CN116200400A - Method for enhancing resistance of tomatoes to root-knot nematodes - Google Patents

Abstract

The invention discloses a method for enhancing resistance of tomatoes to root knot nematodes, and relates to the technical field of biology. Compared with wild plants, the invention has the advantages that the number of root knots is obviously reduced by knocking out the MED25 gene or the ERF1 gene in the tomatoes, and the expression of the defense gene PDF1.2a/b is limited, so that the ERF1 or the MED25 positively regulates the resistance of the tomatoes to the meloidogyne incognita.

Description

Method for enhancing resistance of tomatoes to root-knot nematodes

Technical Field

The invention relates to the technical field of biology, in particular to a method for enhancing resistance of tomatoes to root-knot nematodes.

Background

Jasmonic Acid (JA) is a major defensive plant hormone, playing a key role in regulating the defensive response of plants against mechanical injury, insect attack and pathogen infection. JA biosynthesis is rapidly initiated upon mechanical injury or insect/pathogen attack. Bioactive jasmonic acyl-L-isoleucine (JA Ile) is sensed by the COI 1-jasmonic acid ZIM domain (JAZ) complex, resulting in degradation of the JAZ repressor protein by the 26S proteasome and release of downstream transcription factors to activate various JA response genes. The JA signal path consists of two branches; basic helix-loop-helix (bHLH) protein (MYC) branching is associated with injury and defense in insect herbivores, and Ethylene Response Factor (ERF) branching is associated with enhanced resistance to necrotic pathogens. As a core transcription factor in the JA signaling pathway, MYC2 either interacts with the transcription repressor JAZ to exert its transcription repression function or interacts with the transcription activation mediator 25 (MED 25) to exert its transcription activation function. In addition to MYC2, ERF is also a key factor in JA signaling pathway and is involved in transcriptional regulation of various biological processes in plant stress responses. JA and ethylene are typically produced simultaneously during pathogen infection and synergistically regulate the resistance defensive signaling pathway.

Previous studies have found that ERFs can specifically bind GCC-box and DRE/CRT cis-acting elements to regulate downstream gene expression, such as Ethylene (ET) induced PR gene and abiotic stress induced gene expression. In recent years, ERFs were found to bind to Coupling Element 1 (CE 1: TGCCACCG)), hypoxia Response Promoter Element (HRPE) and ATCTA. However, few reports have been made between ERF1 and root-knot nematodes, and the regulatory mechanisms thereof are unknown. Although ERF has been found in a variety of plants, there is no report of ERF in many tomatoes, particularly in root knot nematode resistance, and the underlying mechanisms of these functions in tomatoes remain poorly understood.

Root Knot Nematodes (RKNs) are plant parasitic nematodes such as peanut root knot nematodes (m.arenaria), java nematodes (m.javanica), southern root knot nematodes (m.incognita) and northern root knot nematodes (m.hapla), and have a broad host range, causing huge economic losses to crops. To combat nematode invasion, plants have evolved various defense strategies to induce immune responses. Notably, recent studies have found that the JA-dependent signaling pathway plays a key role in pathogen-associated molecular patterns (PAMP) triggered immunity (PTI) and effector-triggered immunity (ETI) against nematodes and necrotic pathogens. In tomato, previous studies reported that JA-dependent signaling is not involved in Mi-1 mediated defenses, whereas the complete JA signaling pathway is necessary for tomato sensitivity to RKNs. In rice (Oryza sativa), exogenous Ethephon (ET) and methyl jasmonic acid (MeJA) up-regulate expression of OsPR1a and OsPR1b genes at early stage of gramineous infection, thereby positively regulating systemic defense of rice against parasitic insects. Furthermore, JA response genes, such as phytoalexin 1.2 (PDF 1.2) and Protease Inhibitors (PI), are involved in JA-induced RKN resistance. Although the JA signaling pathway plays a key role in plant RKN resistance, its regulatory mechanisms are largely unknown.

Disclosure of Invention

The applicant found several genes with higher homology with arabidopsis thaliana in tomato, and screened and determined that gene ERF1 with DELLA structure, which interacts with MED25 to participate in pathogen defense, can be induced by RKN; the mutant can enhance the resistance of tomatoes to the root-knot nematodes, and the novel mechanism of the resistance of the tomatoes to the meloidogyne incognita of ET in the tomatoes is disclosed, so that important basis is provided for accelerating the research of the resistance mechanism of the root-knot nematodes and the development of resistance genes, and the tomato has very important scientific and practical significance. Ethylene was found to play a key role in plant response to necrotic pathogens and herbivores. The research of the invention discovers an Arabidopsis thaliana homologous gene ERF1 (Solyc 09g 089930) in tomatoes, and determines that the Arabidopsis thaliana homologous gene ERF1 can interact with MED25 to participate in pathogen defense through yeast interaction screening, and can be rapidly induced to express by RKN. Accordingly, the invention provides an application of tomato MED25 or ERF1 in regulating and controlling the sensitivity of root-knot nematodes.

The specific technical scheme is as follows:

the invention provides application of tomato genes in enhancing resistance of tomatoes to root knot nematodes, wherein the tomato genes are MED25 genes or ERF1 genes.

Particularly in terms of reduced root knot numbers and increased root knot nematode resistance. The lower the expression level of the ERF1 gene in plants, the fewer the number of root knots of the plants at the time of root knot nematode infestation, and the enhancement of the resistance to root knot nematodes.

The nucleotide sequence of the MED25 gene is shown as SEQ ID NO.1, and the nucleotide sequence of the ERF1 gene is shown as SEQ ID NO. 2.

The invention also provides application of the protein coded by the tomato gene in enhancing the resistance of tomatoes to root knot nematodes, wherein the tomato gene is the protein coded by the MED25 gene or the protein coded by the ERF1 gene.

The amino acid sequence of the protein coded by the tomato MED25 gene is shown as SEQ ID NO.3, and the amino acid sequence of the protein coded by the ERF1 gene is shown as SEQ ID NO. 4.

The invention also provides a method for enhancing the resistance of tomatoes to root-knot nematodes, which is to silence or knock out the MED25 gene or the ERF1 gene in tomatoes. The nucleotide sequence of the MED25 gene is shown as SEQ ID NO.1, and the nucleotide sequence of the ERF1 gene is shown as SEQ ID NO. 2.

The method for enhancing the resistance of tomatoes to the root knot nematodes comprises the following steps:

(1) Constructing a vector for knocking out or silencing the MED25 gene or the ERF1 gene;

(2) Introducing the vector for knocking out or silencing the MED25 gene or the ERF1 gene constructed in the step (1) into a rice cell, and silencing or knocking out the MED25 gene with a nucleotide sequence shown as SEQ ID NO.1 or the ERF1 gene with a nucleotide sequence shown as SEQ ID NO.2, thereby obtaining a transgenic plant after culture.

Specifically, in step (1), the vector is pCAMBIA1301.

Specifically, in the step (2), after transferring a vector for silencing or knocking out the MED25 gene or the ERF1 gene into agrobacterium genetic engineering bacteria, infecting rice cells. The agrobacterium genetic engineering bacteria are agrobacterium EHA105 strains.

The invention has the beneficial effects that:

compared with wild plants, the invention has the advantages that the number of root knots is obviously reduced by knocking out the MED25 gene or the ERF1 gene in the tomatoes, and the expression of the defense gene PDF1.2a/b is limited, so that the ERF1 or the MED25 positively regulates the resistance of the tomatoes to the meloidogyne incognita.

Drawings

FIG. 1 is an alignment of the amino acid sequences of AtERF1, atORA59 in Arabidopsis and ERF1 in tomato.

FIG. 2 is a graph showing the analysis of ERF1 expression level of wild tomato Ailsa Craig at different time points of root knot nematode inoculation of 0h,24h,48h,72 h.

FIG. 3 is a graph of ERF1 interaction results with MED 25; 3A is a yeast result diagram, and 3B is a bimolecular fluorescence complementation result diagram.

FIG. 4 is a graph of sequencing results using CRISPR/Cas9 to generate both erf1 (A) and med25 (B) mutants.

FIG. 5 is a graph showing gene expression of PDF1.2a/b in wild type, erf1 mutant and med25 mutant.

FIG. 6 is a plot of root knot nematode phenotype observations 5 weeks after tomato plant inoculation with root knot nematodes; a is a representative acid fuchsin staining result of plant root, scale = 1cm; b is the root knot count statistics of A.

Detailed Description

Example 1

Total RNA extraction and gene expression analysis.

1. Tomato total RNA extraction

Tomato (Ailsa Craig) can be purchased through ucdavis seed library (website links: https:// tgrc. Ucdavis. Edu /) links); total RNA from tomato roots was extracted using Tiangen Plant total RNA extraction kit:

(1) Grinding 0.1g root sample in liquid nitrogen, adding 1mL of lysate RZ, and mixing by vortex;

(2) Centrifuging at 12000rpm at 4deg.C for 5min, and removing supernatant;

(3) 200 mu L of chloroform is added, and the mixture is vigorously shaken for 15s and left at room temperature for 3min;

(4) Centrifugation at 12000rpm for 10min at 4℃the samples were divided into three layers: a yellow organic phase, an intermediate layer and a colorless aqueous phase, transferring the aqueous phase to a new tube for the next operation;

(5) Adding 0.5 times volume of absolute ethyl alcohol, uniformly mixing, transferring into an adsorption column CR3, centrifuging at 12000rpm for 30s at 4 ℃, and discarding the waste liquid in a collecting pipe;

(6) Adding 500 mu L deproteinized solution RD into an adsorption column CR3, centrifuging at 4 ℃ and 12000rpm for 30s, and discarding the waste liquid;

(7) Adding 600 mu L of rinsing liquid RW into an adsorption column CR3, standing at room temperature for 2min, centrifuging at 4 ℃ and 12000rpm for 30s, and discarding the waste liquid;

(8) Repeating the operation step (8);

(9) Placing the adsorption column into a 2mL collecting pipe, centrifuging at 12000rpm for 2min at 4 ℃ to remove residual waste liquid;

(10) Drying the adsorption column in an ultra clean bench for 5min, transferring into a new RNase-Free centrifuge tube, adding 50 μl of RNase-Free ddH ₂ O, standing at room temperature for 2min, and centrifuging at 12000rpm for 2min at 4 ℃;

(11) Determination of OD with ultraviolet Spectrophotometer ₂₆₀ /OD ₂₈₀ And (5) detecting the content and purity of the RNA sample.

2. Real-time fluorescence quantitative PCR (qRT-PCR)

By using

480 II Real-Time PCR detection system (Roche, swiss) and using SYBR Green PCR Master Mix (Takara, RR 420A), PCR reaction conditions were: 3min at 95 ℃; denaturation at 95℃for 15s, annealing at 58℃for 15s, elongation at 72℃for 30s,40 cycles. Fluorescence data were collected at the end of extension of each cycle. The tomato Actin and Ubiquitin3 genes were used as internal reference, and gene-specific primers were designed based on the sequence of the cDNA, the sequences of each primer being shown in the following table. The relative gene expression level was calculated by the method of Livak and Schmittgen (2001).

MYC2 and ERF are two core switches that play an antagonistic role in JA-mediated resistance to different biotic stresses. MED25 is a subunit of the mediator transcriptional coactivation complex that physically interacts with MYC2 and ERF to form a functional transcriptional complex that regulates JA response gene expression. In one previous study, applicants found that MYC2 negatively affected tomato RKN defenses. Therefore, we hypothesize that JA may regulate RKN resistance through the ERF pathway. By sequence alignment, we found tomato ERF1 (Solyc 09g 089930) to be a homologous protein to arabidopsis ORA59 (fig. 1), and found that infection by root knot nematodes induced expression of ERF1 (fig. 2), indicating that ERF1 may be involved in regulation of root knot nematodes.

Table 1 real-time fluorescent quantitative PCR primers

Gene name	Forward primer (5 '-3')	Reverse primer (5 '-3')
			Actin	TGTCCCTATTTACGAGGGTTATGC	CAGTTAAATCACGACCAGCAAGAT
Ubiquitin3	GCCGACTACAACATCCAGAAGG	TGCAACACAGCGAGCTTAACC
			PDF1.2a	ATTTGCAAAGCACCAAGCCAAAC	CATCATAATCTCTTCTTCAAGCA
PDF1.2b	ACTTATGGTCTTGGCAATGGTGCT	AGTTTGCTACAATGTCCACCTGTA
			ERF1	GTGCGTCAAGGAGATCAACA	ACAGCACTCTGGCTTCTTCT

Example 2

1. Yeast two-hybrid verification of ERF1 interaction with MED25

Specific primers were designed based on the full length of CDS of MED25 and ERF1 genes (see Table 2) and PCR amplification was performed using tomato cDNA as template. The PCR product was digested with EcoRI and SalI and ligated into the yeast expression vector pGBKT7 (BD-MED 25). The PCR product was digested with BamHI and SacI and ligated into the yeast expression vector pGADT7 (AD-ERF 1). BD-MED25 and AD-ERF1 vectors were co-transformed into yeast strain Y2H, 50. Mu.L of the transformed strain was spotted on plates of SD-Leu-Trp (SD-L/T) and SD-Leu-Trp-Ade-His (SD-L/T/A/H), and the resultant was placed in an incubator at 28℃for 2-4d, and the growth of yeast was recorded (FIG. 3A).

TABLE 2 Yeast two-hybrid vector primers

Carrier body	Sequence(s)
		AD-ERF1-F	atggccatggaggccgaattcATGGATTCTTCTTCTTCTTCATCTCA
AD-ERF1-R	ccgctgcaggtcgacggatccCCATGGACTAAAATAAGTTGCATCA
		BD-MED25-F	atggccatggaggccgaattcATGGTGGACAAACTGATCGTCG
BD-MED25-R	ccgctgcaggtcgacggatccATTCATAAACCCGCCTCCTGG

2. Bimolecular fluorescence complementation (BiFC) technique to verify ERF1 interaction with MED25

For the BiFC assay, specific primers were designed based on the full length of MED25 and ERF1 gene CDS, and PCR amplification was performed using tomato cDNA as template. The PCR products were digested with PacI and SpeI, ERF1-cYFP and MED25-nYFP vectors (specific primers shown in Table 3) were constructed, and Agrobacterium-infected tobacco was used for the two-molecule fluorescent complementation experiments. Subcellular localization of YFP or mCherry signals in the leaves after 48 hours of penetration was determined using a Zeiss LSM 780 confocal microscope with excitation/emission wavelengths of 514nm/520-560nm and excitation/radiation wavelengths of mCherry of 561nm/580-620nm. As shown in FIG. 3, MED25 was fused to the N-terminus of Yellow Fluorescent Protein (YFP), and ERF1 was fused to the C-terminus of Yellow Fluorescent Protein (YFP). When fused ERFl-cYFP and MED25-nYFP were co-injected into tobacco leaves for expression, biFC signals were detected in transformed tobacco cells, and the above results indicate that ERF1 interacted with MED 25.

TABLE 3 bimolecular fluorescent complementary vector primer

Carrier body	Sequence(s)
		ERF1-cYFP-F	atttacgaacgatagttaattaacATGGATTCTTCTTCTTCTTCATCTCA
ERF1-cYFP-R	actgccacctcctccactagtCCATGGACTAAAATAAGTTGCATCA
		MED25-nYFP-F	atttacgaacgatagttaattaacATGGTGGACAAACTGATCGTCG
MED25-nYFP-R	actgccacctcctccactagtATTCATAAACCCGCCTCCTGG

Example 3

Construction of med25 mutant and erf1 mutant plants.

Firstly, extracting total RNA from young root systems of wild tomatoes; reversely transcribing the obtained tomato total RNA into cDNA; the CRISPR-P website (http:// cbi.hzau.edu.cn/cgi-bin/CRISPR) was used to design the sgRNA sequence as follows (ERF 1-sgRNA: TCCGAAGAGATGCTTCTCTT; MED25-sgRNA1: ATAGTGCTTGCCTGGTTCAG; MED25-sgRNA2: ACATGGATACCTTTTTGCAG). The synthesized sequence was annealed and inserted into the BbsI site of AtU6-sgRNA-AtOBQ-Cas9 vector, and AtU-sgRNA-AtoBQ-Cas 9box was inserted into the HindIII and KpnI sites of pCAMBIA1301 binary vector. All the resulting plasmids described above were transformed into Agrobacterium tumefaciens EHA105 strain, respectively, and infected into AC cotyledons. Transformed plants were selected based on hygromycin resistance and knockouts were identified by sequencing the PCR amplicons of the target loci. The PCR products were sequenced by Hangzhou Kangzhou Biotechnology, the sequencing results are shown in FIG. 4, the sequence alignment was performed using BioXM software (V2.7), tomato cotyledons were infected by Agrobacterium-mediated infection, the target vector was transformed into tomato cotyledons, and candidate plants were initially screened using hygromycin. Independent med25 mutants and erf1 mutants were screened for experiments using the pair of forward and reverse primers (M13F: tgtaaaacgacggccagt; M36-R: ggtattggtttatctcatcggaactgca) for hygromycin gene sequences. Meanwhile, the applicant studies found that tomato plants co-knocked out of the med25 and erf1 genes were not viable.

1) Culture of aseptic seedlings

The tomato seeds are shaken for 6-8 h at a temperature of 28 ℃ in a shaking table of 200r/min, then sterilized for 30s by 75% alcohol, then sterilized for 15min in 10% NaClO, washed 3 times by sterilized distilled water and transferred to a sterilizing vessel, and inoculated in a 1/2MS culture medium. Culturing in dark at 25deg.C until the white color is exposed, and culturing under light.

2) Preparation of explants and cultivation of Agrobacterium

When the cotyledon stretches and the true cotyledon does not grow, the cotyledon is cut into two sections by a new scalpel, and the cotyledon is spread in a nursing culture medium for pre-culture for 24 hours (in the dark). Single colonies of Agrobacterium were picked on LB plates containing antibiotics and inoculated into 30mL of LB containing antibiotics and cultured overnight at 28℃at 200r/min to mid-log (OD 600. Apprxeq.1.0, about 16-24 h).

3) Conversion regeneration

Activating the engineering bacteria liquid of the agrobacterium tumefaciens containing the target carrier plasmid on a YEB plate containing antibiotics, picking single colony of the agrobacterium tumefaciens, inoculating the single colony into 2mL YEB containing antibiotics, shaking at 28 ℃ and 200rpm for overnight culture, and performing shake culture according to the proportion of 1:100 until OD ₆₀₀ =0.8 to 1.0. And infecting the precultured cotyledon explant for 2-3 min in a dark place, then sucking the residual bacterial liquid, transferring the residual bacterial liquid to a sterilizing filter paper, spreading the residual bacterial liquid back to the original nursing culture medium in an upward reverse side, and performing dark co-culture at 22 ℃ for 48h. Transferring the co-cultured explant onto 2Z medium with right side upwards, replacing fresh 2Z medium every two weeks, cutting off the browned explant after differentiation and bud emergence, and transferring the differentiated bud into 0.2Z medium for selective culture.

4) Rooting culture and transplanting

And (5) putting the plant into a rooting culture medium to root when the regenerated buds grow to about 1 em. Hardening off and transplanting the transformed seedlings after 2 weeks to obtain tomato med25 mutant and erf1 mutant plants.

Example 5

Resistance assays were performed on med25 mutants and erf1 mutants.

The tomato med25 mutant and erf1 mutant plants obtained were treated with root knot nematode inoculation.

Wild type WT, med25 mutant and erf1 mutant plants were split equally into two groups, one control group (no root knot nematode treatment) and one experimental group (root knot nematode inoculation).

When tomatoes grow to five leaves and one heart, the experimental group is subjected to nematode inoculation treatment, and each plant is inoculated with about 1000J 2 nematodes, and normal watering is performed during the period.

Plants were grown in plastic cups containing autoclaved river sand, each time with Hoagland nutrient solution. The growth conditions are as follows: day and night temperatureDegree 23 ℃/20 ℃,14h photoperiod and 600 mu mol m ^-2 s ^-1 The intensity of the illumination. The nematode treatment time was 5 weeks. At the end of the experiment, samples were taken and the relevant index was determined.

The observation method of root knot number is as follows:

the acid fuchsin staining method is used for root phenotype observation of root knot nematode infection:

(1) Washing the tomato root system infected by the root knot nematode with tap water, bleaching the tomato root system with 1% sodium hypochlorite solution for 5 minutes, and repeatedly washing the tomato root system with tap water until no pungent taste exists;

(2) Absorbing the root system water by using absorbent paper, soaking in 3.5% acid fuchsin solution, heating and boiling, and cooling at room temperature;

(3) Washing the root system with tap water to remove excessive fuchsin liquid on the surface;

(4) Placing the root system into normal-temperature acidic glycerol for preservation;

(5) Photographing and counting root knot number after 24 hours.

To verify whether MED25 or ERF1 was involved in tomato resistance to RKN, tomato MED25 and ERF1 mutant plants were generated by CRISPR-Cas9 system, and 1000 hatched J2 larvae were inoculated per tomato with MED25 mutant and ERF1 mutant and wild type WT control plants as experimental materials, and the detection of defensive gene expression revealed that root knot nematodes induced expression of pdf1.2a/b in wild type, while being restricted in MED25 mutant and ERF1 mutant (fig. 5). Meanwhile, after 5 weeks of culture, the med25 mutant and erf1 mutant were found to have significantly reduced numbers of root knots compared to the wild type, and the difference was clearly seen from root system fuchsin staining results (fig. 6). Thus, these findings demonstrate that both ERF1 and MED25 positively regulate tomato resistance to meloidogyne incognita.

Claims (10)

1. Use of a tomato gene, said tomato gene being an MED25 gene or an ERFl gene, for increasing resistance of tomato to root knot nematodes.

2. The use according to claim 1, wherein the MED25 gene has a nucleotide sequence shown in SEQ ID No.1 and the ERF1 gene has a nucleotide sequence shown in SEQ ID No. 2.

3. Use of a protein encoded by a tomato gene, which is a protein encoded by an MED25 gene or a protein encoded by an ERF1 gene, for enhancing resistance of tomato to root knot nematodes.

4. The use according to claim 1, wherein the MED25 gene encodes a protein having the amino acid sequence shown in SEQ ID No.3 and the ERF1 gene encodes a protein having the amino acid sequence shown in SEQ ID No. 4.

5. A method for enhancing resistance of tomato to root knot nematode, characterized in that MED25 gene or ERF1 gene in tomato is silenced or knocked out.

6. The method for enhancing resistance of tomato to root-knot nematode according to claim 5, wherein the nucleotide sequence of said MED25 gene is shown in SEQ ID No.1 and the nucleotide sequence of ERF1 gene is shown in SEQ ID No. 2.

7. A method of enhancing resistance of tomatoes to root knot nematodes as claimed in claim 5, comprising the steps of:

(1) Constructing a vector for knocking out or silencing the MED25 gene or the ERF1 gene;

(2) Introducing the vector for knocking out or silencing the MED25 gene or the ERF1 gene constructed in the step (1) into a rice cell, and silencing or knocking out the MED25 gene with a nucleotide sequence shown as SEQ ID NO.1 or the ERF1 gene with a nucleotide sequence shown as SEQ ID NO.2, thereby obtaining a transgenic plant after culture.

8. The method of claim 7, wherein in step (1) the vector is pCAMBIA1301.

9. The method for enhancing resistance of tomato to root-knot nematode according to claim 7, wherein in the step (2), the vector for silencing or knocking out MED25 gene or ERF1 gene is transferred into agrobacterium genetically engineered bacterium to infect rice cells.

10. The method for enhancing resistance of tomato to root knot nematodes as claimed in claim 9, wherein said agrobacterium genetically engineered bacterium is agrobacterium EHA105 strain.

Images