obtain plants with single mutation of the ABCD1 gene, single mutation of the ABCD2 gene, double mutation of the ABCD1 gene and the ABCD2 gene, the ABCD1 gene and the ABCD2 gene of the corresponding plants are knocked out, and the gene expression level is reduced. The experiments of the resistance of the mutant plants to herbicide 2, 4-D-butyric acid also show that the plants of the ABCD1 single mutant line and the ABCD2 single mutant line have a certain degree of 2, 4-D-butyric acid resistance; plants of the ABCD1 and ABCD2 double mutant lines have greater 2,4-d butyrate resistance.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Claims

1. A method of conferring/enhancing resistance/tolerance to the herbicide 2, 4-d-butyric acid (2, 4-DB) in a plant or to a herbicide 2, 4-d-butyric acid in a plant, characterized in that said method comprises any one or more of the steps of:

(a) Reducing or inhibiting the expression level of the ABCD2 (ATP-binding cassette D2) gene in said plant;

(b) Reducing or inhibiting the expression level and/or activity of a protein encoded by the ABCD2 gene in said plant;

the amino acid sequence of ABCD2 has at least 70% sequence identity as compared to SEQ ID No. 1.

2. The method of claim 1, further comprising any one or more of the steps of:

(c) Reducing or inhibiting the expression level of the ABCD1 (ATP-binding cassette D1) gene in said plant;

(d) Reducing or inhibiting the expression level and/or activity of a protein encoded by the ABCD1 gene in said plant;

the amino acid sequence of ABCD1 has at least 70% sequence identity as compared to SEQ ID No. 2.

3. The method according to any one of claims 1-2, wherein steps (a), (b), (c) or (d) are carried out by one or more methods selected from the group consisting of:

gene mutation, gene knockout, gene disruption, RNA interference, gene editing techniques, inhibitors of the introduced gene or protein.

4. A composition, complex or carrier system for conferring/enhancing resistance/tolerance to the herbicide 2, 4-d-butyric acid in a plant, characterized in that said composition, complex or carrier system is used for reducing or inhibiting the expression level of ABCD2 gene in said plant, or reducing or inhibiting the expression level and/or activity of protein encoded by ABCD2 gene in said plant; optionally, the composition, complex or vector system is further used to reduce or inhibit the expression level of the ABCD1 gene in the plant, or to reduce or inhibit the expression level and/or activity of a protein encoded by the ABCD1 gene in the plant;

the amino acid sequence of ABCD2 has at least 70% sequence identity as compared to SEQ ID No. 1;

5. Use of the composition, complex or carrier system of claim 4 for conferring/enhancing resistance/tolerance to the herbicide 2, 4-d-butyric acid in a plant or for preparing a reagent or kit for conferring/enhancing resistance/tolerance to the herbicide 2, 4-d-butyric acid in a plant.

6. A method of preparing a plant cell, or plant tissue, or plant part, or plant that is resistant/tolerant to the herbicide 2, 4-d-butyrate, comprising the step of reducing or inhibiting the expression level of the ABCD2 gene in the plant cell, or plant tissue, or plant part, or plant, or reducing or inhibiting the expression level and/or activity of a protein encoded by the ABCD2 gene in the plant cell, or plant tissue, or plant part, or plant;

7. The method of claim 6, further comprising reducing or inhibiting the expression level of the ABCD1 gene in the plant cell, or plant tissue, or plant part, or plant, or reducing or inhibiting the expression level and/or activity of a protein encoded by the ABCD1 gene in the plant cell, or plant tissue, or plant part, or plant; the amino acid sequence of ABCD1 has at least 70% sequence identity as compared to SEQ ID No. 2.

8. A plant cell, or plant tissue, or plant part, or plant that develops resistance/tolerance to the herbicide 2, 4-d-butyric acid, characterized in that said plant cell, or plant tissue, or plant part, or plant is prepared by the method of any one of claims 6 to 7.

9. A method of making a hybrid plant comprising the step of crossing the plant of claim 8 with other plants to produce a hybrid plant.

10. A method of controlling unwanted vegetation at a plant locus, the method comprising:

(1) Providing a plant according to any one of claims 8 to 9 at said cultivation site;